Application of detection combination of antibody and homo-tetramer nucleic acid aptamer in detection of biomarker

Abstract

The invention provides application of a detection combination of an antibody and a homo-tetramer nucleic acid aptamer in detection of a biomarker. On the basis of an RPA-CRISPR / Cas12a system, an antibody-homo-tetramer nucleic acid aptamer detection combination is used for detecting a biomarker, and the high specificity of an antibody, the strong signal amplification capability of a homo-tetramer nucleic acid aptamer and the high-sensitivity detection technology of the RPA-CRISPR / Cas12a are combined; the method realizes simple, hypersensitive and rapid simultaneous detection and analysis of multiple biomarkers to be detected in a sample to be detected, needs common instruments, is simple and convenient to operate, is suitable for wide popularization and application, and solves the problems of long detection time, dependence on complex equipment and high detection cost of a current high-sensitivity detection method.

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection, and particularly to the application of a detection combination of an antibody and a homologous tetrameric nucleic acid aptamer in detecting a biomarker. Background Art

[0002] Currently, it is still extremely challenging to detect low-abundance protein biomarkers based on traditional immunological detection methods. This is because these low-abundance biomarkers such as myocardial infarction biomarker cardiac troponin I (cTnI), cardiac troponin I-C complex (cTnI-C), and Alzheimer's disease (AD) biomarker Aβ 42 and p-tau have extremely low contents in blood at the early stage of the disease, which have exceeded the lowest detection limit of traditional immunological detection, and thus cannot meet the requirements for early and accurate detection of the disease. In addition, these biomarkers often lack specificity and are widely distributed in various diseases. Therefore, the combined diagnosis of multiple biomarkers is crucial for improving the accuracy of disease diagnosis.

[0003] Although several high-sensitivity detection technologies based on antibody pairs have been developed, such as single-molecule immunoarray, ultrasensitive electrochemiluminescence, immunoprecipitation mass spectrometry (IP-MS), and Olink proteomics, they have disadvantages such as high equipment requirements, expensive detection costs, and long processing times, which limit their application in early large-scale screening. Currently, there is a lack of a simple, convenient, highly sensitive detection technology that does not rely on complex instruments and can simultaneously detect multiple biomarkers.

[0004] Therefore, how to develop a simple, convenient, highly sensitive detection technology that does not rely on complex instruments and can simultaneously detect multiple biomarkers (>3 biomarkers), and can be commercialized and has the potential to be applied to rapid detection and analysis within the community, is of great significance for the early rapid screening of AD and other multi-pathogenic factor diseases and the prediction of disease progression.

[0005] A nucleic acid aptamer is a molecular probe with the recognition function of a traditional antibody, usually composed of DNA or RNA. Compared with traditional antibodies, nucleic acid aptamers have the advantages of simple synthesis, low cost, high stability, and can achieve signal amplification through nucleic acid amplification methods such as recombinase polymerase amplification and loop-mediated isothermal amplification technology. However, the application of nucleic acid aptamers in actual detection still faces some challenges: such as poor specificity and low sensitivity.

[0006] Therefore, combining the high specificity and rapid recognition of antibodies with the nucleic acid signal amplification ability of nucleic acid aptamers, it is of great significance to develop a detection combination based on antibody-nucleic acid aptamer to achieve convenient, economical, accurate, and highly sensitive detection of multiple biomarkers. Summary of the Invention

[0007] The present invention provides an application of a detection combination of an antibody and a homologous tetrameric nucleic acid aptamer in detecting a biomarker, which solves at least the above technical problems existing in the prior art.

[0008] According to the first aspect of the present invention, there is provided an application of a detection combination of an antibody and a monomeric nucleic acid aptamer in detecting a biomarker or in preparing a product for detecting a biomarker, wherein the antibody is an antibody that recognizes the biomarker to be detected, and the monomeric nucleic acid aptamer is a monomeric nucleic acid aptamer that specifically recognizes the biomarker to be detected.

[0009] In one implementable manner, the detection is performed based on the RPA-CRISPR / Cas12a system.

[0010] According to the second aspect of the present invention, there is provided an application of a detection combination of an antibody and a homologous tetrameric nucleic acid aptamer in detecting a biomarker or in preparing a product for detecting a biomarker, wherein the antibody is an antibody of the biomarker to be detected, and the homologous tetrameric nucleic acid aptamer is obtained by assembling a biotin-labeled monomeric nucleic acid aptamer that recognizes the biomarker to be detected through a biotin-streptavidin system.

[0011] In one implementable manner, the detection is performed based on the RPA-CRISPR / Cas12a system.

[0012] In one implementable manner, the assembly includes the following steps: mixing a biotin-modified monomeric nucleic acid aptamer and streptavidin at a molar ratio of 4:1, incubating at 37 °C for 0.5-2 hours or at room temperature (20-25 °C) for 0.5-6 hours or at 4 °C for 8-16 hours to obtain a homologous tetrameric nucleic acid aptamer.

[0013] According to the third aspect of the present invention, there is provided a composition for detecting a biomarker based on the RPA-CRISPR / Cas12a system, the composition comprising an antibody, a monomeric nucleic acid aptamer or a homologous tetrameric nucleic acid aptamer; wherein, the antibody is an antibody of the biomarker to be detected, the monomeric nucleic acid aptamer is a monomeric nucleic acid aptamer that contains a CRISPR Cas12a PAM recognition site and specifically recognizes the biomarker to be detected, and the homologous tetrameric nucleic acid aptamer is obtained by assembling a biotin-labeled monomeric nucleic acid aptamer that contains a CRISPR Cas12a PAM recognition site and recognizes the biomarker to be detected through a biotin-streptavidin system.

[0014] In one implementable manner, the assembly includes the following steps: Mixing a biotinylated monomeric nucleic acid aptamer and streptavidin in a molar ratio of 4:1, incubating at 37 °C for 0.5 - 2 hours or at room temperature (20 - 25 °C) for 0.5 - 6 hours or at 4 °C for 8 - 16 hours to obtain a homotetrameric nucleic acid aptamer.

[0015] According to the fourth aspect of the present invention, there is provided a kit for detecting a biomarker based on the RPA-CRISPR / Cas12a system, comprising an antibody, a monomeric nucleic acid aptamer or a homotetrameric nucleic acid aptamer, magnetic beads, an RPA primer pair, a crRNA, CRISPR Cas12a, and a fluorescent reporter molecule; wherein, the antibody is an antibody against the biomarker to be detected, the monomeric nucleic acid aptamer is a monomeric nucleic acid aptamer containing a CRISPR Cas12a PAM recognition site and specifically recognizing the biomarker to be detected, the homotetrameric nucleic acid aptamer is obtained by assembling a biotin-labeled monomeric nucleic acid aptamer containing a CRISPR Cas12a PAM recognition site and recognizing the biomarker to be detected through the biotin-streptavidin system, the magnetic beads are used to modify the antibody, the RPA primer pair is used to amplify the monomeric nucleic acid aptamer or the homotetrameric nucleic acid aptamer, the crRNA is used to recognize the RPA amplification product of the monomeric nucleic acid aptamer or the homotetrameric nucleic acid aptamer, and the fluorescent reporter molecule can be cleaved by CRISPR Cas12a.

[0016] In one implementable manner, the biomarker to be detected is cTnI, cTnI-C, Aβ 42 or p-tau, wherein the p-tau is p-tau 181 、p-tau 217 、p-tau 231 or p-tau 396,404 and is one of them;

[0017] When detecting biomarker cTnI and / or cTnI-C, the kit includes cTnI and / or cTnI-C antibodies, magnetic beads for modifying cTnI and / or cTnI-C antibodies, monomeric nucleic acid aptamer 1 that contains a CRISPR Cas12a PAM recognition site and recognizes cTnI and cTnI-C, or a homotetrameric nucleic acid aptamer 1 assembled from a biotin-labeled monomeric nucleic acid aptamer 1 that contains a CRISPR Cas12a PAM recognition site and recognizes cTnI and cTnI-C through the biotin-streptavidin system, RPA primer pair 1 for amplifying monomeric nucleic acid aptamer 1 or homotetrameric nucleic acid aptamer 1, crRNA1 for recognizing the RPA amplification product of monomeric nucleic acid aptamer 1 or homotetrameric nucleic acid aptamer 1, CRISPR Cas12a, and a fluorescent reporter molecule that can be cleaved by CRISPR Cas12a;

[0018] When detecting biomarker Aβ 42 the kit includes Aβ 42 antibodies, magnetic beads for modifying Aβ 42 antibodies, monomeric nucleic acid aptamer 2 that contains a CRISPR Cas12a PAM recognition site and recognizes Aβ 42 or a homotetrameric nucleic acid aptamer 2 assembled from a biotin-labeled monomeric nucleic acid aptamer 2 that contains a CRISPR Cas12a PAM recognition site and recognizes Aβ 42 through the biotin-streptavidin system, RPA primer pair 2 for amplifying monomeric nucleic acid aptamer 2 or homotetrameric nucleic acid aptamer 2, crRNA2 for recognizing the RPA amplification product of monomeric nucleic acid aptamer 2 or homotetrameric nucleic acid aptamer 2, CRISPR Cas12a, and a fluorescent reporter molecule that can be cleaved by CRISPR Cas12a;

