Kit for predicting efficacy of adoptive nk therapy based on triple-negative breast cancer circdek expression

Abstract

The application belongs to the technical field of biological detection, and discloses a kit for predicting the curative effect of adoptive NK treatment based on triple-negative breast cancer circDEK expression. The application discloses that circDEK in breast cancer tissue can be used as a triple-negative breast cancer adoptive NK treatment sensitivity evaluation marker. Specifically, on the basis of triple-negative breast cancer, the expression level of circDEK in tumor tissue is related to the curative effect of adoptive NK cells (circDEK expression is low, and the curative effect of adoptive NK cells is better), so as to predict the triple-negative breast cancer adoptive NK treatment sensitivity. Further, the application provides that by detecting the expression level of circDEK in the tumor tissue of a triple-negative breast cancer patient, the curative effect of adoptive NK treatment can be accurately predicted (sensitivity 82.69%, specificity 94.23%, and AUC 0.9331).

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and specifically relates to a kit for predicting the efficacy of adoptive NK therapy based on triple-negative breast cancer circDEK expression. BACKGROUND

[0002] Breast cancer is the most common malignant tumor in women, with about 2 million new cases worldwide each year. Breast cancer is a highly heterogeneous tumor at the molecular level, with great differences in tissue morphology, immunophenotype, biological behavior, and treatment response. Patients with the same traditional pathological TNM stage may have very different responses to clinical treatment and prognosis. According to molecular markers, including estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2), breast cancer is divided into three major subtypes: hormone receptor (HR) positive, HER2 positive, and triple-negative breast cancer (TNBC). Triple-negative breast cancer accounts for about 15% to 20% of all breast cancer cases. Compared with hormone receptor-positive breast cancer, triple-negative breast cancer has a poorer prognosis. More than 50% of patients relapse within three to five years after diagnosis, and the median overall survival (OS) under existing treatment regimens is 10.2 months. Due to the lack of relevant receptor markers, triple-negative breast cancer (TNBC) patients cannot benefit from existing endocrine or HER2-targeted drugs. Therefore, the standard therapy for non-surgical treatment of TNBC is still non-specific chemotherapy. It is worth noting that TNBC responds best to standard chemotherapy regimens such as taxanes or anthracyclines. However, only less than 30% of TNBC patients can achieve complete remission, and their relapse and mortality rates are still higher than those of non-TNBC subtypes.

[0003] Currently, immunotherapy has shown good efficacy in TNBC. In addition to immune checkpoint inhibitors, such as therapeutic monoclonal antibodies against the PD-1 / PD-L1 (programmed death protein 1 - programmed death ligand 1) pathway, and adoptive T cell therapy, adoptive NK therapy has also gradually been valued. Human natural killer cells (NK cells) are a type of peripheral blood lymphocyte characterized by the expression of cd56 or cd16 and the lack of T cell receptors (CD3). NK cells play a role in tumor surveillance and are important immune effector cells belonging to the innate lymphoid cell (ILC) family. During development, NK cells are derived from the same common lymphoid progenitor cells (CLP) as T cells and B cells. Their functions include the production of cytokines, including interferon-gamma (IFN-γ), tumor necrosis factor (TNF), IL-10, granulocyte-macrophage colony-stimulating factor (GM-CSF), and cytotoxic perforin and granzyme B. Although NK cells lack specific antigen-distinguishing somatically rearranged receptors, they are naturally expressed with a variety of activating and inhibitory receptors. The dynamic balance between these receptors ensures the fine regulation of NK cytotoxic activity. NK cells are activated when the activating signal is stronger than the inhibitory signal; otherwise, they are in a resting state. These characteristics make NK cells ideal candidates for "off-the-shelf" therapeutic products for adoptive immunotherapy. Specifically, autologous or allogeneic NK cells are expanded and activated in vitro under the stimulation of feeder cells such as genetically modified k562 cells and cytokines (IL-2 / IL-15), and then reinfused into patients to eliminate tumor cells. The rapidly developing field of adoptive NK cell therapy now covers a range of candidate cell sources, and further improves the specificity, persistence and anti-tumor efficacy of NK cells with advances in genetic engineering.

