Artificial nucleic acid molecules

Abstract

Relates to the field of biomedicine. The present invention relates to an artificial nucleic acid molecule, specifically to an artificial nucleic acid molecule comprising at least one open reading frame and at least one 3 '-untranslated region element, and having high translation efficiency.

Description

Artificial nucleic acid molecule

[0001] The present invention belongs to the field of biomedicine. The present invention relates to an artificial nucleic acid molecule, which comprises an open reading frame, a 3'-untranslated region element (3'-UTR element) and / or a 5'-untranslated region element (5'-UTR element). The present invention also relates to a vector comprising a 3'-UTR element and / or a 5'-UTR element, to a cell comprising the artificial nucleic acid molecule or the vector, to a lipid composition or a pharmaceutical composition comprising the artificial nucleic acid molecule or the vector, and to a kit comprising the artificial nucleic acid molecule, the vector, the lipid composition and / or the pharmaceutical composition, preferably for the fields of gene therapy and / or gene vaccination.

[0002] For gene therapy and gene vaccination, stable RNA is usually required. Stable RNA enables the product encoded by the RNA sequence to accumulate in vivo and, during its storage, preparation and administration, stable RNA can maintain its structural and functional integrity. Therefore, there is a need to provide stable RNA molecules for gene therapy or gene vaccination to prevent them from undergoing early degradation or decay. As a solution for mRNA stabilization, it has been found that naturally occurring eukaryotic mRNA molecules contain specific stabilization elements. For example, its 3'-untranslated region (3'-UTR) and / or 5'-untranslated region (5'-UTR). Both 3'-UTR and 5'-UTR are typical premature mRNA elements.

[0003] An mRNA molecule carries a gene encoding a corresponding protein. The two sides of this gene have specific untranslated regions at the 5' of the AUG start codon and at the 3' of the stop codon, and these regions are called 5'-untranslated region and 3'-untranslated region. Generally, the 3'-UTR is a part of the sequence between the protein-coding region (open reading frame (ORF) or coding sequence (CDS)) and the polyadenylation sequence, which can regulate the stability, localization and expression of mRNA.

[0004] In the prior art, many untranslated region sequences that are beneficial to improving the stability and expression level of mRNA have been designed and experimentally studied based on the untranslated regions of some naturally occurring proteins. However, there is still a need in the art for more untranslated region sequences that are more beneficial to enhancing the stability and safety of gene therapy and gene vaccination.

[0005] SUMMARY OF THE INVENTION

[0006] In one aspect, the present invention provides an artificial nucleic acid molecule, which comprises

[0007] a. at least one open reading frame (ORF); and

[0008] b. At least one 3'-untranslated region element (3'-UTR element), wherein the 3'-UTR element comprises a nucleic acid sequence selected from the following:

[0009] (i) wherein the 3'-UTR element comprises a variant of the nucleic acid sequence shown in SEQ ID NO: 44, which variant, compared with the nucleic acid sequence shown in SEQ ID NO: 44, comprises truncation, terminal extension, and / or 1, 2, 3 or more mutations, additions or deletions; or (ii) wherein the 3'-UTR element comprises the nucleic acid sequence of the 3'-UTR of a transcript derived from the following genes: HCV, CoV2, CVB3, AES and AAT, or a variant thereof, which variant, compared with the nucleic acid sequence from which it is derived, comprises truncation, terminal extension, and / or 1, 2, 3 or more mutations, additions or deletions; or (iii) wherein the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 16; or the corresponding RNA sequence of the above nucleic acid sequences.

[0010] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 3.

[0011] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 4.

[0012] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 44 and further comprises the nucleic acid sequence of SEQ ID NO: 90, 91 or 93.

[0013] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 1, 2 or 5.

[0014] In one embodiment, the nucleic acid sequence is the nucleic acid sequence of the 3'-UTR of a transcript derived from the following viral genes: HCV, CoV2 and CVB3; or the nucleic acid sequence of the 3'-UTR of a transcript derived from the mouse gene AES; or the nucleic acid sequence of the 3'-UTR of a transcript derived from the human gene AAT; or the nucleic acid sequence of the 3'-UTR of a transcript derived from the bovine gene AES, wherein the variant, compared with the nucleic acid sequence from which it is derived, comprises truncation, terminal extension, and / or 1, 2, 3 or more mutations, additions or deletions.

[0015] In one embodiment, the 3'-UTR element has a length of 3 - 500 nucleotides, preferably 5 - 250 nucleotides, more preferably 90 - 215 nucleotides.

[0016] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 6, 7, 8, 9 or 12.

[0017] In one embodiment, the 3'-UTR element further comprises the nucleic acid sequence of SEQ ID NO: 92.

[0018] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 10, 14 or 15.

[0019] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 12 and further comprises the nucleic acid sequence of SEQ ID NO: 9 or 94.

[0020] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 11 or 13.

[0021] In one embodiment, the artificial nucleic acid molecule further comprises at least one 5'-untranslated region element (5'-UTR element).

[0022] In one embodiment, the 5'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 45.

[0023] In one embodiment, the artificial nucleic acid molecule further comprises a 5' cap structure, a polycytidylic acid sequence, a polyadenylic acid sequence or a histone stem-loop.

[0024] In one embodiment, the artificial nucleic acid molecule further comprises a 5' cap structure, a polycytidylic acid sequence, a polyadenylic acid sequence and a histone stem-loop.