[0019] When detecting biomarker p-tau, the kit includes p-tau antibodies, magnetic beads for modifying p-tau antibodies, monomeric nucleic acid aptamer 3 that contains a CRISPR Cas12a PAM recognition site and recognizes p-tau, or a homotetrameric nucleic acid aptamer 3 assembled from a biotin-labeled monomeric nucleic acid aptamer 3 that contains a CRISPR Cas12a PAM recognition site and recognizes p-tau through the biotin-streptavidin system, RPA primer pair 3 for amplifying monomeric nucleic acid aptamer 3 or homotetrameric nucleic acid aptamer 3, crRNA3 for recognizing the RPA amplification product of monomeric nucleic acid aptamer 3 or homotetrameric nucleic acid aptamer 3, CRISPR Cas12a, and a fluorescent reporter molecule that can be cleaved by CRISPR Cas12a;

[0020] When detecting biomarker cTnI or cTnI-C and Aβ 42 the kit includes antibodies against cTnI or cTnI-C and Aβ 42 magnetic beads for modifying antibodies against cTnI or cTnI-C and Aβ 42 monomeric nucleic acid aptamers 1 and 2 containing CRISPR Cas12a PAM recognition sites and recognizing cTnI or cTnI-C and Aβ 42 or homologous tetrameric nucleic acid aptamers 1 and 2 assembled by the biotin-streptavidin system from biotin-labeled monomeric nucleic acid aptamers 1 and 2 containing CRISPR Cas12a PAM recognition sites and recognizing cTnI or cTnI-C and p-tau, RPA primer pairs 1 and 2 for amplifying monomeric nucleic acid aptamers or homologous tetrameric nucleic acid aptamers, and crRNA1 and crRNA2 containing for recognizing RPA amplification products of monomeric nucleic acid aptamers 1 and 2 or homologous tetrameric nucleic acid aptamers 1 and 2, CRISPR Cas12a, and a CRISPR array of a fluorescent reporter molecule cleavable by CRISPR Cas12a;

[0021] When detecting biomarker cTnI or cTnI-C and p-tau, the kit includes antibodies against cTnI or cTnI-C and p-tau, magnetic beads for modifying antibodies against cTnI or cTnI-C and p-tau, monomeric nucleic acid aptamers 1 and 3 containing CRISPR Cas12a PAM recognition sites and recognizing cTnI or cTnI-C and p-tau

[0022] or homologous tetrameric nucleic acid aptamers 1 and 3 assembled by the biotin-streptavidin system from biotin-labeled monomeric nucleic acid aptamers 1 and 3 containing CRISPR Cas12a PAM recognition sites and recognizing cTnI or cTnI-C and p-tau, RPA primer pairs 1 and 3 for amplifying monomeric nucleic acid aptamers or homologous tetrameric nucleic acid aptamers, and crRNA1 and crRNA3 containing for recognizing RPA amplification products of monomeric nucleic acid aptamers 1 and 3 or homologous tetrameric nucleic acid aptamers 1 and 3, CRISPR Cas12a, and a CRISPR array of a fluorescent reporter molecule cleavable by CRISPR Cas12a;

[0022] When detecting biomarker Aβ 42 and p-tau, the kit includes antibodies against Aβ 42 and p-tau, magnetic beads for modifying antibodies against Aβ 42 and p-tau, monomeric nucleic acid aptamers 2 and 3 containing CRISPR Cas12a PAM recognition sites and recognizing Aβ 42 and p-tau42 The biotinylated monomeric nucleic acid aptamers 2 and 3 of p-tau, the homologous tetrameric nucleic acid aptamers 2 and 3 assembled through the biotin-streptavidin system, the RPA primer pairs 2 and 3 for amplifying the monomeric nucleic acid aptamers or homologous tetrameric nucleic acid aptamers, and the crRNAs 2 and 3, CRISPR Cas12a, and the CRISPR array of the fluorescent reporter molecule that can be cleaved by CRISPR Cas12a, which contain the RPA amplification products for recognizing the monomeric nucleic acid aptamers 2 and 3 or homologous tetrameric nucleic acid aptamers 2 and 3;

[0023] When detecting the biomarkers cTnI or cTnI-C, Aβ 42 and p-tau, the kit includes cTnI or cTnI-C, Aβ 42 and p-tau antibodies, magnetic beads for modifying the cTnI or cTnI-C, Aβ 42 and p-tau antibodies, the monomeric nucleic acid aptamers 1, 2, and 3 containing the CRISPR Cas12a PAM recognition site and recognizing cTnI or cTnI-C, Aβ 42 and p-tau, or the biotinylated monomeric nucleic acid aptamers 1, 2, and 3 containing the CRISPR Cas12a PAM recognition site and recognizing cTnI or cTnI-C, Aβ 42 and p-tau, the homologous tetrameric nucleic acid aptamers 1, 2, and 3 assembled through the biotin-streptavidin system, the RPA primer pairs 1, 2, and 3 for amplifying the monomeric nucleic acid aptamers or homologous tetrameric nucleic acid aptamers, and the crRNAs 1, 2, and 3, CRISPR Cas12a, and the CRISPR array of the fluorescent reporter molecule that can be cleaved by CRISPR Cas12a, which contain the RPA amplification products for recognizing the monomeric nucleic acid aptamers 1, 2, and 3 or homologous tetrameric nucleic acid aptamers 1, 2, and 3.

[0024] In a preferred embodiment, the sequence of the monomeric nucleic acid aptamer 1 is as shown in SEQ ID NO.1, the sequence of the monomeric nucleic acid aptamer 2 is as shown in SEQ ID NO.2, and the sequence of the monomeric nucleic acid aptamer 3 is as shown in SEQ ID NO.3.

[0025] In a preferred embodiment, each primer in the RPA primer pair has a length of 20 - 45 bases; the sequence of the RPA primer pair 1 is as shown in SEQ ID NO.4 and SEQ ID NO.5, the RPA primer pair 2 is as shown in SEQ ID NO.6 and SEQ ID NO.7, and the RPA primer pair 3 is as shown in SEQ ID NO.8 and SEQ ID NO.9.

[0026] In a preferred embodiment, the length of the crRNA is 40 to 60 bases; the sequence of crRNA1 is as shown in SEQ ID NO.10, the sequence of crRNA2 is as shown in SEQ ID NO.11, and the sequence of crRNA3 is as shown in SEQ ID NO.12.

[0027] In an implementable embodiment, the magnetic beads are superparamagnetic magnetic beads modified with protein A, carboxyl or N-hydroxysuccinimide; the magnetic beads can be replaced with enzyme-linked immunosorbent assay (ELISA) plates, chips, and other media that can modify antibodies.

[0028] In an implementable embodiment, the length of the fluorescent reporter molecule is 4 to 10 bases; the fluorescent reporter molecule is 5’-FAM-PAM-BQH-3’, 5’-FITC-PAM-Dig-3’, 5’-Cy3-PAM-Dig-3 or 5’-Cy5-PAM-Dig-3’.

[0029] In an implementable embodiment, the CRISPR Cas12a is Lba Cas12 (Cpf1).

[0030] In an implementable embodiment, the PAM sequence is FAM-TTTNTTTN-BQM (N represents A, T, C, G). In a specific embodiment, the PAM sequence is TTTTT.

[0031] In an implementable embodiment, the kit further includes other recombinase polymerase amplification (RPA) reagents and CRISPR detection reagents.

[0032] In a specific embodiment, the other RPA reagents are TwistAmp TM Liquid Basic Kit, including 2×Reaction buffer, 10×Basic E-mix, dNTP, 20×Core Reaction Mix, and MgOAc, etc.

[0033] In a specific embodiment, the other CRISPR detection reagents are nuclease-free water, 10×NEB buffer, RNA inhibitor, etc.

[0034] According to the fifth aspect of the present invention, there is provided a method for simultaneously detecting multiple biomarkers for non-diagnostic purposes using the above-mentioned composition or kit, including the following steps:

[0035] Modifying antibodies of different biomarkers to be detected with magnetic beads to obtain magnetic beads with different modified antibodies;

[0036] Magnetic beads modified with different antibodies are simultaneously added to the sample to be tested for enrichment of the biomarker to be tested, and an antibody-magnetic bead-biomarker complex is obtained;

[0037] Different monomeric nucleic acid aptamers or homologous tetrameric nucleic acid aptamers are simultaneously added to the magnetic bead-biomarker complex to obtain an antibody-magnetic bead-biomarker@monomeric nucleic acid aptamer complex or an antibody-magnetic bead-biomarker@homologous tetrameric nucleic acid aptamer complex;

[0038] The antibody-magnetic bead-biomarker@monomeric nucleic acid aptamer complex or the antibody-magnetic bead-biomarker@homologous tetrameric nucleic acid aptamer complex is added to a reagent containing an RPA primer pair for amplifying different monomeric nucleic acid aptamers or homologous tetrameric nucleic acid aptamers for multiplex RPA amplification reaction to obtain an RPA amplification product;

[0039] The RPA amplification product is respectively added to an array of reagents containing different crRNAs, fluorescent reporter molecules, and CRISPR Cas12a for CRISPR detection, and the fluorescence signal is recorded;

[0040] Detection and analysis of multiple biomarkers are achieved by the fluorescence signals of different crRNA arrays for simultaneous detection.

[0041] In an implementable embodiment, the sample to be tested is blood, plasma, blood cells, exosomes or cerebrospinal fluid.