[0004] Circular RNA (circRNA) is a special non-coding RNA with a structure different from linear RNA. It forms a closed single-stranded RNA ring structure in the form of a covalent bond, so it has no polyA tail; also no 5'-3' polarity; not easy to be degraded by exonuclease RNAse r; and even its half-life in cells is longer than that of linear RNA. The single-stranded circRNA structure was first observed by diener using an electron microscope in potato tuber disease; because the free RNA molecules observed by diener were a kind of virus-like infectious particles, so the single-stranded circular RNA molecules with pathogenic ability in plants were named viroid at that time. But these RNA molecules with closed circular structure not only exist in viruses or prokaryotes, but also exist in eukaryotic cells. In 1993, circRNA molecules transcribed from sry gene were first found in mouse testis. In 2012, salzman et al. found a large number of circRNA in normal cells and tumor cells of human by bioinformatics method combined with second-generation sequencing technology, and the abundance of some circRNA was higher than that of its linear transcript. These evidences suggest that circRNA, as a special non-coding RNA, is not a “noise” or by-product of transcription like lncRNA, but a kind of important regulatory molecule, which participates in the regulation of tumor occurrence and development. At present, there is no related research on circRNA in the efficacy of adoptive NK therapy for triple-negative breast cancer. SUMMARY

[0005] The first aspect of the present application aims to provide the use of circDEK as a biomarker in the preparation of a product for predicting the efficacy of adoptive NK therapy for triple-negative breast cancer.

[0006] The second aspect of the present application aims to provide the use of a substance for detecting circDEK in the preparation of a product for predicting the efficacy of adoptive NK therapy for triple-negative breast cancer.

[0007] The third aspect of the present application aims to provide a primer set for detecting circDEK.

[0008] The fourth aspect of the present application aims to provide a kit.

[0009] The fifth aspect of the present application aims to provide a system for predicting the efficacy of adoptive NK therapy for triple-negative breast cancer.

[0010] The sixth aspect of the present application aims to provide the use of a circDEK inhibitor in the preparation of a product for improving the efficacy of adoptive NK therapy for triple-negative breast cancer.

[0011] The seventh aspect of the present application aims to provide an shRNA.

[0012] The eighth aspect of the present application aims to provide a biological material of the shRNA of the seventh aspect of the present application.

[0013] The ninth aspect of the present application aims to provide a reagent.

[0014] The tenth aspect of the present application aims to provide an application of the shRNA of the seventh aspect of the present application, the biological material of the eighth aspect of the present application or the reagent of the ninth aspect of the present application in preparing a product for improving the curative effect of adoptive NK therapy for triple-negative breast cancer.

[0015] To achieve the above-mentioned purposes, the technical solutions adopted by the present application are as follows:

[0016] The first aspect of the present application provides an application of circDEK as a biomarker in preparing a product for predicting the curative effect of adoptive NK therapy for triple-negative breast cancer.

[0017] In some embodiments of the present application, the nucleotide sequence of the circDEK is shown in SEQ ID NO: 7.

[0018] In some embodiments of the present application, the product comprises at least one of a reagent, a kit, a test paper, a system and a chip.

[0019] The second aspect of the present application provides an application of a substance for detecting circDEK in preparing a product for predicting the curative effect of adoptive NK therapy for triple-negative breast cancer.

[0020] In some embodiments of the present application, the substance for detecting circDEK comprises a substance for quantitatively detecting circDEK.

[0021] In some embodiments of the present application, the substance comprises a substance for detecting the circDEK by PCR, a biochip method or nucleic acid sequencing method.

[0022] In some embodiments of the present application, the substance comprises at least one of a substance specific to circDEK, a probe specific to circDEK, a gene chip or a PCR primer.

[0023] In some embodiments of the present application, the nucleotide sequence of the PCR primer is shown in SEQ ID NO: 1-2.

[0024] In some embodiments of the present application, the product comprises but is not limited to a reagent, a kit, a test paper, a system or a chip.

[0025] In some embodiments of the present invention, the test sample of the product is selected from at least one of the blood, tissue, cells, and excrement of the test subject.

[0026] A third aspect of the present invention provides a primer set for detecting circDEK, the nucleotide sequence of which is shown in SEQ ID NO:1-2.

[0027] A fourth aspect of the present invention provides a kit comprising the primer set of the third aspect of the present invention.

[0028] In some embodiments of the present invention, the kit further includes RNA extraction reagents, reagents for RNA reverse transcription reaction, and reagents for PCR reaction.

[0029] In some embodiments of the present invention, the reagents used for RNA reverse transcription reaction include reverse transcriptase, reverse transcription primers, random primers, and buffer solutions.

[0030] In some embodiments of the present invention, the reverse transcriptase includes M-MLV reverse transcriptase, AMV reverse transcriptase, or a combination thereof.

[0031] In some embodiments of the present invention, the buffer solution comprises dNTPs and metal ions (such as magnesium ions, manganese ions or calcium ions), and at least one of ATP and / or GTP.