[0025] In one embodiment, the ORF is codon-optimized.

[0026] In one embodiment, the artificial nucleic acid molecule is RNA, preferably mRNA.

[0027] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 or 62.

[0028] In yet another aspect, the present invention further provides a vector comprising the artificial nucleic acid molecule of the present invention.

[0029] In another aspect, the present invention further provides a cell comprising the artificial nucleic acid molecule of the present invention or the vector of the present invention.

[0030] In another aspect, the present invention also provides a lipid composition, which comprises the artificial nucleic acid molecule of the present invention and a lipid encapsulating the artificial nucleic acid molecule, wherein the lipid encapsulating the artificial nucleic acid molecule comprises a cationic lipid, a phospholipid, a steroid and a polyethylene glycol-modified lipid; the lipid composition further comprises a cationic polymer, wherein the cationic polymer associates with the artificial nucleic acid molecule to form a complex, and the complex is co-encapsulated in the lipid to form a lipid polyplex.

[0031] In one embodiment, the cationic lipid comprises a lipid compound of formula (I), (II), (III), (IV) or a pharmaceutically acceptable salt thereof, as defined herein. In a preferred embodiment, the cationic lipid is M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2.

[0032] In one embodiment, the lipid composition comprises 10-70 mol% of a cationic lipid, 10-70 mol% of a phospholipid, 10-70 mol% of a steroid and 0.05-20 mol% of a polyethylene glycol-modified lipid.

[0033] In one embodiment, the lipid composition comprises 35-50 mol% of a cationic lipid, 10-30 mol% of a phospholipid, 24-44 mol% of a steroid and 1-1.5 mol% of a polyethylene glycol-modified lipid.

[0034] In a preferred embodiment, the lipid composition comprises 35-50 mol% of a cationic lipid, 10-30 mol% of DOPE, 24-44 mol% of cholesterol and 1-1.5 mol% of DMG-PEG.

[0035] In a preferred embodiment, the lipid composition comprises 50 mol% of a cationic lipid, 10 mol% of DOPE, 38.5 mol% of cholesterol and 1.5 mol% of DMG-PEG.

[0036] In a preferred embodiment, the lipid composition comprises 40 mol% of a cationic lipid, 15 mol% of DOPE, 43.5 mol% of cholesterol and 1.5 mol% of DMG-PEG.

[0037] In yet another aspect, the present invention also provides a pharmaceutical composition, which comprises the artificial nucleic acid molecule of the present invention, the carrier of the present invention, the cell of the present invention or the lipid composition of the present invention, and a pharmaceutically acceptable carrier, excipient or diluent.

[0038] In yet another aspect, the present invention also provides the use of the artificial nucleic acid molecule of the present invention, the vector of the present invention, the cell of the present invention, the lipid composition of the present invention or the pharmaceutical composition of the present invention in the preparation of a vaccine or a drug for gene therapy.

[0039] In yet another aspect, the present invention also provides the use of the artificial nucleic acid molecule of the present invention, the vector of the present invention, the cell of the present invention, the lipid composition of the present invention or the pharmaceutical composition of the present invention in the preparation of a drug for treating or preventing a disease.

[0040] In yet another aspect, the present invention also provides a method for increasing the translation efficiency of an artificial nucleic acid molecule, preferably an mRNA molecule or a vector, the method comprising ligating an open reading frame to a 3'-UTR element as defined in the present invention.

[0041] In yet another aspect, the present invention also provides a kit comprising the artificial nucleic acid molecule of the present invention, the vector of the present invention, the cell of the present invention, the lipid composition of the present invention or the pharmaceutical composition of the present invention.

[0042] In yet another aspect, the present invention also provides a method for generating an artificial nucleic acid molecule, the method comprising:

[0043] a) synthesizing the artificial nucleic acid molecule of the present invention; or

[0044] b) synthesizing an artificial nucleic acid molecule by means of the vector of the present invention.

[0045] Figure 1 shows the plasmid map of pUC57-Luc.

[0046] Figure 2 shows an exemplary sequence of the test artificial nucleic acid molecule.

[0047] Figure 3 shows the effect of different 3'-UTR elements on the expression of the reporter gene luciferase. The vertical axis is the serial number of the corresponding 3'-UTR element contained in different artificial nucleic acid molecules, wherein, relative to the test artificial nucleic acid molecule, the artificial nucleic acid molecule containing only the poly(A) sequence after the stop codon of the luciferase gene is the reference nucleic acid molecule (ctrl).

[0048] DEFINITIONS

[0049] All patents, patent applications, scientific publications, manufacturer's specifications and guidelines cited herein, whether above or below, are hereby incorporated by reference in their entirety. Nothing herein shall be construed as an admission that the present disclosure is not entitled to antedate such disclosure.

[0050] In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Moreover, the terms related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology, and the laboratory operation procedures used herein are all widely used terms and conventional procedures in the relevant fields. Meanwhile, for a better understanding of the present invention, the definitions and explanations of relevant terms are provided below.

[0051] As used herein, "at least one" or "one or more" may represent 1, 2, 3, 4, 5, 6, 7, 8 or more.

[0052] As used herein, the expressions "comprising", "including", "containing", and "having" are open-ended, meaning including the recited elements, steps, or components but not excluding other unrecited elements, steps, or components. The expression "consisting of" does not include any unstated element, step, or component. The expression "consisting essentially of" means that the scope is limited to the specified elements, steps, or components, plus any optional elements, steps, or components that do not significantly affect the basic and novel properties of the claimed subject matter. It should be understood that the expressions "consisting essentially of" and "consisting of" are encompassed within the meaning of the expression "including".