[0042] In an implementable embodiment, the conditions for the multiplex RPA amplification reaction are incubation at 37-42 °C for 10-60 minutes. In a specific embodiment, the conditions for the multiplex RPA amplification reaction are incubation at 37 °C for 30 minutes.

[0043] In an implementable embodiment, the conditions for the CRISPR detection are incubation at 37-42 °C for 10-60 minutes. In a specific embodiment, the conditions for the RPA amplification reaction are incubation at 37 °C for 60 minutes.

[0044] According to the sixth aspect of the present invention, there is provided a method for detecting a biomarker using the above composition or kit for non-diagnostic purposes, comprising the following steps:

[0045] Use magnetic beads to modify the antibody of the biomarker to be tested to obtain magnetic beads modified with the antibody;

[0046] Add the magnetic beads modified with the antibody to the sample to be tested for enrichment of the biomarker to be tested, and obtain an antibody-magnetic bead-biomarker complex;

[0047] Add a monomeric nucleic acid aptamer or a homotetrameric nucleic acid aptamer to the magnetic bead-biomarker complex to obtain an antibody-magnetic bead-biomarker@monomeric nucleic acid aptamer complex or an antibody-magnetic bead-biomarker@homotetrameric nucleic acid aptamer complex;

[0048] The antibody-magnetic bead-biomarker@monomeric nucleic acid aptamer complex or the antibody-magnetic bead-biomarker@homotetrameric nucleic acid aptamer complex is subjected to an RPA amplification reaction using an RPA primer pair to obtain an RPA amplification product;

[0049] Add the RPA amplification product to a reagent containing crRNA, a fluorescent reporter molecule, and CRISPR Cas12a for CRISPR detection, and record the fluorescence signal;

[0050] Through the detection of the fluorescence signal, the detection and analysis of the biomarker are realized.

[0051] In one implementable embodiment, the sample to be tested is blood, plasma, blood cells, exosomes, or cerebrospinal fluid.

[0052] In one implementable embodiment, the conditions for the RPA amplification reaction are incubation at 37-42 °C for 10-60 minutes. In a specific implementation, the conditions for the RPA amplification reaction are incubation at 37 °C for 30 minutes.

[0053] In one implementable embodiment, the conditions for the CRISPR detection are incubation at 37-42 °C for 10-60 minutes. In a specific implementation, the conditions for the RPA amplification reaction are incubation at 37 °C for 60 minutes.

[0054] According to one implementable embodiment of the present invention, it has at least the following beneficial effects:

[0055] 1. The present invention uses an antibody-homotetrameric nucleic acid aptamer detection combination to detect biomarkers based on the RPA-CRISPR / Cas12a system. The monomeric nucleic acid aptamer is assembled into a homotetrameric nucleic acid aptamer through the biotin-streptavidin system, which not only improves the binding affinity of the nucleic acid aptamer but also increases the signal amplification ability of the nucleic acid aptamer.

[0056] 2. The present invention uses an antibody-homotetrameric nucleic acid aptamer detection combination to detect biomarkers based on the RPA-CRISPR / Cas12a system, and uses an immunocapture strategy to achieve high-sensitivity detection and specific recognition of the biomarker to be tested (such as cTnI, cTnI-C, Aβ 42 、p-tau) in the clinically relevant concentration range.

[0057] 3. The present invention uses an antibody-homotetrameric nucleic acid aptamer detection combination based on the RPA-CRISPR / Cas12a system to detect a single biomarker. By combining the high specificity of antibodies, the strong signal amplification ability of homotetrameric nucleic acid aptamers, and the highly sensitive detection technology of RPA-CRISPR / Cas12a, it realizes simple, ultrasensitive (6.8 fg / mL), and rapid detection and analysis of the biomarker to be detected (such as cTnI, cTnI-C, Aβ 42 or p-tau) in the sample to be tested. The instruments required are common and the operation is simple, making it suitable for wide promotion and application, and solving the problems of long detection time, dependence on complex equipment, and high detection cost existing in current highly sensitive detection methods.

[0058] 4. The present invention uses an antibody-homotetrameric nucleic acid aptamer detection combination based on the RPA-CRISPR / Cas12a system to simultaneously detect multiple biomarkers. By combining the high specificity of antibodies, the strong signal amplification ability of homotetrameric nucleic acid aptamers, the multiplex RPA amplification technology, and the spatial encoding ability of the CRISPR array, it realizes simultaneous detection and analysis of multiple biomarkers to be detected (such as cTnI, cTnI-C, Aβ 42 and / or p-tau) in the sample to be tested based on a single fluorescent molecule, simply and ultrasensitively. The instruments required are common and the operation is simple, making it suitable for wide promotion and application, and solving the problems of high cost for simultaneous detection of multiple markers and complex equipment requirements existing currently.

[0059] It should be understood that the content described in this part is not intended to identify the key or important features of the embodiments of the present invention, nor is it used to limit the scope of the present invention. Other features of the present invention will become easily understood through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] By reading the following detailed description with reference to the accompanying drawings, the above and other objects, features, and advantages of the exemplary embodiments of the present invention will become easily understood. In the drawings, several embodiments of the present invention are shown in an illustrative rather than restrictive manner, where:

[0061] In the drawings, the same or corresponding reference numerals represent the same or corresponding parts.

[0062] Figure 1 The results of the antibody-monomeric nucleic acid aptamer detection combination for screening and detecting cTnI, Aβ 42 , p-tau 181 of the present invention are shown. Among them, A is a schematic diagram of screening the antibody-nucleic acid aptamer detection combination based on sandwich ELISA, B is the result of detecting cTnI or cTnI-C by combining different anti-cTnI antibodies with the anti-cTnI-C nucleic acid aptamer, and C is the anti-Aβ 42 antibody and the anti-Aβ42 Detection of Aβ by Aptamer Combinations 42 results, where D is the result of anti-tau antibody and anti-p-tau 181 Detection of p-tau by Aptamer Combinations 181 results;

[0063] Figure 2 Shows the comparison results of signal amplification between monomeric aptamers and homotetrameric aptamers of the present invention. Among them, A is the schematic diagram of the assembly of homotetrameric aptamers, B is the agarose gel electrophoresis diagram of monomeric aptamers and homotetrameric aptamers, C is the SDS-PAGE diagram of monomeric aptamers and homotetrameric aptamers, D is the CRISPR kinetic curve diagram of monomeric aptamers and homotetrameric aptamers after RPA-CRISPR, and E is the comparison result of the end-point fluorescence values of monomeric aptamers and homotetrameric aptamers after RPA-CRISPR;

[0064] Figure 3 Shows the specific evaluation results of the RPA amplification primer pair combinations of the present invention. Among them, A is the specific evaluation of the RPA primer pair for cTnI, and B is for Aβ 42 specific evaluation of the RPA primer pair, and C is for p-tau 181 specific evaluation of the RPA primer pair;

[0065] Figure 4 Shows the specific evaluation results of crRNA in the CRISPR detection of the present invention. Among them, A is the fluorescence kinetic curve diagram of the selection specificity of crRNA (cTnI) for ssDNA (cTnI), ssDNA (Aβ 42 ) and ssDNA (p-tau 181 ), B is the fluorescence kinetic curve diagram of the selection specificity of crRNA (Aβ 42 ) for ssDNA (cTnI), ssDNA (Aβ 42 ) and ssDNA (p-tau 181 ), C is the fluorescence kinetic curve diagram of the selection specificity of crRNA (p-tau 181 ) for ssDNA (cTnI), ssDNA (Aβ 42 ) and ssDNA (p-tau 181 ), D is the statistical analysis diagram of the fluorescence values of the selection specificity of different crRNAs for monomeric aptamers 1, 2 and 3, and E is the heat map analysis result of the selection specificity of different crRNAs for monomeric aptamers 1, 2 and 3;

[0066] Figure 5The results of detecting cTnI, cTnI-C, Aβ 42 or p-tau by the detection combination of antibody-homotetrameric nucleic acid aptamer based on the RPA-CRISPR / Cas12a system of the present invention are shown. Among them, A is the detection principle diagram of the RPA-CRISPR / Cas12a detection combination of antibody-homotetrameric nucleic acid aptamer, B is the CRISPR kinetic curve of detecting cTnI, C is the CRISPR kinetic curve of detecting cTnI-C, D is the CRISPR kinetic curve of detecting Aβ 42 ; E is the CRISPR kinetic curve of detecting p-tau 181 ;

[0067] Figure 6 The sensitivity detection results of the detection combination of antibody-homotetrameric nucleic acid aptamer based on the RPA-CRISPR / Cas12a system of the present invention are shown. Among them, A and B are the CRISPR kinetic curves of the detection combination of antibody-homotetrameric nucleic acid aptamer with RPA-CRISPR signal amplification strategy for detecting different concentrations of cTnI and cTnI-C standard proteins respectively, and C and D are the standard curves of the detection combination of antibody-homotetrameric nucleic acid aptamer with RPA-CRISPR signal amplification strategy for detecting different concentrations of cTnI and cTnI-C respectively;

[0068] Figure 7 The evaluation of the multiplex RPA amplification effect of the present invention is shown. Among them, A is the schematic diagram of the multiplex RPA amplification of the present invention, and B is the agarose electrophoresis results of multiplex RPA amplification of ssDNA (cTnI), ssDNA (Aβ 42 ), ssDNA (p-tau 181 ), and ssDNA (cTnI + Aβ 42 + p-tau 181 );

[0069] Figure 8 The schematic diagram of simultaneous detection of multiple markers by the detection combination of antibody-homotetrameric nucleic acid aptamer based on the RPA-CRISPR / Cas12a system of the present invention and the results of the fluorescence kinetic curve of simultaneous detection of cTnI, Aβ 42 and p-tau 18 are shown. Detailed implementation manners

[0070] To make the objectives, features, and advantages of the present invention more obvious and understandable, the following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative efforts belong to the scope of protection of the present invention.