[0032] In some embodiments of the present invention, the reverse transcription primer is oligo(dt). 12-18 Primers.

[0033] In some embodiments of the present invention, the reagents used for the PCR reaction include SYBR green mixture.

[0034] In some embodiments of the present invention, the kit further includes PCR amplification primers for the internal reference gene U6 and β-actin, as shown in SEQ ID NO:3-4 and SEQ ID NO:5-6, respectively.

[0035] A fifth aspect of the present invention provides a system for predicting the efficacy of adoptive NK therapy for triple-negative breast cancer, the system comprising:

[0036] The data collection module collects patient samples, measures the expression level of circDEK, and outputs the circDEK expression data to the model calculation module.

[0037] Model calculation module: Obtains the patient's risk coefficient and cut-off value, using 2 -ΔΔCt Methods for calculating the patient's risk coefficient;

[0038] Output prediction module: Outputs the efficacy of adoptive NK treatment for patients based on their risk coefficient and cut-off value.

[0039] In some embodiments of the present invention, the cut-off value is 0.00088.

[0040] In some embodiments of the present invention, when the patient's risk coefficient is lower than the cut-off value, the patient is determined to be a Responder; otherwise, the patient is determined to be a Non-Responder.

[0041] A sixth aspect of the invention provides the use of a circDEK inhibitor in the preparation of a product for improving the efficacy of adoptive NK therapy for triple-negative breast cancer.

[0042] In some embodiments of the present invention, the circDEK inhibitor includes at least one of the following: substances that inhibit circDEK activity, substances that reduce circDEK content, and substances that reduce circDEK expression levels.

[0043] In some embodiments of the present invention, the circDEK inhibitor is a substance that reduces the expression level of circDEK.

[0044] In some embodiments of the present invention, the substance that reduces circDEK expression level is at least one of (1) to (3):

[0045] (1) sgRNA, siRNA, dsRNA, miRNA, ribozyme or shRNA that target circDEK;

[0046] (2) Nucleic acid molecules encoding sgRNA, siRNA, dsRNA, miRNA, ribozyme or shRNA that target circDEK as described in (1);

[0047] (3) An expression cassette, vector, transgenic cell line or microorganism containing the nucleic acid molecule described in (1).

[0048] In some embodiments of the present invention, the nucleotide sequence of the shRNA targeting circDEK is shown in SEQ ID NO:8 or SEQ ID NO:9.

[0049] A seventh aspect of the present invention provides an shRNA, characterized in that the nucleotide sequence of the shRNA is as shown in SEQ ID NO:8 or SEQ ID NO:9.

[0050] An eighth aspect of the present invention provides a biological material for shRNA as described in the seventh aspect of the present invention, said biological material comprising any one of 1) to 12):

[0051] 1) A nucleic acid molecule encoding the shRNA of the seventh aspect of this invention;

[0052] 2) An expression cassette containing the nucleic acid molecule described in 1);

[0053] 3) A carrier containing the nucleic acid molecule described in 1);

[0054] 4) A carrier containing the expression box described in 2);

[0055] 5) Transgenic cell lines containing the nucleic acid molecules described in 1);

[0056] 6) A transgenic cell line containing the expression cassette described in 2);

[0057] 7) A transgenic cell line containing the vector described in 3);

[0058] 8) A transgenic cell line containing the vector described in 4);

[0059] 9) Recombinant microorganisms containing the nucleic acid molecules described in 1);

[0060] 10) Recombinant microorganisms containing the expression cassette described in 2);

[0061] 11) Recombinant microorganisms containing the vector described in 3);

[0062] 12) Recombinant microorganisms containing the vector described in 4).

[0063] In some embodiments of the present invention, the transgenic cell line does not contain propagation material.

[0064] A ninth aspect of the present invention provides a reagent comprising shRNA of the seventh aspect of the present invention and / or biological material of the eighth aspect of the present invention.

[0065] In some embodiments of the present invention, the reagent is used to improve the efficacy of adoptive NK cell therapy for triple-negative breast cancer.

[0066] A tenth aspect of the present invention provides the use of the shRNA of the seventh aspect of the present invention, the biomaterial of the eighth aspect of the present invention, and / or the reagent of the ninth aspect of the present invention in the preparation of a product for improving the efficacy of adoptive NK therapy for triple-negative breast cancer.

[0067] In some embodiments of the present invention, the product includes reagents, kits, and drugs.