[0053] As used herein, the connecting term "and / or" between multiple recited elements should be understood to include both the individual and combined options. In other words, "and / or" includes "and" as well as "or". For example, A and / or B includes A, B, and A + B. A, B, and / or C includes A, B, C, and any combination thereof, such as A + B, A + C, B + C, and A + B + C. More elements defined by "and / or" are understood in a similar manner and include any one of them and any combination thereof.

[0054] Unless otherwise specified, any numerical value or numerical range, such as a concentration or concentration range, should in any case be understood to be modified by the term "about". Thus, the numerical value generally includes ±10% of the stated value. For example, a concentration of 1 mg / mL includes 0.9 mg / mL to 1.1 mg / mL. Similarly, a concentration range of 1% to 10% (w / v) includes 0.9% (w / v) to 11% (w / v). As used herein, the use of numerical ranges clearly includes all possible sub-ranges, all individual numerical values within the range, including integers and fractions within the range, unless the context clearly indicates otherwise.

[0055] As used herein, "nucleotide" includes deoxyribonucleotides and ribonucleotides and their derivatives. As used herein, "ribonucleotide" is a constituent of ribonucleic acid (RNA), consisting of one molecule of base, one molecule of pentose sugar, and one molecule of phosphoric acid, and refers to a nucleotide having a hydroxyl group at the 2'-position of the β-D-ribofuranosyl group. "Deoxyribonucleotide" is a constituent of deoxyribonucleic acid (DNA), also consisting of one molecule of base, one molecule of pentose sugar, and one molecule of phosphoric acid, and refers to a nucleotide in which the hydroxyl group at the 2'-position of the β-D-ribofuranosyl group is replaced by hydrogen, and is the main chemical component of chromosomes. "Nucleotide" is usually denoted by a single letter representing the base therein: "A(a)" refers to deoxyadenosine monophosphate or adenosine monophosphate containing adenine, "C(c)" refers to deoxycytidine monophosphate or cytidine monophosphate containing cytosine, "G(g)" refers to deoxyguanosine monophosphate or guanosine monophosphate containing guanine, "U(u)" refers to uridine monophosphate containing uracil, and "T(t)" refers to deoxythymidine monophosphate containing thymine.

[0056] As used herein, the terms "polynucleotide" and "nucleic acid" are used interchangeably and refer to a polymer of deoxyribonucleotides (deoxyribonucleic acid, DNA) or a polymer of ribonucleotides (ribonucleic acid, RNA). "Polynucleotide sequence", "nucleic acid sequence", and "nucleotide sequence" are used interchangeably to denote the order of nucleotides in a polynucleotide. Those skilled in the art should understand that the DNA coding strand (sense strand) and the RNA it encodes can be regarded as having the same nucleotide sequence, and deoxythymidine monophosphate in the DNA coding strand sequence corresponds to uridine monophosphate in the RNA sequence it encodes.

[0057] As used herein, "artificial nucleic acid molecule" can be understood as a non-natural nucleic acid molecule. Such a nucleic acid molecule can be non-natural due to its individual sequence (which does not exist in nature) and / or due to other modifications (such as structural modifications of nucleotides that do not exist in nature). Artificial nucleic acid molecules can be DNA molecules, RNA molecules, or hybrid molecules containing both DNA and RNA moieties. Typically, artificial nucleic acid molecules can be designed and / or produced by genetic engineering methods. In this case, the artificial nucleic acid molecule contains an artificial sequence that is usually not present in nature, and the artificial sequence differs from the wild-type sequence by at least one nucleotide. The term "wild-type sequence" can be understood as a naturally occurring sequence.

[0058] As used herein, "modified" refers to non-natural. For example, an RNA can be a modified RNA. That is, an RNA can include one or more non-naturally occurring nucleobases, nucleosides, nucleotides, or linking groups. A "modified" group can also be referred to herein as an "altered" group. A group can be modified or altered chemically, structurally, or functionally. For example, a modified nucleobase can include one or more non-naturally occurring substitutions.

[0059] As used herein, the term "transfection" refers to the introduction of a nucleic acid molecule, such as a DNA or RNA (e.g., mRNA) molecule, into a cell, preferably into a eukaryotic cell. Within the scope of the present invention, the term "transfection" includes any method known to those skilled in the art for introducing a nucleic acid molecule into a cell, preferably into a eukaryotic cell, such as into a mammalian cell. Such methods include, for example, electroporation, lipid transfection, such as cationic lipid- and / or liposome-based transfection, calcium phosphate precipitation, nanoparticle-based transfection, virus-based transfection, or transfection based on cationic polymers (such as DEAE-dextran or polyethyleneimine), etc. Preferably, the method is lipid transfection.

[0060] As used herein, the term "expression" includes transcription and / or translation of a nucleotide sequence. Thus, expression can involve the production of a transcript and / or a polypeptide.