[0071] The following will explain in detail the technical solutions provided by the present invention with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0072] Example 1

[0073] In this example, the screening of the antibody-monomeric nucleic acid aptamer detection combination was carried out based on sandwich ELISA. The detection schematic diagram is as shown in Figure 1 A (the schematic diagram takes the screening of the anti-cTnI antibody-monomeric nucleic acid aptamer detection combination as an example). The specific process is as follows:

[0074] (1) Coating antigen: Dilute anti-cTnI, Aβ 42 and tau antibodies with carbonate buffer solution (CBS) respectively, and add them to each well of the enzyme-linked immunosorbent assay (ELISA) plate at a dosage of 0.5 μg / well for coating.

[0075] Among them, the anti-Aβ 42 antibody was secreted by the hybridoma cell line 1F12 in the patent "Hybridoma cell line secreting human amyloid-β monoclonal antibody and its application" with the publication number CN113308439A; the anti-cTnI and tau antibodies were commercially purchased antibodies.

[0076] (2) Blocking: Discard the liquid in the wells, wash each well with phosphate-buffered saline with Tween-20 detergent (PBS-T), and then block with a blocking solution (5% non-fat milk) at 37 °C for 2 h.

[0077] (3) Adding antigen: Discard the blocking solution in the wells, wash with PBS-T, and then add 50 μL of cTnI standard protein or 16-month-old 5xFAD mouse brain tissue grinding solution (containing Aβ 42 and p-tau 181 protein) to each well and incubate at room temperature for 2 h.

[0078] (4) Adding nucleic acid aptamer: Discard the liquid in the wells, wash with PBS-T, and then add 100 μL of biotin-labeled anti-cTnI, Aβ 42, p-tau 181 The monomeric nucleic acid aptamer was incubated at 4 °C for 10 h.

[0079] (5) Add enzyme-labeled secondary antibody: Discard the liquid in the wells, wash with PBS-T, and then add 100 μL of streptavidin secondary antibody labeled with horseradish peroxidase (HRP) (1:8000) to each well, and react at 37 °C for 1 h.

[0080] (6) Color development: Discard the liquid in the wells, wash the unbound secondary antibody with PBS-T, and then add 100 μL of highly sensitive soluble TMB substrate color development solution for color development at 37 °C.

[0081] (7) Result detection and analysis: After color development, each well was treated with H 2 SO 4 to terminate the reaction between HRP and TMB, and the absorbance value at 450 nm was measured with an enzyme-labeled instrument.

[0082] The results were as Figure 1 shown. The results of detecting cTnI and cTnI-C with different anti-cTnI antibodies and anti-cTnI-C monomeric nucleic acid aptamer combinations were as Figure 1 shown in B, the results of detecting Aβ with anti-Aβ 42 antibody and anti-Aβ 42 monomeric nucleic acid aptamer combination were as 42 shown in C, and the results of detecting p-tau with anti-tau antibody and anti-p-tau Figure 1 monomeric nucleic acid aptamer combination were as 181 shown in D. The results indicated that the antibody-monomeric nucleic acid aptamer detection combinations for detecting cTnI, Aβ 181 and p-tau Figure 1 had been successfully screened out. 42 The monomeric nucleic acid aptamer for detecting cTnI and / or cTnI-C screened above is monomeric nucleic acid aptamer 1, and its sequence is as SEQ ID NO.1: TTTCTACGGTGCCTTGAAGTGACTGTGATTGGTTGGGGGGGTCAGGCTGGAGTTAACTCCATAGCAGGTCACTTCCAGG; the monomeric nucleic acid aptamer for detecting Aβ 181 The monomeric nucleic acid aptamer for detecting cTnI and / or cTnI-C screened above is monomeric nucleic acid aptamer 1, and its sequence is as SEQ ID NO.1: TTTCTACGGTGCCTTGAAGTGACTGTGATTGGTTGGGGGGGTCAGGCTGGAGTTAACTCCATAGCAGGTCACTTCCAGG; the monomeric nucleic acid aptamer for detecting Aβ

[0083] The monomeric nucleic acid aptamer for detecting cTnI and / or cTnI-C screened above is monomeric nucleic acid aptamer 1, and its sequence is as SEQ ID NO.1: TTTCTACGGTGCCTTGAAGTGACTGTGATTGGTTGGGGGGGTCAGGCTGGAGTTAACTCCATAGCAGGTCACTTCCAGG; the monomeric nucleic acid aptamer for detecting Aβ 42The monomeric nucleic acid aptamer 2, whose sequence is as shown in SEQ ID NO.2: TTTTCCGCTTCGCCGTCTCCTACCCGGTGGGGGACCAGTACAAAAGTGGG TAGGGCGGGTTGGAAAATGCTATTTTTTGGGTCTGCGCTCGTCACCCTTC TCCT; for detecting p-tau 181 The monomeric nucleic acid aptamer 3, whose sequence is as shown in SEQ ID NO.3: GCGGAGCGTGGCAGGTTTTTTAGTTCGGGATTGGGGCTGGGTTGGTTTTT TAGTCTAGGATTCGGCGTGGGTTAATTTTTTGCGGAGCGTGGCAGGTTT.

[0084] Example 2

[0085] In this example, the assembly of the homotetrameric nucleic acid aptamer and its RPA-CRISPR detection were carried out. The specific process is as follows:

[0086] (1) Self-assembly of the homotetrameric nucleic acid aptamer: Using the biotin-streptavidin system, the monomeric nucleic acid aptamer was assembled to obtain the homotetrameric nucleic acid aptamer. The schematic diagram is as shown in Figure 2 A in it. The assembly process of the homotetrameric nucleic acid aptamer is as follows: The biotinylated monomeric nucleic acid aptamer and streptavidin were mixed at a molar ratio of 4:1, and then incubated with rotation at 37 °C for 30 minutes to obtain the homotetrameric nucleic acid aptamer.

[0087] Among them, the monomeric nucleic acid aptamer for detecting cTnI and / or cTnI-C is the monomeric nucleic acid aptamer 1, whose sequence is as shown in SEQ ID NO.1; for detecting Aβ 42 The monomeric nucleic acid aptamer 2, whose sequence is as shown in SEQ ID NO.2; for detecting p-tau 181 The monomeric nucleic acid aptamer 3, whose sequence is as shown in SEQ ID NO.3. Respectively, the homotetrameric nucleic acid aptamer 1 for detecting cTnI and / or cTnI-C was obtained; for detecting Aβ 42 The homotetrameric nucleic acid aptamer 2; for detecting p-tau 181 The homotetrameric nucleic acid aptamer 3.

[0088] (2) RPA amplification: Configure the RPA amplification system, which respectively includes: RPA primer pairs, 2×Reaction buffer, 10×Basic E-mix, DNTP, 20×Core Reaction Mix, MgOAc, and monomer nucleic acid aptamer or homologous tetramer nucleic acid aptamer. After mixing, incubate at 37 °C for 30 minutes for RPA amplification reaction to obtain RPA amplification products, and detect the RPA amplification products using agarose gel electrophoresis and SDS-PAGE.

[0089] Among them, the RPA primer pairs are respectively: primer pair 1 for amplifying monomer nucleic acid aptamer 1 or homologous tetramer nucleic acid aptamer 1, and its sequences are as shown in SEQ ID NO.4: TTTCTACGGTGCCTTGAAGTGACTGTGA and SEQ ID NO.5: CCTGGAAGTGACCTGCTATGGAGTTAAC; primer pair 2 for amplifying monomer nucleic acid aptamer 2 or homologous tetramer nucleic acid aptamer 2, and its sequences are as shown in SEQ ID NO.6: TTTTCCGCTTCGCCGTCTCCTACCCGGT and SEQ ID NO.7: AGGAGAAGGGTGACGAGCGCAGACCCAA; primer pair 3 for amplifying monomer nucleic acid aptamer 3 or homologous tetramer nucleic acid aptamer 3, and its sequences are as shown in SEQ ID NO.8: GCGGAGCGTGGCAGGTTTTTTAGTTCGG and SEQ ID NO.9: AAACCTGCCACGCTCCGCAAAAAATTAA.

[0090] (3) CRISPR detection: Configure the CRISPR detection system, which respectively includes the RPA amplification products in step (2), crRNA, CRISPR Cas12a, 10×NEB buffer, RNA inhibitor, and fluorescent reporter molecule. After mixing, incubate at 37 °C for 60 minutes on a fluorescence quantitative PCR instrument for CRISPR detection, record the fluorescence signal every 30 seconds, and draw a CRISPR kinetic curve.