[0068] The beneficial effects of this invention are:

[0069] This invention discloses for the first time that circDEK in breast cancer tissue can be used as an assessment of the sensitivity to adoptive NK cell therapy in triple-negative breast cancer. Specifically, in triple-negative breast cancer, the expression level of circDEK in tumor tissue is correlated with the efficacy of adoptive NK cell therapy (lower circDEK expression corresponds to better adoptive NK cell therapy efficacy), thereby predicting the sensitivity of triple-negative breast cancer to adoptive NK cell therapy. Furthermore, this invention provides a method for accurately predicting the efficacy of adoptive NK cell therapy by detecting the expression level of circDEK in the tumor tissue of triple-negative breast cancer patients (sensitivity 82.69%, specificity 94.23%, AUC 0.9331).

[0070] The triple-negative breast cancer adoptive NK therapy sensitivity kit provided by this invention can detect circDEK in tumor tissue by obtaining tumor specimens, thus achieving convenient operation.

[0071] This invention, based on real-time quantitative PCR, can predict and evaluate the efficacy of adoptive NK therapy for triple-negative breast cancer, screen patients with high treatment benefit, guide individualized clinical treatment, and improve the precision of treatment.

[0072] This invention designs a specific shRNA targeting circDEK that can effectively improve the efficacy of adoptive NK therapy in patients with triple-negative breast cancer. Experimental verification shows that reducing circDEK expression levels in tumor tissue can significantly improve the efficacy of adoptive NK therapy in patients with triple-negative breast cancer. Attached Figure Description

[0073] Figure 1 Example 3 uses the kit of the present invention to detect the expression differences of circDEK in different breast cancer cell lines.

[0074] Figure 2 The figure shows the difference in tumor volume of mice with breast cancer tumors expressing different levels of circDEK after adoptive NK treatment in vivo. In the figure, there is no significant difference in ns, ***P<0.001, ****P<0.0001.

[0075] Figure 3 In Example 5, the kit of the present invention was used to detect the expression difference of circDEK in different patient samples, N=110.

[0076] Figure 4 The figure shows the analysis results of the relationship between circDEK expression and immunotherapy efficacy in Example 5. In the figure, ****P<0.0001.

[0077] Figure 5The image shows the ROC curve of the sensitivity correlation between clinical prognosis and predictive efficacy of circDEK samples detected using the kit of the present invention in Example 5. The sensitivity is 82.69% and the specificity is 94.23%. Detailed Implementation

[0078] The present invention will be further described in detail below through specific embodiments.

[0079] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0080] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0081] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0082] Example 1

[0083] A kit for assessing the prognostic risk of breast cancer, the kit comprising amplification primers for circDEK; amplification primers for internal reference genes U6 and β-actin; reagents for RNA extraction; reagents for preparing a reverse transcription reaction system; and reagents for preparing a real-time quantitative PCR (RT-PCR) reaction system.

[0084] The amplification primer sequences for circDEK are as follows:

[0085] Forward primer: 5'-CCCCTACAGATGAAGAGTT-3' (SEQ ID NO:1);

[0086] Reverse primer: 5'-GACTTGCATTGTCAACCTC-3' (SEQ ID NO:2);

[0087] The amplification primers for the internal reference gene U6 are as follows:

[0088] Forward primer: 5'-GCTTCGGCAGCACATATACTAAAAT-3' (SEQ ID NO:3);

[0089] Reverse primer: 5'-CGCTTCACGAATTTGCGTGTCAT-3' (SEQ ID NO:4);

[0090] The amplification primers for the internal reference gene β-actin are as follows:

[0091] Forward primer: 5'-CTGGAACGGTGAAGGTGACA-3' (SEQ ID NO:5);

[0092] Reverse primer: 5'-AAGGGACTTCCTGTAACAATGCA-3' (SEQ ID NO: 6);

[0093] The reagents used for RNA extraction include those used in common RNA extraction methods, such as commercially available RNA extraction kits.

[0094] The reagents used to prepare the reverse transcription reaction system include reverse transcriptase, reverse transcription buffer, and pure water;

[0095] The reagents used to prepare the real-time quantitative PCR reaction system include SYBR green and nuclease-free pure water.

[0096] The nucleotide sequence of circDEK is shown in SEQ ID NO:7.