[0061] As used herein, the term "translation efficiency" relates to a nucleic acid molecule (e.g., mRNA) containing an open reading frame (ORF). Translation efficiency is experimentally measurable. Translation efficiency is typically measured by determining the amount of protein translated from the ORF. For experimental measurement of translation efficiency, the ORF preferably encodes a reporter protein or any other protein that can be quantified. In the context of the present invention, translation efficiency is particularly applicable to such nucleic acid molecules that, in addition to the ORF, also contain at least one 3'-UTR element, preferably as defined herein. It should be understood that in the present invention, high translation efficiency is typically provided by a specific UTR element (a specific 3'-UTR element). Although for experimental quantification of translation efficiency, the ORF suitably encodes a reporter protein or any other protein that can be quantified, the present invention is not limited to such purposes; thus, at least one 3'-UTR element of the present invention (which provides high translation efficiency) can be included in a nucleic acid molecule containing an ORF that does not encode a reporter protein.

[0062] Translation efficiency is a relative term that is determined by determining and comparing the translation efficiencies of multiple (e.g., two or more) nucleic acid molecules, e.g., by experiments to quantify the proteins encoded by the ORFs. One of the nucleic acid molecules can be referred to as the "reference nucleic acid molecule" or "reference construct", and the other as the "test nucleic acid molecule" or "test construct", and the test nucleic acid molecule can be the artificial nucleic acid molecule described in the present invention. For this purpose, the reference nucleic acid molecule and the test nucleic acid molecule share the same ORF (the same nucleic acid sequence); and preferably, the nucleic acid sequence of the test nucleic acid molecule is the same as that of the reference nucleic acid molecule, except for the UTR element being tested, i.e., the 3'-UTR element; in other words, preferably, the test nucleic acid molecule and the reference nucleic acid molecule differ from each other only in that the 3'-UTR element has different nucleic acid sequences; such that the 3'-UTR element is the only structural feature that distinguishes the test nucleic acid molecule and the reference nucleic acid molecule.

[0063] As used herein, a "vector" is a vehicle for introducing an exogenous polynucleotide into a host cell, and when the vector is transformed into a suitable host cell, the exogenous polynucleotide is amplified or expressed. The vector generally remains free, but can be designed to integrate a gene or a part thereof into the chromosome of the genome. As used herein, the definition of a vector encompasses plasmids, linearized plasmids, viral vectors, cosmids, phage vectors, phagemids, artificial chromosomes (e.g., yeast artificial chromosomes and mammalian artificial chromosomes), etc. Viral vectors include but are not limited to retroviral vectors (including lentiviral vectors), adenoviral vectors, adeno-associated viral vectors, herpes viral vectors, poxviral vectors, and baculoviral vectors, etc.

[0064] As used herein, a "cell" is a cell for receiving, retaining, replicating, and amplifying a vector. The cell can also be used to express the polypeptide encoded by the vector. When the cell divides, the nucleic acid contained in the vector replicates, thereby amplifying the nucleic acid. The cell can be a eukaryotic cell or a prokaryotic cell. Suitable cells include but are not limited to CHO cells, various COS cells, HeLa cells, HEK cells such as HEK 293 cells.

[0065] As used herein, an "aliphatic" group is a non-aromatic group in which carbon atoms are connected in a chain and can be saturated or unsaturated.

[0066] As used herein, the term "alkyl" refers to an optionally substituted straight-chain or branched-chain saturated hydrocarbon comprising one or more carbon atoms. The term "C 1 -C 12 alkyl" or "C 1-12"Alkyl" refers to an optionally substituted straight-chain or branched-chain saturated hydrocarbon containing 1 to 12 carbon atoms. As used herein, the term "alkoxy" refers to an alkyl as described herein that is attached to the remainder of the molecule through an oxygen atom. The term "alkylene" refers to a divalent group formed by removing one hydrogen atom from the corresponding alkyl. The term "C 1 -C 12 alkylene" or "C 1-12 alkylene" refers to an optionally substituted straight-chain or branched-chain alkylene containing 1 to 12 carbon atoms.

[0067] As used herein, the term "alkenyl" refers to an optionally substituted straight-chain or branched-chain hydrocarbon containing two or more carbon atoms and at least one double bond. The term "C 2 -C 12 alkenyl" or "C 2-12 alkenyl" refers to an optionally substituted straight-chain or branched-chain hydrocarbon containing 2 to 12 carbon atoms and at least one carbon-carbon double bond. The alkenyl may include one, two, three, four or more carbon-carbon double bonds.

[0068] As used herein, the term "halogen" refers to fluorine, chlorine, bromine and iodine.

[0069] As used herein, the term "carbocycle" refers to a monocyclic or polycyclic non-aromatic system including one or more rings composed of carbon atoms. The term "C 3-8 carbocycle" means a carbocycle including 3 to 8 carbon atoms. The carbocycle may include one or more carbon-carbon double bonds or triple bonds. Examples of carbocycles include, but are not limited to, cyclopropyl, cyclopentyl, cyclohexyl, etc. As used herein, when the carbocycle is saturated (i.e., does not contain unsaturated bonds), it may also refer to the corresponding cycloalkyl. Unless otherwise specifically stated, the carbocycles described herein refer to both unsubstituted and substituted carbocycles, i.e., optionally substituted carbocycles.