[0091] Among them, the crRNAs are respectively: crRNA1 for recognizing the amplification product of the homologous tetrameric nucleic acid aptamer 1, and its sequence is as shown in SEQ ID NO.10: GAAUUUCUACUGUUGUAGAUUUUCUACGGUGCCUUGAAGUGACUGUGA; crRNA2 for recognizing the amplification product of the homologous tetrameric nucleic acid aptamer 2, and its sequence is as shown in SEQ ID NO.11: GAAUUUCUACUGUUGUAGAUUUUCAACCCGCCCACUUUUGUA; crRNA3 for recognizing the amplification product of the homologous tetrameric nucleic acid aptamer 3, and its sequence is as shown in SEQ ID NO.12: GAAUUUCUACUGUUGUAGAUUUUAGUCUAGGAUUCGGCGUGGGUUAAU.

[0092] The fluorescent reporter molecules are 5'-FAM-PAM-BQH-3', 5'-FITC-PAM-Dig-3', 5'-Cy3-PAM-Dig-3 or 5'-Cy5-PAM-Dig-3'.

[0093] The results of self-assembly and identification of the homologous tetrameric nucleic acid aptamer are as Figure 2 shown (taking cTnI as an example). The agarose gel electrophoresis patterns and SDS-PAGE patterns of the monomeric nucleic acid aptamer and the homologous tetrameric nucleic acid aptamer are respectively as Figure 2 shown in B and C. The results show that the homologous tetrameric nucleic acid aptamer was successfully prepared by self-assembly of the monomeric nucleic acid aptamer; the kinetic curves of the homologous tetrameric nucleic acid aptamer and the monomeric nucleic acid aptamer after CRISPR are as Figure 2 shown in D. The results show that the fluorescence signal of the homologous tetrameric nucleic acid aptamer is significantly higher than that of the monomeric nucleic acid aptamer at the same incubation time; the end-point fluorescence values of the homologous tetrameric nucleic acid aptamer and the monomeric nucleic acid aptamer after RPA-CRISPR are as Figure 2 shown in E. The results show that the fluorescence signal of the homologous tetrameric nucleic acid aptamer is significantly higher than that of the monomeric nucleic acid aptamer at the same molar concentration, indicating that the homologous tetrameric nucleic acid aptamer has higher detection sensitivity.

[0094] Example 3

[0095] This example evaluates the selection specificity of different primer pairs for different nucleic acid aptamers based on RPA amplification. The specific process is as follows:

[0096] (1) Preparation of RPA amplification system: Sequentially prepare reaction mixtures containing RPA primer pair 1, 2×Reaction buffer, 10×Basic E-mix, DNTP, 20×Core Reaction Mix, MgOAc, and monomeric nucleic acid aptamers 1, 2, and 3 or homologous tetrameric nucleic acid aptamers 1, 2, and 3; RPA primer pair 2, 2×Reaction buffer, 10×Basic E-mix, DNTP, 20×Core Reaction Mix, MgOAc, and monomeric nucleic acid aptamers 1, 2, and 3 or homologous tetrameric nucleic acid aptamers 1, 2, and 3; RPA primer pair 3, 2×Reaction buffer, 10×Basic E-mix, DNTP, 20×Core Reaction Mix, MgOAc, and monomeric nucleic acid aptamers 1, 2, and 3 or homologous tetrameric nucleic acid aptamers 1, 2, and 3. After mixing the above reagents, incubate at 37°C for 30 minutes for RPA amplification reaction to obtain RPA amplification products;

[0097] Among them, the sequences of primer pair 1 for amplifying homologous tetrameric nucleic acid aptamer 1 are shown in SEQ ID NO.4 and SEQ ID NO.5; the sequences of primer pair 2 for amplifying homologous tetrameric nucleic acid aptamer 2 are shown in SEQ ID NO.6 and SEQ ID NO.7; the sequences of primer pair 3 for amplifying homologous tetrameric nucleic acid aptamer 3 are shown in SEQ ID NO.8 and SEQ ID NO.9.

[0098] (2) Agarose gel electrophoresis: Take 5 μL of each of the above RPA amplification products for 3% agarose gel electrophoresis.

[0099] (3) Result detection and analysis: After the electrophoresis is completed, take out the agarose gel and analyze the results under a gel imager.

[0100] The results are as Figure 3 shown. The selectivity of RPA primer pair 1 for nucleic acid aptamers 1, 2, and 3 is as Figure 3 shown in A; the selectivity of RPA primer pair 2 for nucleic acid aptamers 1, 2, and 3 is as Figure 3 shown in B; the selectivity of RPA primer pair 3 for nucleic acid aptamers 1, 2, and 3 is as Figure 3 shown in C. The results show that RPA primer pairs 1, 2, and 3 can only specifically amplify the corresponding monomeric nucleic acid aptamers or homologous tetrameric nucleic acid aptamers, but cannot amplify other monomeric nucleic acid aptamers or homologous tetrameric nucleic acid aptamers, and have high selectivity and specificity.

[0101] Example 4

[0102] In this embodiment, the selectivity of crRNA in RPA-CRISPR detection was evaluated, and the specific steps are as follows:

[0103] (1) RPA amplification: Sequentially prepare reaction mixtures containing RPA primer pair 1, 2×Reaction buffer, 10×Basic E-mix, DNTP, 20×Core Reaction Mix, MgOAc, and monomeric nucleic acid aptamer 1; RPA primer pair 2, 2×Reaction buffer, 10×Basic E-mix, DNTP, 20×Core Reaction Mix, MgOAc, and monomeric nucleic acid aptamer 2; RPA primer pair 3, 2×Reaction buffer, 10×Basic E-mix, DNTP, 20×Core Reaction Mix, MgOAc, and monomeric nucleic acid aptamer 3. After mixing the above reagents, incubate at 37 °C for 30 minutes for RPA amplification reaction to obtain the RPA amplification products of monomeric nucleic acid aptamers 1, 2, and 3 (i.e., ssDNA(cTnI), ssDNA(Aβ 42 ) and ssDNA(p-tau 181 ))).

[0104] Among them, the sequences of primer pair 1 for amplifying monomeric nucleic acid aptamer 1 are shown as SEQ ID NO.4 and SEQ ID NO.5; the sequences of primer pair 2 for amplifying monomeric nucleic acid aptamer 2 are shown as SEQ ID NO.6 and SEQ ID NO.7; the sequences of primer pair 3 for amplifying monomeric nucleic acid aptamer 3 are shown as SEQ ID NO.8 and SEQ ID NO.9.

[0105] (2) Preparation of CRISPR detection reagents: Sequentially prepare different CRISPR detection systems containing crRNA1, crRNA2, or crRNA3, CRISPRCas12a, 10×NEB buffer, RNA inhibitor, and fluorescent reporter molecule.

[0106] Among them, the sequence of crRNA1 for recognizing the RPA amplification product of monomeric nucleic acid aptamer 1 is shown as SEQ ID NO.10; the sequence of crRNA2 for recognizing the RPA amplification product of monomeric nucleic acid aptamer 2 is shown as SEQ ID NO.11; the sequence of crRNA3 for recognizing the RPA amplification product of monomeric nucleic acid aptamer 3 is shown as SEQ ID NO.12;

[0107] The fluorescent reporter molecules are 5’-FAM-PAM-BQH-3’, 5’-FITC-PAM-Dig-3’, 5’-Cy3-PAM-Dig-3 or 5’-Cy5-PAM-Dig-3’.

[0108] (3) CRISPR detection: The RPA amplification products 1, 2, and 3 from step (1) were successively added to the CRISPR detection reagent containing crRNA1; the RPA amplification products 1, 2, and 3 from step (1) were successively added to the CRISPR detection reagent containing crRNA2; the RPA amplification products 1, 2, and 3 from step (1) were successively added to the CRISPR detection reagent containing crRNA3. After mixing the above reagents, they were incubated at 37 °C for 60 minutes for CRISPR detection, and the fluorescence signal was recorded every 30 seconds to plot the CRISPR kinetic curve.

[0109] The results are as Figure 4 shown. The selective fluorescence kinetic curve of crRNA1 (abbreviated as "crRNA(cTnI)" in the figure) for the RPA amplification product of the monomeric nucleic acid aptamer 1 against the RPA amplification products (ssDNA(cTnI), ssDNA(Aβ 42 )) and ssDNA(p-tau 181 )) of the monomeric nucleic acid aptamers 1, 2, and 3 is as shown in Figure 4 A. The selective fluorescence kinetic curve of crRNA2 (abbreviated as "crRNA(Aβ 42 ))" in the figure) for the RPA amplification product of the monomeric nucleic acid aptamer 2 against the monomeric nucleic acid aptamers 1, 2, and 3 is as shown in Figure 4 B. The selective fluorescence kinetic curve of crRNA3 (abbreviated as "crRNA(p-tau 181 ))" in the figure) for the RPA amplification product of the monomeric nucleic acid aptamer 3 against the monomeric nucleic acid aptamers 1, 2, and 3 is as shown in Figure 4 C. The results of the fluorescence quantitative analysis of the selectivity of different crRNAs for the monomeric nucleic acid aptamers 1, 2, and 3 are as shown in Figure 4 D, and the results of the fluorescence heat map analysis of the selectivity of different crRNAs for the monomeric nucleic acid aptamers 1, 2, and 3 are as shown in Figure 4 E. The results show that crRNA1 is only applicable to the CRISPR detection of the monomeric nucleic acid aptamer 1 and the homologous tetrameric nucleic acid aptamer 1, crRNA2 is only applicable to the CRISPR detection of the monomeric nucleic acid aptamer 2 and the homologous tetrameric nucleic acid aptamer 2, and crRNA3 is only applicable to the CRISPR detection of the monomeric nucleic acid aptamer 3 and the homologous tetrameric nucleic acid aptamer 3.