[0097] AAAAGAGTCTCATCGTGGAAGGCAAGAGGGAAAAGAAAAAAGTAGAGAGGTTGACAATGCAAGTCTCTTCCTTACAGAGAGAGCCATTTACAATTGCACAAGGAAAGGGGCAGAAACTTTGTGAAATTGAGAGGATACATTTTTTTCTAAGTAAGAAGAAAACCGATGAACTTAGAAATCTACACAAACTGCTTTACAACAGGCCAGGCACTGTGTCCTCATTAAAGAAGAATGTGGGTCAGTTCAGTGGCTTTCCATTTGAAAAAGGAAGTGTCCAATATAAAAAGAAGGAAGAAATGTTGAAAAAATTTAGAAATGCCATGTTAAAGAGCATCTGTGAGGTTCTTGATTTGGAGAGATCAGGTGTAAATAGTGAACTAGTGAAGAGGATCTTGAATTTCTTAATGCATCCAAAGCCTTCTGGCAAACCATTGCCGAAATCTAAAAAAACTTGTAGCAAAGGCAGTAAAAAGGAACGGAACAGTTCTGGAATGGCAAGGAAGGCTAAGCGAACCAAATGTCCTGAAATTCTGTCAGATGAATCTAGTAGTGATGAAGATGAAAAGAAAAACAAGGAAGAGTCTTCAGATGATGAAGATAAAGAAAGTGAAGAGGAGCCACCAAAAAAGACAGCCAAAAGAGAAAAACCTAAACAGAAAGCTACTTCTAAAAGTAAAAAATCTGTGAAAAGTGCCAATGTTAAGAAAGCAGATAGCAGCACCACCAAGAAGAATCAAAACAGTTCCAAAAAAGAAAGTGAGTCTGAGGATAGTTCAGATGATGAACCTTTAATTAAAAAGTTGAAGAAACCCCCTACAGATGAAGAGTTAAAGGAAACAATAAAGAAATTACTGGCCAGTGCTAACTTGGAAGAAGTCACAATGAAACAGATTTGCAAAAAG(SEQ ID NO:7).

[0098] Example 2

[0099] The method for detecting circRNA in a sample using the kit described in Example 1 includes the following steps:

[0100] (1) RNA extraction: RNA was extracted from the sample using reagents for RNA extraction. Specifically, in this embodiment, the RNA extraction kit for paraffin-embedded tissue (centrifuge column type) (Biotake, rp5322 (100 times)) was used to extract RNA from paraffin-embedded tissue.

[0101] 1) Cut the paraffin-embedded tissue into thin slices of 5-10 μm and place them in 1.5 mL centrifuge tubes.

[0102] 2) Add 1 mL of xylene and vortex for 10 s.

[0103] 3) Centrifuge at 12,000 rpm for 2 minutes at room temperature. Discard the supernatant, being careful not to remove the precipitate.

[0104] 4) Add 1 mL of anhydrous ethanol, vortex to mix, and centrifuge at 12,000 rpm for 2 min at room temperature.

[0105] 5) Remove the supernatant, being careful not to remove the precipitate. Let it air dry at room temperature for 10 minutes or until any residual ethanol has completely evaporated.

[0106] 6) Add 240 μL of PTL solution and 10 μL of proteinase K solution, and vortex to mix. Incubate at 55°C for 15 min, then at 80°C for 15 min.

[0107] 7) Add 750 μL of lysis buffer MRL, vortex to mix, and let stand at room temperature for 2 min.

[0108] 8) Add 0.2 mL of chloroform. Tightly cap the sample tube, shake vigorously for 15 seconds, and incubate at room temperature for 3 minutes.

[0109] 9) Centrifuge at 12,000 rpm for 10 min at 4℃. The sample will separate into three layers: a lower organic phase, a middle layer, and an upper colorless aqueous phase. RNA is present in the aqueous phase. Transfer the aqueous phase (approximately 600 μL) to a new tube for the next step.

[0110] 10) Add an equal volume of 70% ethanol (please check first to ensure anhydrous ethanol has been added), and mix by inverting (a precipitate may form at this point). Transfer the resulting solution and any precipitate together into the adsorption column RA (the adsorption column is placed inside the collection tube; if there is too much solution, pass it through the column in several batches).

[0111] 11) Centrifuge at 10,000 rpm for 45 seconds, discard the waste liquid, and put the adsorption column back into the collection tube.

[0112] 12) Add 500 μL of protein removal solution RE, centrifuge at 12,000 rpm for 45 seconds, and discard the waste liquid.

[0113] 13) Add 700 μL of rinsing buffer RW (please check if anhydrous ethanol has been added first), centrifuge at 12,000 rpm for 60 s, and discard the waste liquid.

[0114] 14) Add 500 μL of rinsing buffer RW, centrifuge at 12,000 rpm for 60 s, and discard the waste liquid.

[0115] 15) Place the adsorption column RA back into the empty collection tube, open the centrifuge column cap, and centrifuge at 12,000 rpm for 2 minutes to remove as much of the wash solution as possible, so as to avoid the residual ethanol in the wash solution inhibiting the downstream reaction.