[0070] As used herein, the term "heterocycle" refers to a monocyclic or polycyclic system including one or more rings and including at least one heteroatom. The heteroatom may be, for example, a nitrogen, oxygen, phosphorus or sulfur atom. The heterocycle may include one or more double bonds or triple bonds and may be non-aromatic. Examples of heterocycles include, but are not limited to, imidazolidinyl, oxazolidinyl, thiazolidinyl, pyrazolidinyl, isoxazolidinyl, isothiazolidinyl, morpholinyl, pyrrolidinyl, tetrahydrofuryl and piperidinyl. The heterocycle may contain, for example, 3 to 10 atoms (non-hydrogen), i.e., a 3- to 10-membered heterocycle (e.g., 3, 4, 5, 6, 7, 8, 9 or 10-membered), where one or more atoms are heteroatoms (e.g., N, O, S or P). When the heterocycle is saturated (i.e., does not contain unsaturated bonds), it may also refer to the corresponding heterocycloalkyl. Unless otherwise specifically stated, the heterocycles described herein refer to both unsubstituted and substituted heterocyclic groups, i.e., optionally substituted heterocycles.

[0071] As used herein, the term "aryl" refers to an all-carbon monocyclic or fused polycyclic aromatic ring group having a conjugated π-electron system. For example, C 6 -C 10 The alkylaryl may have 6-10 carbon atoms, such as 6, 7, 8, 9, 10 carbon atoms. Examples of aryl include, but are not limited to, phenyl, naphthyl, etc.

[0072] As used herein, the term "heteroaryl" refers to a monocyclic or fused polycyclic system containing at least one ring atom selected from N, O, S, with the remaining ring atoms being C and having at least one aromatic ring. The heteroaryl may have 5-10 ring atoms (5-10 membered heteroaryl), which includes 5, 6, 7, 8, 9 or 10 members, especially 5 or 6 membered heteroaryl. Examples of heteroaryl include, but are not limited to, pyrrolyl, furyl, thienyl, imidazolyl, oxazolyl, pyrazolyl, pyridyl, pyrimidinyl, pyrazinyl, quinolinyl, isoquinolinyl, tetrazolyl, triazolyl, triazinyl, benzofuryl, benzothienyl, indolyl, isoindolyl, etc.

[0073] As used herein, the term "interrupted by one or more groups" means that one or more such groups are present in the carbon chain and the remaining part of the carbon chain is connected to both ends of the one or more groups.

[0074] Unless otherwise specifically stated, the groups described herein (for example, any of R 1 -R 7 , such as alkyl, alkylene, alkenyl, aryl, amino, etc.) may be optionally substituted. Optional substituents may be selected from, but are not limited to: halogen atoms (such as chloro, bromo, fluoro or iodo), carboxylic acids (such as -C(O)OH), alcohols (such as hydroxy, -OH), esters (such as -C(O)OR or -OC(O)R), aldehydes (such as -C(O)H), carbonyls (such as -C(O)R, or represented by C=O), acyl halides (such as -C(O)X, where X is a halogen group selected from bromine, fluorine, chlorine and iodine), carbonate groups (such as -OC(O)OR), alkoxy groups (such as -OR), acetals (such as -C(OR) 2 R””, where each OR is the same or different alkoxy group and R”” is an alkyl or alkenyl group), phosphate groups (such as P(O) 4 3- ), thiols (such as -SH), sulfoxides (such as -S(O)R), sulfinic acids (such as -S(O)OH), sulfonic acids (such as -S(O) 2 OH), thioaldehydes (such as -C(S)H), sulfate groups (such as S(O) 4 2- ), sulfonyl groups (such as -S(O) 2 -), amides (such as -C(O)NR 2or -N(R)C(O)R), azide (e.g., -N 3 ), nitro (e.g., -NO 2 ), cyano (e.g., -CN), isocyano (e.g., -NC), acyloxy (e.g., -OC(O)R), amino (e.g., -NR 2 , NRH or -NH 2 ), carbamoyl (e.g., -OC(O)NR 2 , -OC(O)NRH or -OC(O)NH 2 ), sulfonamide (e.g., -S(O) 2 NR 2 , -S(O) 2 NRH, -S(O) 2 NH 2 , -N(R)S(O) 2 R, -N(H)S(O) 2 R, -N(R)S(O) 2 H, -N(H)S(O) 2 H), C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 6 -C 10 aryl, 5- to 10-membered heteroaryl or 3- to 10-membered heterocycle. In any of the foregoing, each R independently may be a substituent as defined herein, such as alkyl, alkoxy, alkylene, halogen, carbocycle, heterocycle, aryl, heteroaryl, alkenyl. In some embodiments, the substituent itself may be further substituted by, for example, one, two, three, four, five, or six substituents as defined herein. For example, an alkyl may be further substituted by one, two, three, four, five, or six substituents as described herein.

[0075] As used herein, the term "compound" is intended to include isotopically labeled compounds of the depicted structures. "Isotope" refers to atoms having the same atomic number but different mass numbers due to different numbers of neutrons in the nucleus, such as deuterium isotopes. For example, isotopes of hydrogen include tritium and deuterium. Additionally, the compounds, salts, or complexes of the invention may be combined with solvents or water molecules to form solvates and hydrates by conventional methods.

[0076] The term "optionally" or "optionally (e.g., optionally substituted)" means that the subsequently described event may or may not occur, and the description includes instances where the event or circumstance occurs and instances where the event or circumstance does not occur. For example, "optionally substituted alkyl" means that the alkyl may or may not be substituted, and the description includes substituted alkyl radicals and unsubstituted alkyl radicals.

[0077] It should be understood that when chemical groups are written in a specific order, the reverse order is also covered, unless otherwise stated. For example, in M 1 The general formula -(R) i -(M1) k -(R) m -(i.e., -(R) i -C(O)-NH-(R) m -), unless otherwise stated, also covers compounds in which M 1 is -NHC(O)-(i.e., -(R) i -NHC(O)-(R) m -).