[0110] Example 5

[0111] In this example, a combined detection of biomarkers cTnI, cTnI-C, Aβ 42 or p-tau 181 was performed based on the RPA-CRISPR / Cas12a system using an antibody-homotetrameric nucleic acid aptamer detection combination. The detection principle diagram is as shown in Figure 5 Figure A. The specific steps are as follows:

[0112] (1) Take 1 μL each of 0.4 μg / μL anti-cTnI, cTnI-C, Aβ 42 or p-tau 181 antibody-modified Fe 3 O 4 magnetic beads;

[0113] (2) Add 50 μL each of cTnI, cTnI-C standard proteins and brain tissue homogenate of 16-month-old 5xFAD mice (containing Aβ 42 and p-tau 181 proteins) and incubate at room temperature for 30 minutes to enrich cTnI, Aβ 42 or p-tau 181 .

[0114] (3) After washing 3 times with TBS-T, add the homotetrameric nucleic acid aptamers for detecting cTnI, cTnI-C, Aβ 42 or p-tau 181 respectively and incubate at 4 °C for 8 h to obtain magnetic bead-biomarker@homotetrameric nucleic acid aptamer complexes.

[0115] Among them, the homotetrameric nucleic acid aptamer 1 for detecting cTnI and cTnI-C is composed of biotinylated monomeric nucleic acid aptamer 1 assembled through the biotin-streptavidin system. The sequence of monomeric nucleic acid aptamer 1 is shown in SEQ ID NO.1; the homotetrameric nucleic acid aptamer 2 for detecting Aβ 42 is composed of biotinylated monomeric nucleic acid aptamer 2 assembled through the biotin-streptavidin system. The sequence of monomeric nucleic acid aptamer 2 is shown in SEQ ID NO.2; the homotetrameric nucleic acid aptamer 3 for detecting p-tau 181 is composed of biotinylated monomeric nucleic acid aptamer 3 assembled through the biotin-streptavidin system. The sequence of monomeric nucleic acid aptamer 3 is shown in SEQ ID NO.3.

[0116] (4) RPA amplification reaction: Prepare the RPA amplification system respectively, including: the magnetic bead - biomarker @ homotetrameric nucleic acid aptamer complex obtained in step (3), RPA primer pairs, 2×Reaction buffer, 10×Basic E-mix, DNTP, 20×Core Reaction Mix, and MgOAc. After mixing, incubate at 37 °C for 30 minutes for RPA amplification reaction to obtain RPA amplification products.

[0117] Among them, the RPA primer pairs are respectively: primer pair 1 for amplifying homotetrameric nucleic acid aptamer 1, whose sequences are shown in SEQ ID NO.4 and SEQ ID NO.5; primer pair 2 for amplifying homotetrameric nucleic acid aptamer 2, whose sequences are shown in SEQ ID NO.6 and SEQ ID NO.7; primer pair 3 for amplifying homotetrameric nucleic acid aptamer 3, whose sequences are shown in SEQ ID NO.8 and SEQ ID NO.9.

[0118] (5) CRISPR detection: Prepare the CRISPR detection system: Add the RPA amplification products obtained in step (4) to the reagents of crRNA, CRISPR Cas12a, 10×NEB buffer, RNA inhibitor, and fluorescent reporter molecule respectively. After mixing, incubate at 37 °C for 60 minutes on a fluorescence quantitative PCR instrument for CRISPR detection, record the fluorescence signal every 30 seconds, and draw a CRISPR kinetic curve.

[0119] Among them, the crRNAs are respectively: crRNA1 for recognizing the amplification product of homotetrameric nucleic acid aptamer 1, whose sequence is shown in SEQ ID NO.10; crRNA2 for recognizing the amplification product of homotetrameric nucleic acid aptamer 2, whose sequence is shown in SEQ ID NO.11; crRNA3 for recognizing the amplification product of homotetrameric nucleic acid aptamer 3, whose sequence is shown in SEQ ID NO.12;

[0120] The fluorescent reporter molecule is 5’-FAM-PAM-BQH-3’, 5’-FITC-PAM-Dig-3’, 5’-Cy3-PAM-Dig-3 or 5’-Cy5-PAM-Dig-3’.

[0121] The results are as Figure 5 shown in B - E in. The detection combination of antibody - homotetrameric nucleic acid aptamer using the RPA - CRISPR signal amplification strategy of the present invention can achieve the separate detection of biomarkers cTnI (B), cTnI - C (C), Aβ 42 (D) or p - tau 181 (E), and has good versatility.

[0122] Example 6

[0123] In this example, taking the detection of cTnI and cTnI-C as an example, the sensitivity of the antibody-homotetrameric nucleic acid aptamer detection combination based on the RPA-CRISPR / Cas12a system was evaluated. The specific process was as follows:

[0124] (1) Respectively take 1 μL of Fe 3 O 4 magnetic beads modified with 0.4 μg / μL anti-cTnI and cTnI-C antibodies.

[0125] (2) Corresponding add 50 μL of cTnI and cTnI-C standard protein solutions with different concentrations (the concentrations are 6800 pg / mL, 680 pg / mL, 68 pg / mL, 6.8 pg / mL, 680 fg / mL, 68 fg / mL, and 6.8 fg / mL in sequence), and incubate at room temperature for 30 minutes.

[0126] Steps (3)-(5) are as shown in Example 3.

[0127] The results are as Figure 6 shown. The kinetic curves of the antibody-homotetrameric nucleic acid aptamer detection combination using the RPA-CRISPR signal amplification strategy for detecting cTnI and cTnI-C standard proteins with different concentrations are respectively as Figure 6 A and B in it. The standard curves of the antibody-homotetrameric nucleic acid aptamer detection combination using the RPA-CRISPR signal amplification strategy for detecting cTnI and cTnI-C standard proteins with different concentrations are respectively as Figure 6 C and D in it. The results show that for the antibody-homotetrameric nucleic acid aptamer detection combination using the RPA-CRISPR signal amplification strategy, the detection sensitivity for cTnI and cTnI-C is 6.8 fg / mL.

[0128] Example 7

[0129] In this example, a multiplex RPA amplification system was established. The schematic diagram of multiplex RPA amplification is as Figure 7 shown in A in it. The specific process was as follows:

[0130] (1) Preparation of primer pair combination: Prepare primer pairs 1, 2, and 3 to a final concentration of 30 μM, and then mix the 3 primer pairs according to a volume ratio of 1:1:1.

[0131] Among them, primer pair 1 is used to amplify monomeric nucleic acid aptamer 1 (abbreviated as "cTnI F / R" in the figure), and its sequences are as shown in SEQ ID NO.4 and SEQ ID NO.5; primer pair 2 is used to amplify monomeric nucleic acid aptamer 2 (abbreviated as "Aβ42 F / R”), and its sequences are shown in SEQ ID NO.6 and SEQ ID NO.7; Primer pair 3 is used to amplify monomeric nucleic acid aptamer 3 (abbreviated as "p-tau" in the figure) 181 F / R”), and its sequences are shown in SEQ ID NO.8 and SEQ ID NO.9.

[0132] (2) Multiple RPA amplification reaction: Mix the RPA primer pair combination, 2×Reaction buffer, 10×BasicE-mix, DNTP, 20×Core Reaction Mix, MgOAc and monomeric nucleic acid aptamers 1, 2 and / or 3, and incubate at 37 °C for 30 minutes for RPA amplification reaction to obtain RPA amplification products, namely ssDNA(cTnI), ssDNA(Aβ 42 ) and ssDNA(p-tau 181 ).

[0133] (3) Agarose gel electrophoresis: Take 5 μL of each of the above RPA amplification products for 3% agarose gel electrophoresis.

[0134] (4) Result detection and analysis: After electrophoresis, take out the agarose gel and analyze the results under a gel imager.

[0135] The results are as Figure 7 shown. The agarose gel electrophoresis results of multiple RPA amplifying monomeric nucleic acid aptamers 1, 2 and / or 3 are as shown in Figure 7 B. The results show that primer pairs 1, 2 and 3 can achieve multiple RPA amplification reactions in the same system.

[0136] Example 8

[0137] In this example, a detection combination of antibody-homotetrameric nucleic acid aptamer based on the RPA-CRISPR / Cas12a system was used to simultaneously detect biomarkers cTnI, Aβ 42 and p-tau 181 , and the detection schematic diagram is as shown in Figure 8 shown. The specific steps are as follows:

[0138] (1) Take 1 μL of 0.4 μg / μL anti-cTnI, Aβ 42 and p-tau 181 antibody-modified Fe 3 O 4 magnetic beads respectively;

[0139] (2) Add 50 μL of cTnI standard protein and the ground brain tissue of 16-month-old 5xFAD mice (containing Aβ 42 and p-tau181 Protein), incubated at room temperature for 30 minutes, for cTnI, Aβ 42 and p-tau 181 enrichment.

[0140] (3) After washing 3 times with TBS-T, add the homologous tetrameric nucleic acid aptamers for detecting cTnI, Aβ 42 and p-tau 181 , incubate at 4 °C for 8 h to obtain a magnetic bead - biomarker @ homologous tetrameric nucleic acid aptamer complex.