[0116] 16) Remove the adsorption column RA and place it in an RNAse-free centrifuge tube. Add 30 μL of RNAse-free water (preheating in a 65–70°C water bath beforehand will improve the effect). Incubate at room temperature for 2 minutes, then centrifuge at 12,000 rpm for 1 minute. Collect the purified RNA and store it at -20°C or lower for later use.

[0117] (2) Preparation of cDNA (RT)

[0118] Electrophoresis is used to test the quality of RNA samples.

[0119] Pre-denaturation: Prepare Mix1 (10 μL system, see Table 1 for details), heat at 65 °C for 5 min to denature and destroy the secondary structure of RNA, and then place on ice for 2 min.

[0120] Table 1 Mix 1

[0121]

[0122] Prepare Mix2 (Table 2) during pre-denaturation.

[0123] Table 2 Mix2

[0124]

[0125] Aliquot Mix2 into the pre-denatured and cooled tubes. If air bubbles are present, centrifuge briefly. Incubate at room temperature for 5 minutes. Set the PCR instrument to the reverse transcriptase operating temperature as follows:

[0126] 30℃ for 10 minutes;

[0127] 42–50℃, 15–30 min;

[0128] 95℃ for 5 minutes;

[0129] The synthesized cDNA first strand was stored at -20°C for later use.

[0130] (3) RT-PCR (Reverse Transcription PCR using Quantitative Real-Time Fluorescence) detection

[0131] Prepare the PCR reaction solution (10 μL system) according to the composition shown in Table 3.

[0132] Table 3 PCR reaction system

[0133]

[0134] PCR reaction procedure:

[0135] 3STEP PCR reaction conditions:

[0136] 94℃30sec55~65℃30sec, 30cycles72℃, 1min / kbp.

[0137] Risk value calculation: using 2 -ΔΔCt The relative expression level of circDEK was calculated using this method.

[0138] Example 3: Differential expression of circDEK in triple-negative breast cancer

[0139] 1. Experimental Methods

[0140] (1) The expression level of circDEK in breast cancer cell lines (including hormone receptor positive cell lines: ZR75-1 cells, T47D cells, MCF-7 cells, HER-2 overexpressing cell lines: SKBR-3 cells and BT-474 cells, triple negative cell lines: HCC-1937 cells, MDA-MB-468 cells, MDA-MB-231 cells, BT-549 cells and HS-578T cells) and breast epithelial cells (MCF10A cells) was detected using the kit described in Example 1. The detection method is as described in Example 2.

[0141] (2) Statistical analysis

[0142] Statistical analysis was performed using GraphPadPrism software (Version 8.0.2). All means were calculated from at least three independent experiments.

[0143] 2. Experimental Results

[0144] This study investigated the expression of circDEK in one type of mammary epithelial cell and ten types of breast cancer cell lines. The results showed that circDEK was differentially expressed in triple-negative breast cancer cell lines and hormone receptor-positive cell lines, with lower expression levels in HER-2 overexpressing cell lines. Figure 1 ).

[0145] 3. Experimental Conclusions

[0146] circDEK is differentially expressed in triple-negative breast cancer cell lines.

[0147] Example 4: Breast cancer cell lines with low circDEK expression showed better responsiveness to adoptive NK therapy.

[0148] 1. Experimental Methods

[0149] (1) Construction of mouse orthotopic xenograft model

[0150] Breast cancer cell lines with different circDEK expression were constructed using shRNA and pCD25-based overexpression plasmids. The specific steps are as follows:

[0151] circDEK short hairpin RNA (shRNA) and negative control lentivirus were purchased from Guangzhou Aiji Biotechnology Co., Ltd. (Guangzhou, China), and their sequences are as follows:

[0152] shcircDEK-1: 5'-TTTGCAAAAAGAAAAGAGT-3' (SEQ ID NO: 8);

[0153] shcircDEK-2: 5'-CAGATTTGCAAAAAGAAAA-3' (SEQ ID NO: 9);

[0154] circDEK overexpression (OE) and negative control lentiviruses were purchased from Guangzhou Aiji Biotechnology Co., Ltd. (Guangzhou, China). Primary breast cancer cells were cultured at 1×10⁻⁶ cells / year. 5 Cells were seeded at a density of [number] cells / well in low-adhesion 6-well plates. 10 μg / mL polybrene was added to improve transfection efficiency. Lentiviral virus was added and mixed well (MOI = 10), then the volume was increased to 2 mL of complete culture medium. Forty-eight hours post-transfection, when cells were in good condition, stable transfected cells were selected using puromycin or blastcinonium based on the resistance tag contained in the lentiviral vector. Transfection efficiency was verified by qPCR, and subsequent experiments were conducted.