[0078] As used herein, the term "contact" refers to establishing a physical connection between two or more entities. For example, contacting a mammalian cell with a lipid composition means that the mammalian cell and the lipid nanoparticles share a physical connection. Methods for contacting cells with external entities in vivo and in vitro are well known in the biological arts. For example, contacting a lipid composition with mammalian cells in a mammalian body can be carried out by different administration routes (e.g., intravenous, intramuscular, intradermal, and subcutaneous) and can involve different amounts of the lipid composition. In addition, the lipid composition can contact more than one mammalian cell.

[0079] As used herein, the term "delivery" refers to providing an entity to a target. For example, delivering an artificial nucleic acid molecule to a subject can involve administering a lipid composition comprising the artificial nucleic acid molecule to the subject.

[0080] As used herein, a "lipid component" is a component of a composition comprising one or more lipids. For example, a lipid component can comprise one or more cationic lipids, pegylated lipids, structural lipids, or helper lipids.

[0081] The phrase "pharmaceutically acceptable" is used herein to refer to compounds, salts, materials, compositions, and / or dosage forms that, within the scope of reasonable medical judgment, are suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic response, or other problems or complications, and are commensurate with a reasonable benefit / risk ratio.

[0082] As used herein, "pharmaceutically acceptable salts" refers to derivatives of the disclosed compounds in which the parent compound is modified by converting an existing acidic or basic moiety into its salt form (e.g., by reacting a free basic group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, inorganic or organic acid salts of basic residues such as amines; alkali metal or organic salts of acidic residues such as carboxylic acids, etc. Representative acid addition salts include, but are not limited to, acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptanoate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxyethanesulfonate, lactobionate, lactate, laurate, laurylsulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, tosylate, undecanoate, valerate, etc. Representative alkali metal or alkaline earth metal salts include, but are not limited to, sodium, lithium, potassium, calcium, magnesium salts, etc.; and non-toxic ammonium, quaternary ammonium, and amine cations, including, but not limited to, ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, etc. The pharmaceutically acceptable salts of the present invention include, for example, conventional non-toxic salts of the parent compounds formed from non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of the present invention can be synthesized from parent compounds containing basic or acidic moieties by conventional chemical methods. Generally, these salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of both; generally, a non-aqueous medium such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile is preferred.

[0083] As used herein, "gene therapy" can be understood as treating a patient's body or a separated component of a patient's body, such as a separated tissue / cell, with a nucleic acid encoding a peptide or protein. It typically can include at least one of the following steps: a) directly administering a nucleic acid (preferably an artificial nucleic acid molecule as defined herein) to the patient by any route of administration or to a separated cell / tissue of the patient in vitro, which results in transfection of the patient's cells in vivo / ex vivo or in vitro; b) transcribing and / or translating the introduced nucleic acid molecule; and optionally c) if the nucleic acid is not directly administered to the patient, readministering the separated, transfected cells to the patient.

[0084] As used herein, "gene vaccination" can typically be understood as vaccination by administration of a nucleic acid molecule encoding an antigen or immunogen or a fragment thereof. The nucleic acid molecule can be administered to the body of a subject or to isolated cells of a subject. When certain cells of the body are transfected or when isolated cells are transfected, the antigen or immunogen can be expressed by those cells and subsequently presented to the immune system, eliciting an adaptive (i.e., antigen-specific) immune response. Thus, gene vaccination typically includes at least one of the following steps: a) administering a nucleic acid (preferably an artificial nucleic acid molecule as defined herein) to a subject (preferably a patient), or to isolated cells of a subject, which typically results in transfection of the subject's cells in vivo or in vitro; b) transcribing and / or translating the introduced nucleic acid molecule; and optionally c) readministering the isolated, transfected cells to the subject (preferably a patient) if the nucleic acid was not directly administered to the patient.

[0085] As used herein, a "vaccine" refers to a composition comprising an active ingredient (such as an artificial nucleic acid molecule of the present invention) that can elicit an immune response in a vaccinated subject upon vaccination. In a specific embodiment, the immune response it induces can provide immune protection and is sufficient to prevent and / or alleviate at least one symptom associated with pathogen or disease infection.

[0086] As used herein, the term "treatment" refers to partially or completely alleviating, ameliorating, improving, relieving one or more symptoms or characteristics of a particular infection, disease, disorder or condition, delaying its onset, inhibiting its progression, reducing its severity or decreasing its occurrence. "Prevention" refers to guarding against a potential disease or guarding against symptom exacerbation or disease progression.

[0087] The term "preventive or therapeutic effective amount" refers to the amount of an agent (such as a nucleic acid, drug, composition, therapeutic agent, diagnostic agent, preventive agent, etc.) sufficient to prevent or inhibit the occurrence of a disease or symptom and / or slow down, alleviate, delay the development or severity of a disease or symptom. The preventive or therapeutic effective amount is affected by factors including but not limited to: the rate and severity of the development of the disease or symptom, the age, sex, weight and physiological condition of the subject, the duration of treatment, and the specific route of administration. The preventive or therapeutic effective amount can be administered in one or more doses. The preventive or therapeutic effective amount can be achieved by continuous or intermittent administration.