[0141] Among them, the homologous tetrameric nucleic acid aptamer for detecting cTnI is homologous tetrameric nucleic acid aptamer 1, which is assembled from biotinylated monomeric nucleic acid aptamer 1 through the biotin - streptavidin system, and the sequence of monomeric nucleic acid aptamer 1 is shown in SEQ ID NO.1; the homologous tetrameric nucleic acid aptamer 2 for detecting Aβ 42 , which is assembled from biotinylated monomeric nucleic acid aptamer 2 through the biotin - streptavidin system, and the sequence of monomeric nucleic acid aptamer 2 is shown in SEQ ID NO.2; the homologous tetrameric nucleic acid aptamer 3 for detecting p-tau 181 , which is assembled from biotinylated monomeric nucleic acid aptamer 3 through the biotin - streptavidin system, and the sequence of monomeric nucleic acid aptamer 3 is shown in SEQ ID NO.3.

[0142] (4) RPA amplification reaction: Configure the RPA amplification system: the magnetic bead - biomarker @ homologous tetrameric nucleic acid aptamer complex obtained in step (3), RPA primer pair combination, 2×Reaction buffer, 10×Basic E-mix, DNTP, 20×Core Reaction Mix and MgOAc, mix well, and incubate at 37 °C for 30 minutes for RPA amplification reaction to obtain RPA amplification products.

[0143] Among them, the RPA primer pair combination includes: primer pair 1 for amplifying homologous tetrameric nucleic acid aptamer 1, whose sequences are shown in SEQ ID NO.4 and SEQ ID NO.5; primer pair 2 for amplifying homologous tetrameric nucleic acid aptamer 2, whose sequences are shown in SEQ ID NO.6 and SEQ ID NO.7; primer pair 3 for amplifying homologous tetrameric nucleic acid aptamer 3, whose sequences are shown in SEQ ID NO.8 and SEQ ID NO.9, that is, the forward primers including SEQ ID NO.4, 6 and 8 and the reverse primers of SEQ ID NO.5, 7 and 9.

[0144] (5) CRISPR Detection: Preparation of the CRISPR detection system: Add the amplification products obtained in step (4) into arrays containing different crRNAs, CRISPR Cas12a, 10× NEB buffer, RNA inhibitor, and fluorescent reporter molecules respectively. After mixing, incubate at 37 °C for 60 minutes on a fluorescence quantitative PCR instrument for CRISPR detection. Record the fluorescence signal every 30 seconds and plot the CRISPR kinetic curve.

[0145] Among them, the crRNAs are respectively: crRNA1 for identifying the RPA amplification product of the homologous tetramer nucleic acid aptamer 1, and its sequence is as shown in SEQ ID NO.10; crRNA2 for identifying the RPA amplification product of the homologous tetramer nucleic acid aptamer 2, and its sequence is as shown in SEQ ID NO.11; crRNA3 for identifying the RPA amplification product of the homologous tetramer nucleic acid aptamer 3, and its sequence is as shown in SEQ ID NO.12;

[0146] The fluorescent reporter molecule is 5’-FAM-PAM-BQH-3’, 5’-FITC-PAM-Dig-3’, 5’-Cy3-PAM-Dig-3 or 5’-Cy5-PAM-Dig-3’.

[0147] The results are as Figure 8 shown, and the CRISPR kinetic curves for simultaneously detecting cTnI, cTnI-C, Aβ 42 and p-tau 181 are respectively as Figure 8 shown. The results show that the detection combination of antibody-homologous tetramer nucleic acid aptamer using the RPA-CRISPR signal amplification strategy in the present disclosure can achieve the simultaneous detection of biomarkers cTnI, cTnI-C, Aβ 42 and p-tau 181 .

[0148] It should be understood that various forms of the processes shown above can be used, with steps reordered, added, or deleted. For example, the steps described in the present invention can be executed in parallel, sequentially, or in different orders, as long as the desired results of the technical solution of the present invention can be achieved, and no limitations are imposed herein.

[0149] In addition, the terms “first” and “second” are only used for descriptive purposes and cannot be construed as indicating or implying relative importance or implicitly specifying the quantity of the indicated technical features. Thus, the features defined with “first” and “second” may explicitly or implicitly include at least one of such features.

[0150] As described above, it is only the specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention can easily think of changes or substitutions, which should all be covered within the protection scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims described above.

Claims

1. Use of a detection combination of an antibody and a monomeric nucleic acid aptamer in detecting a biomarker or in preparing a product for detecting a biomarker, characterized in that: The antibody is an antibody against a biomarker to be detected, and the monomeric nucleic acid aptamer is a monomeric nucleic acid aptamer that specifically recognizes a biomarker to be detected.

2. The use of a detection combination of an antibody and a homotetrameric nucleic acid aptamer in detecting biomarkers or in preparing a product for detecting biomarkers, wherein the antibody is an antibody of the biomarker to be detected, and the homotetrameric nucleic acid aptamer is a biotin-labeled monomeric nucleic acid aptamer that recognizes the biomarker to be detected and is assembled through a biotin and streptavidin system.

3. The use according to claim 1 or 2, characterized in that: The detection is based on the RPA-CRISPR / Cas12a system; Preferably, the assembly comprises the following steps: mixing the biotin-modified monomeric nucleic acid aptamer and streptavidin at a molar ratio of 4:1, incubating at 37°C for 0.5-2 hours or at room temperature for 0.5-6 hours or at 4°C for 8-16 hours to obtain a homotetrameric nucleic acid aptamer.

4. A composition for detecting biomarkers based on the RPA-CRISPR / Cas12a system, characterized in that: The composition includes an antibody, a monomeric nucleic acid aptamer or a homotetrameric nucleic acid aptamer; wherein the antibody is an antibody of a biomarker to be detected, the monomeric nucleic acid aptamer is a monomeric nucleic acid aptamer containing a CRISPR Cas12a PAM recognition site and specifically recognizing a biomarker to be detected, and the homotetrameric nucleic acid aptamer is a biotin-labeled monomeric nucleic acid aptamer containing a CRISPR Cas12a PAM recognition site and recognizing a biomarker to be detected, which is assembled by a biotin and streptavidin system.

5. A kit for detecting biomarkers based on the RPA-CRISPR / Cas12a system, characterized in that: The kit comprises an antibody, a monomeric nucleic acid aptamer or a homotetrameric nucleic acid aptamer, magnetic beads, an RPA primer pair, crRNA, CRISPRCas12a and a fluorescent reporter molecule; wherein the antibody is an antibody of a biomarker to be detected, the monomeric nucleic acid aptamer is a monomeric nucleic acid aptamer containing a CRISPR Cas12a PAM recognition site and specifically identifying the biomarker to be detected, the homotetrameric nucleic acid aptamer is a biotin-labeled monomeric nucleic acid aptamer containing a CRISPR Cas12a PAM recognition site and identifying the biomarker to be detected, and is assembled by a biotin and streptavidin system, the magnetic beads are used to modify the antibody, the RPA primer pair is used to amplify the monomeric nucleic acid aptamer or the homotetrameric nucleic acid aptamer, the crRNA is used to identify the RPA amplification product of the monomeric nucleic acid aptamer or the homotetrameric nucleic acid aptamer, and the fluorescent reporter molecule can be cut by CRISPR Cas12a.