[0155] Female NSG mice aged 4–5 weeks and weighing 15–16 g were selected as experimental animals. After acclimatization for 7 days, the experiments were conducted. One × 10^6 breast cancer cells were injected into the mammary fat pad of each mouse. The cells were fully resuspended using a pipette tip, and then 100 μL was drawn into a 1 mL syringe, inserted at a 45° angle, and slowly injected subcutaneously. After injection, the needle was withdrawn slowly, and the skin was disinfected with an alcohol swab. No further treatment was required. Tumor formation was observed one week later. During the observation period, tumor formation was recorded every three days, and the tumor size (length × width 2 × 0.5) was measured and recorded, thus establishing a mouse orthotopic xenograft tumor model.

[0156] (2) Adoptive NK cell therapy

[0157] NK-92 cell lines were expanded and cultured, and irradiated (10 Gy) before infusion. On the third day after tumor implantation, 1 × 10^7 NK-92 cells were injected per tumor into each mouse. Twenty-eight days later, mice were euthanized using an overdose anesthesia method, and the tumors were removed. The mice were euthanized as a humane endpoint if the following conditions were observed: tumor volume reaching 10% of the mouse's body weight, average diameter exceeding 10 mm, rapid weight loss of approximately 15%, hemiplegia, decreased appetite, or other abnormal symptoms, or persistent hypothermia and obvious signs of impending death.

[0158] 2. Experimental Results

[0159] In this embodiment, two cell lines expressing high levels of circDEK (denoted as the high-expression circDEK group) and two cell lines expressing low levels of circDEK (denoted as the low-expression circDEK group) were constructed. Mouse experiments showed that the low-expression circDEK group had a better response to adoptive NK cell therapy and smaller tumor volume, while the high-expression circDEK group responded poorly to adoptive NK cell therapy and had a larger tumor burden in mice. Figure 2 ).

[0160] 3. Experimental Conclusions

[0161] Mice with low circDEK expression showed better response to adoptive NK cell therapy.

[0162] Example 5: circDEK expression status predicts NK cell therapy responsiveness

[0163] 1. Experimental Methods

[0164] (1) circDEK detection

[0165] Same as Embodiment 2 of the present invention.

[0166] (2) Establishment of primary tumor cell lines

[0167] Fresh breast cancer tissue specimens were collected from patients who underwent breast cancer surgery at Sun Yat-sen Memorial Hospital, Sun Yat-sen University, between September 2020 and December 2024. Excess adipose tissue and necrotic tissue were removed, and the specimens were rinsed thoroughly with DMEM. The specimens were then minced with scissors and a scalpel and placed in a digestion solution (collagenase I / collagenase II 1:1, trypsin, dissolved in DMEM). The digestion was carried out at 37°C with a constant-temperature shaker at 100 rpm for 1–2 hours. The digestion effect was observed; if the tissue fragments were not significantly loose or were large, the digestion time could be appropriately extended. After digestion, the cell suspension was filtered through a 100-mesh sieve, and the filtrate was collected in 50 mL centrifuge tubes. The tubes were centrifuged at 1000 rpm for 5 minutes, and the supernatant was discarded. Complete culture medium was added, the cells were resuspended, and then transferred to culture flasks.

[0168] (3) Co-culture of tumor cells and NK cells in vitro

[0169] After counting the tumor cells, 5×10^4 cells / well were seeded into a 24-well plate. After overnight incubation, 5×10^5 NK-92 cells were placed in the upper chamber (0.4 μm pore size) and co-cultured for 4–6 h. Then, the NK-92 cells were used for subsequent experiments.

[0170] (4) NK cell flow cytometry analysis

[0171] NK-92 cells were centrifuged at 500g, 4℃ for 5 min. The cell pellet was then stained with the primary antibody (BioLegend) for flow cytometry. The primary antibody was diluted according to the manufacturer's instructions to 100 μL per sample, and the cells were incubated on ice in the dark for 30 min. After incubation, the cells were washed with 1 mL of PBS, centrifuged at 500g, 4℃ for 5 min, and the supernatant was removed. This process was repeated three times. Cell fixation and permeabilization were performed using a fixation and permeabilization kit, with the washing steps as above. Finally, intracellular antibody staining (BioLegend) was performed, diluted according to the manufacturer's instructions to 100 μL per sample, and the cells were incubated on ice in the dark for 30 min.