[0088] Artificial nucleic acid molecule

[0089] Provided herein is an artificial nucleic acid molecule comprising

[0090] a. at least one open reading frame (ORF); and

[0091] b. at least one 3'-untranslated region element (3'-UTR element).

[0092] As used herein, an "open reading frame (ORF)" is a sequence of nucleotide triplets that can be translated into a peptide or protein. The open reading frame preferably contains a start codon at the end of its 5'-untranslated region element, i.e., a combination of three consecutive nucleotides (ATG) that typically encodes the amino acid methionine, and a contiguous region that typically presents in multiples of three nucleotide lengths. The open reading frame of the present invention is preferably a nucleotide sequence composed of a number of nucleotides divisible by three, which starts with a start codon (e.g., ATG) and preferably ends with a stop codon (e.g., TAA, TGA, or TAG). The open reading frame can be isolated or integrated into a longer nucleic acid sequence, such as a vector or mRNA. The open reading frame can also be referred to as a "protein-coding region"

[0093] The untranslated region (UTR) can have features that provide regulatory effects, such as an increase or decrease in stability, localization, and / or translation efficiency. Polynucleotides containing UTRs can be administered to cells, tissues, or organisms, and one or more regulatory features can be measured using conventional methods.

[0094] As used herein, the term "3'-UTR" refers to a portion of an artificial nucleic acid molecule that is located 3' (i.e., "downstream") of the open reading frame and that is not translated into a protein. Generally, the 3'-UTR is a portion of the mRNA between the protein-coding region (open reading frame (ORF) or coding sequence (CDS)) of the mRNA and the polyadenylation sequence. The 3'-UTR of the mRNA is not translated into an amino acid sequence. The 3'-UTR plays an important role in the regulation of biological complexity, which can regulate the localization and expression of mRNA, can regulate the translation of mRNA, and can also regulate protein-protein interactions (see, e.g., Mayr C. What Are 3'UTRs Doing? Cold Spring Harb Perspect Biol. 2019 Oct 1;11(10):a034728).

[0095] In one embodiment, the artificial nucleic acid molecule comprises

[0096] a. at least one open reading frame (ORF); and

[0097] b. at least one 3'-untranslated region element (3'-UTR element), the 3'-UTR element comprising a variant of the nucleic acid sequence shown in SEQ ID NO: 44, the variant comprising a truncation, terminal extension, and / or 1, 2, 3, or more mutations, additions, or deletions as compared to the nucleic acid sequence shown in SEQ ID NO: 44.

[0098] In one embodiment, the 3'-UTR element comprises T87C or T94C as compared to SEQ ID NO: 44.

[0099] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:3.

[0100] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:3 and further comprises the nucleic acid sequence of SEQ ID NO:92.

[0101] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:4.

[0102] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and further comprises at least one nucleic acid sequence selected from the following: SEQ ID NO:6, 7, 9, 12, 90, 91, 92, 93, 95, and 96.

[0103] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and further comprises the nucleic acid sequence of SEQ ID NO:90.

[0104] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:1.

[0105] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and further comprises the nucleic acid sequence of SEQ ID NO:91.

[0106] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:2.

[0107] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and further comprises the nucleic acid sequence of SEQ ID NO:93.

[0108] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:5.

[0109] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and further comprises the nucleic acid sequence of SEQ ID NO:92.

[0110] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:17.

[0111] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and further comprises the nucleic acid sequence of SEQ ID NO:95.

[0112] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:18.

[0113] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and further comprises the nucleic acid sequence of SEQ ID NO:7.

[0114] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:25.

[0115] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and further comprises the nucleic acid sequences of SEQ ID NO:96 and 92.

[0116] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:26.

[0117] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and further comprises the nucleic acid sequences of SEQ ID NO:9 and SEQ ID NO:92.

[0118] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:27 or 38.

[0119] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and further comprises the nucleic acid sequences of SEQ ID NO:12 and 92.

[0120] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:29 or 40.

[0121] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and further comprises the nucleic acid sequence of SEQ ID NO:9.

[0122] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:37.

[0123] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and further comprises the nucleic acid sequence of SEQ ID NO:12.

[0124] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:39.

[0125] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and further comprises the nucleic acid sequence of SEQ ID NO:6.

[0126] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:41.

[0127] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and further comprises the nucleic acid sequence of SEQ ID NO:90, 91 or 93.

[0128] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:1, 2 or 5.

[0129] In one embodiment, the artificial nucleic acid molecule comprises

[0130] a. at least one open reading frame (ORF); and

[0131] b. at least one 3'-untranslated region element (3'-UTR element), the 3'-UTR element comprising the nucleic acid sequence of SEQ ID NO:1, 2, 3, 4, 5, 17, 18, 25, 26, 27, 29, 37, 38, 39, 40 or 41.

[0132] In a preferred embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:1, 2, 3, 4 or 5.

[0133] In one embodiment, the artificial nucleic acid molecule comprises

[0134] a. at least one open reading frame (ORF); and

[0135] b. at least one 3'-untranslated region element (3'-UTR element), the 3'-UTR element comprising the nucleic acid sequence of the 3'-UTR of a transcript derived from the following genes or a variant thereof: HCV, CoV2, DENV2, TCV, CYBA, BYDA, CVB3, AES and AAT, the variant comprising a truncation, terminal extension and / or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence from which it is derived.