6. The kit according to claim 5, characterized in that The biomarkers to be tested are cTnI, cTnI-C, Aβ 42 and / or p-tau, wherein the p-tau is p-tau 181 , p-tau 217 , p-tau 231 or p-tau 396,404 One of; When the biomarkers cTnI and / or cTnI-C are detected, the kit includes cTnI and / or cTnI-C antibodies, magnetic beads for modifying cTnI and / or cTnI-C antibodies, monomeric nucleic acid aptamers 1 containing CRISPR Cas12a PAM recognition sites and recognizing cTnI and cTnI-C, or homotetrameric nucleic acid aptamers 1 obtained by assembling biotin-labeled monomeric nucleic acid aptamers 1 containing CRISPR Cas12a PAM recognition sites and recognizing cTnI and cTnI-C through a biotin and streptavidin system, RPA primer pairs 1 for amplifying monomeric nucleic acid aptamers 1 or homotetrameric nucleic acid aptamers 1, crRNA 1 for recognizing RPA amplification products of monomeric nucleic acid aptamers 1 or homotetrameric nucleic acid aptamers 1, CRISPR Cas12a, and fluorescent reporter molecules that can be cleaved by CRISPR Cas12a; When testing the biomarker Aβ 42 When the kit includes Aβ 42 Antibodies, used to modify Aβ 42 Antibody magnetic beads, containing CRISPR Cas12a PAM recognition sites and recognizing Aβ 42 The monomeric nucleic acid aptamer 2 may contain a CRISPR Cas12a PAM recognition site and recognize Aβ 42 A homotetrameric nucleic acid aptamer 2 obtained by assembling a biotin-labeled monomeric nucleic acid aptamer 2 through a biotin and streptavidin system, an RPA primer pair 2 for amplifying the monomeric nucleic acid aptamer 2 or the homotetrameric nucleic acid aptamer 2, crRNA 2 for identifying the RPA amplification product of the monomeric nucleic acid aptamer 2 or the homotetrameric nucleic acid aptamer 2, CRISPR Cas12a, and a fluorescent reporter molecule that can be cut by CRISPR Cas12a; When the biomarker p-tau is detected, the kit includes a p-tau antibody, magnetic beads for modifying the p-tau antibody, a monomeric nucleic acid aptamer 3 containing a CRISPR Cas12a PAM recognition site and recognizing p-tau, or a homotetrameric nucleic acid aptamer 3 obtained by assembling a biotin-labeled monomeric nucleic acid aptamer 3 containing a CRISPR Cas12a PAM recognition site and recognizing p-tau through a biotin and streptavidin system, an RPA primer pair 3 for amplifying the monomeric nucleic acid aptamer 3 or the homotetrameric nucleic acid aptamer 3, crRNA 3 for recognizing the RPA amplification product of the monomeric nucleic acid aptamer 3 or the homotetrameric nucleic acid aptamer 3, CRISPR Cas12a, and a fluorescent reporter molecule that can be cut by CRISPR Cas12a; When measuring biomarkers cTnI or cTnI-C and Aβ 42 When the kit includes cTnI or cTnI-C and Aβ 42 Antibodies, for modification of cTnI or cTnI-C and Aβ 42 Antibody magnetic beads, containing CRISPR Cas12a PAM recognition sites and recognizing cTnI or cTnI-C and Aβ 42 Monomeric aptamers 1 and 2 or biotin-labeled monomeric aptamers 1 and 2 containing CRISPR Cas12a PAM recognition sites and recognizing cTnI or cTnI-C and p-tau are assembled by a biotin and streptavidin system to obtain homotetrameric aptamers 1 and 2, RPA primer pairs 1 and 2 for amplifying monomeric aptamers or homotetrameric aptamers, and crRNA1 and crRNA2 containing RPA amplification products for recognizing monomeric aptamers 1 and 2 or homotetrameric aptamers 1 and 2, CRISPR Cas12a, and a CRISPR array of fluorescent reporter molecules that can be cleaved by CRISPR Cas12a; When the biomarkers cTnI or cTnI-C and p-tau are detected, the kit includes cTnI or cTnI-C and p-tau antibodies, magnetic beads for modifying cTnI or cTnI-C and p-tau antibodies, monomeric nucleic acid aptamers 1 and 3 containing CRISPR Cas12a PAM recognition sites and recognizing cTnI or cTnI-C and p-tau, or homotetrameric nucleic acid aptamers 1 and 3 obtained by assembling biotin-streptavidin systems from biotin-labeled monomeric nucleic acid aptamers 1 and 3 containing CRISPR Cas12a PAM recognition sites and recognizing cTnI or cTnI-C and p-tau, RPA primer pairs 1 and 3 for amplifying monomeric nucleic acid aptamers or homotetrameric nucleic acid aptamers, and crRNA 1 and crRNA 3 containing RPA amplification products for recognizing monomeric nucleic acid aptamers 1 and 3 or homotetrameric nucleic acid aptamers 1 and 3, CRISPR Cas12a, CRISPR array of fluorescent reporter molecules that can be cleaved by CRISPR Cas12a; When testing the biomarker Aβ 42 and p-tau, the kit includes Aβ 42 and p-tau antibodies for modification of Aβ 42 Magnetic beads with p-tau antibodies, containing CRISPR Cas12a PAM recognition sites and recognizing Aβ 42 Monomeric aptamers 2 and 3 for p-tau or containing CRISPR Cas12a PAM recognition sites and recognizing Aβ 42 Homotetrameric nucleic acid aptamers 2 and 3 obtained by assembling biotin-labeled monomeric nucleic acid aptamers 2 and 3 of p-tau through a biotin and streptavidin system, RPA primer pairs 2 and 3 for amplifying monomeric nucleic acid aptamers or homotetrameric nucleic acid aptamers, and crRNA2 and crRNA3 for recognizing RPA amplification products of monomeric nucleic acid aptamers 2 and 3 or homotetrameric nucleic acid aptamers 2 and 3, CRISPR Cas12a, and a CRISPR array comprising a fluorescent reporter molecule that can be cut by CRISPR Cas12a; When testing biomarkers cTnI or cTnI-C, Aβ 42 and p-tau, the kit includes cTnI or cTnI-C, Aβ 42 and p-tau antibodies, for modification of cTnI or cTnI-C, Aβ 42 Magnetic beads with antibodies against p-tau, CRISPR Cas12a PAM recognition sites and cTnI or cTnI-C, Aβ 42 and p-tau or monomeric aptamers 1, 2 and 3 containing CRISPR Cas12a PAM recognition sites and recognizing cTnI or cTnI-C, Aβ 42 Homotetrameric nucleic acid aptamers 1, 2 and 3 obtained by assembling biotin-labeled monomeric nucleic acid aptamers 1, 2 and 3 of p-tau through a biotin and streptavidin system, RPA primer pairs 1, 2 and 3 for amplifying monomeric nucleic acid aptamers or homotetrameric nucleic acid aptamers, and crRNA1, crRNA2 and crRNA3 for recognizing RPA amplification products of monomeric nucleic acid aptamers 1, 2 and 3 or homotetrameric nucleic acid aptamers 1, 2 and 3, CRISPR Cas12a, and a CRISPR array of fluorescent reporter molecules that can be cut by CRISPR Cas12a; Preferably, the magnetic beads are superparamagnetic magnetic beads modified with protein A, carboxyl or N-hydroxysuccinimide; Preferably, the fluorescent reporter molecule is 5'-FAM-PAM-BQH-3', 5'-FITC-PAM-Dig-3', 5'-Cy3-PAM-Dig-3 or 5'-Cy5-PAM-Dig-3'; Preferably, the PAM sequence is FAM-TTTNTTTN-BQM, where N refers to A, T, C, or G; Preferably, the kit also includes other RPA amplification reagents and CRISPR detection reagents.

7. The kit according to claim 6, characterized in that The sequence of the monomer nucleic acid aptamer 1 is shown in SEQ ID NO.1, the sequence of the monomer nucleic acid aptamer 2 is shown in SEQ ID NO.2, and the sequence of the monomer nucleic acid aptamer 3 is shown in SEQ ID NO.3; Preferably, the sequence of the RPA primer pair 1 is shown as SEQ ID NO.4 and SEQ ID NO.5, the sequence of the RPA primer pair 2 is shown as SEQ ID NO.6 and SEQ ID NO.7, and the sequence of the RPA primer pair 3 is shown as SEQ ID NO.8 and SEQ ID NO.9; Preferably, the sequence of the crRNA1 is shown as SEQ ID NO.10, the sequence of the crRNA2 is shown as SEQ ID NO.11, and the sequence of the crRNA3 is shown as SEQ ID NO.

12.

8. A method for simultaneously detecting multiple biomarkers using the composition of claim 4 or the kit of any one of claims 5 to 7 for non-diagnostic purposes, characterized in that: The steps include: Using magnetic beads to modify antibodies of different biomarkers to be detected, to obtain magnetic beads with different modified antibodies; Adding magnetic beads with different modified antibodies to the sample to be tested simultaneously to enrich the biomarker to be tested, thereby obtaining an antibody-magnetic bead-biomarker complex; Adding different monomeric aptamers or homotetrameric aptamers to the magnetic bead-biomarker complex at the same time to obtain an antibody-magnetic bead-biomarker@monomeric aptamer complex or an antibody-magnetic bead-biomarker@homotetrameric aptamer complex; The antibody-magnetic bead-biomarker@monomer nucleic acid aptamer complex or the antibody-magnetic bead-biomarker@homototetramer nucleic acid aptamer complex is added to a reagent containing an RPA primer pair for amplifying different monomer nucleic acid aptamers or homologous tetramer nucleic acid aptamers to perform an RPA amplification reaction to obtain an RPA amplification product; The RPA amplified products were added to arrays containing different crRNAs, fluorescent reporter molecules, and CRISPR Cas12a reagents for CRISPR detection, and the fluorescent signals were recorded; The detection and analysis of multiple biomarkers are achieved through the fluorescent signals of arrays containing different crRNAs.

9. A method for detecting a biomarker using the composition of claim 4 or the kit of any one of claims 5 to 7 for non-diagnostic purposes, characterized in that: The steps include: Using magnetic beads to modify antibodies of biomarkers to be detected to obtain antibody-modified magnetic beads; Adding the antibody-modified magnetic beads to the sample to be tested to enrich the biomarker to be tested, thereby obtaining an antibody-magnetic bead-biomarker complex; Adding a monomeric aptamer or a homotetrameric aptamer to a magnetic bead-biomarker complex to obtain an antibody-magnetic bead-biomarker@monomeric aptamer complex or an antibody-magnetic bead-biomarker@homotetrameric aptamer complex; The antibody-magnetic bead-biomarker@monomer nucleic acid aptamer complex or the antibody-magnetic bead-biomarker@homototetramer nucleic acid aptamer complex is added to a reagent containing an RPA primer pair for amplifying monomer nucleic acid aptamers or homologous tetramer nucleic acid aptamers to perform an RPA amplification reaction to obtain an RPA amplification product; The RPA amplification product was added to a reagent containing crRNA, fluorescent reporter molecules, and CRISPR Cas12a for CRISPR detection, and the fluorescent signal was recorded; The detection and analysis of biomarkers can be achieved through the detection of fluorescent signals.

10. The method according to claim 8 or 9, characterized in that: The sample to be tested is blood, plasma, blood cells, exosomes or cerebrospinal fluid; Preferably, the conditions of the multiple RPA amplification reaction or the RPA amplification reaction are incubation at 37-42° C. for 10-60 minutes; Preferably, the CRISPR detection conditions are incubation at 37-42° C. for 10-60 minutes.

Images