[0172] 2. Experimental Results

[0173] This embodiment detected the expression level of circDEK in 110 patients with triple-negative breast cancer. The procedure was repeated three times independently, with a cut-off value of 0.00088. Figure 3 Based on NK cell flow cytometry results and IFN-γ production levels, the NK functional responses stimulated by different tumor cells were differentiated and defined as Responder and Non-Responder. Experimental results indicated that circDEK expression was low in the Responder group. Figure 4 ).

[0174] Further, ROC curves were established based on different circDEK expression levels to reflect the relationship between circDEK expression levels in tumors and predictive response to adoptive NK therapy. The results showed a sensitivity of 82.69%, a specificity of 94.23%, and an area under the curve (AUC) of 0.9331. Figure 5 The results indicate that circDEK, as a biomarker, has high accuracy in predicting adoptive NK cell therapy in triple-negative breast cancer patients.

[0175] 3. Experimental Conclusions

[0176] Breast cancer samples with low circDEK expression exhibit high NK cell reactivity, suggesting that detecting circDEK expression levels in patient breast cancer tissue can effectively predict the efficacy of adoptive NK cell therapy in triple-negative breast cancer patients.

[0177] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. Use of a reagent for detecting circDEK in the manufacture of a product for predicting the efficacy of adoptive NK therapy for triple-negative breast cancer.

2. Use according to claim 1, characterized in that, The reagent for detecting circDEK includes a reagent for quantitatively detecting circDEK.

3. Use according to claim 2, characterized in that, The reagent includes a reagent for detecting the circDEK by PCR, biochip method, nucleic acid sequencing method.

4. Use according to claim 2, characterized in that, The reagent includes at least one of a reagent specific to circDEK, a probe specific to circDEK, a gene chip, and a PCR primer.

5. Use according to claim 4, characterized in that, The nucleotide sequence of the PCR primer is shown in SEQ ID NO: 1-2.

6. A system for predicting the efficacy of adoptive NK therapy for triple negative breast cancer, characterized by, The system comprises: a data collection module that collects a sample from a patient, measures the expression level of circDEK, and outputs the circDEK expression level data to a model calculation module; Model calculation module: obtain the risk coefficient of the patient and the cut-off value, adopt the 2 -ΔΔCt method to calculate the risk coefficient of the patient; an output prediction module that outputs the efficacy of adoptive NK therapy for the patient according to the risk coefficient of the patient and a cut-off value.

7. The system of claim 6, wherein, The cut-off value is 0.00088.

8. The system of claim 6, wherein, When the risk coefficient of the patient is lower than the cut-off value, the patient is determined to be a Responder, otherwise the patient is determined to be a Non-Responder.

9. Use of a circDEK inhibitor in the manufacture of a product for improving the efficacy of adoptive NK therapy for triple-negative breast cancer. The circDEK inhibitor is a reagent for reducing the expression level of circDEK. The reagent for reducing the expression level of circDEK is at least one of (1)-(3): (1) an shRNA targeting circDEK; (2) a nucleic acid molecule encoding the shRNA targeting circDEK of (1); (3) an expression cassette, a vector, a transgenic cell line, or a microorganism comprising the nucleic acid molecule of (1); The nucleotide sequence of the shRNA targeting circDEK is shown in SEQ ID NO: 8 or SEQ ID NO:

9.

10. A shRNA, characterized in that, The nucleotide sequence of the shRNA is shown in SEQ ID NO: 8 or SEQ ID NO:

9.

11. A biological material associated with the shRNA of claim 10, the biological material comprising any one of (1)-(12): (1) a nucleic acid molecule encoding the shRNA of claim 10; (2) an expression cassette comprising the nucleic acid molecule of (1); (3) a vector comprising the nucleic acid molecule of (1); (4) a vector comprising the expression cassette of (2); (5) a transgenic cell line comprising the nucleic acid molecule of (1); (6) a transgenic cell line comprising the expression cassette of (2); (7) a transgenic cell line comprising the vector of (3); (8) a transgenic cell line comprising the vector of (4); (9) a recombinant microorganism containing the nucleic acid molecule of (1); (10) a recombinant microorganism containing the expression cassette of (2); (11) a recombinant microorganism containing the vector of (3); (12) a recombinant microorganism containing the vector of (4).

12. An agent, characterized in that, The reagent comprises the shRNA of claim 10 and / or the biological material of claim 11.

13. Use of the shRNA of claim 10, the biomaterial of claim 11 and / or the agent of claim 12 for the preparation of a product for increasing the efficacy of adoptive NK therapy for triple negative breast cancer.

Images