[0136] The term "nucleic acid sequence derived from the 3'-UTR of a gene transcript" refers to a nucleic acid sequence based on the 3'-UTR sequence of a gene transcript or a fragment or portion thereof (preferably a naturally occurring gene or a fragment or portion thereof). The "nucleic acid sequence derived from the 3'-UTR of a gene transcript" includes a sequence corresponding to the entire 3'-UTR sequence, i.e., the full-length 3'-UTR sequence of the gene transcript, and a sequence corresponding to a fragment of the 3'-UTR sequence of the gene transcript. Preferably, a fragment of the 3'-UTR of a gene transcript comprises a continuous stretch of nucleotides corresponding to a continuous stretch of nucleotides in the full-length 3'-UTR of the gene transcript, which represents at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the full-length 3'-UTR of the gene transcript. In the present context, preferably, the fragment retains the regulatory function for the translation of the ORF linked to the 3'-UTR or a fragment thereof.

[0137] The term "truncated" refers to a fragment or portion of a nucleic acid sequence based on the 3'-UTR sequence of a gene transcript. Preferably, the truncated 3'-UTR sequence comprises a continuous stretch of nucleotides corresponding to a continuous stretch of nucleotides in the full-length 3'-UTR of the gene transcript, which represents at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the full-length 3'-UTR of the gene transcript.

[0138] The term "variant" refers to a variant of the 3'-UTR of a transcript of a naturally occurring gene, preferably a variant of the 3'-UTR of a transcript of a viral gene, more preferably a variant of the 3'-UTR of a transcript of a mammalian gene. The variant may be a modified 3'-UTR of a gene transcript. For example, compared with the naturally occurring 3'-UTR from which the variant is derived, the variant of the 3'-UTR may exhibit truncation, terminal extension, or deletion, addition and / or mutation of one or more nucleotides. Preferably, the variant of the 3'-UTR of a gene transcript is at least 40%, preferably at least 50%, more preferably at least 60%, more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% identical to the naturally occurring 3'-UTR from which the variant is derived.

[0139] As used herein, the term "terminal extension" refers to the addition of one or more nucleotides at the N-terminus or C-terminus of a variant of the 3'-UTR compared with the naturally occurring or modified 3'-UTR from which the variant is derived.

[0140] In one embodiment, the 3'-UTR element has a length of at least about 3 nucleotides, preferably at least about 5 nucleotides, more preferably at least about 10, 15, 20, 25 or 30 nucleotides, even more preferably at least about 50 nucleotides, and most preferably at least about 90 nucleotides. In a preferred embodiment, the 3'-UTR element has a length of 3 to about 500 nucleotides, preferably 5 to about 250 nucleotides, more preferably 90 to 215 nucleotides.

[0141] In one embodiment, the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the following viral genes: HCV, CoV2, DENV2, TCV, CYBA, BYDA, and CVB3, and is truncated.

[0142] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 8, 19, 21 or 23.

[0143] In one embodiment, the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the mouse gene AES, and is truncated.

[0144] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 9.

[0145] In one embodiment, the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the human gene AAT or AES, and is truncated.

[0146] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 12 or 96.

[0147] In one embodiment, the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the bovine gene AES, and is truncated.

[0148] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 98.

[0149] In one embodiment, the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the following viral genes: HCV, CoV2, DENV2, TCV, CYBA, BYDA, and CVB3, or a variant thereof, wherein the variant contains truncations and 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence from which it is derived.

[0150] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 6, 7, 20, 22, 30, 31 or 32.

[0151] In one embodiment, the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of bovine gene AES or a variant thereof, wherein the variant contains a truncation and 1, 2, 3 or more mutations, additions or deletions as compared to the nucleic acid sequence from which it is derived.

[0152] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:94.

[0153] In one embodiment, the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of mouse gene AES or a variant thereof, wherein the variant contains a truncation and 1, 2, 3 or more mutations, additions or deletions as compared to the nucleic acid sequence from which it is derived.

[0154] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:97.

[0155] In one embodiment, the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of mouse gene AES or a variant thereof, wherein the variant contains a truncation and a terminal extension as compared to the nucleic acid sequence from which it is derived.

[0156] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:9, and further comprises the nucleic acid sequence of SEQ ID NO:92 or 12.

[0157] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:10, 13 or 28.

[0158] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:9, and further comprises the nucleic acid sequences of SEQ ID NO:92 and 12.

[0159] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:33.

[0160] In one embodiment, the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of human gene AAT or a variant thereof, wherein the variant contains a truncation and a terminal extension as compared to the nucleic acid sequence from which it is derived.

[0161] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:12, and further comprises the nucleic acid sequence of SEQ ID NO:6, 9, 92, 94, 97 or 98.

[0162] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 11, 13, 14, 28, 34, 35, or 36.

[0163] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 12 and further comprises the nucleic acid sequences of SEQ ID NO: 9 and 92.

[0164] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 33.

[0165] In one embodiment, the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of bovine gene AES or a variant thereof, wherein the variant comprises truncation and terminal extension as compared to the nucleic acid sequence from which it is derived.

[0166] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 98 and further comprises the nucleic acid sequence of SEQ ID NO: 12.

[0167] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 35.

[0168] In one embodiment, the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of bovine gene AES or a variant thereof, wherein the variant comprises truncation, terminal extension, and one, two, three, or more mutations, additions, or deletions as compared to the nucleic acid sequence from which it is derived.

[0169] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 94 and further comprises the nucleic acid sequence of SEQ ID NO: 12.

[0170] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 11.

[0171] In one embodiment, the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the following viral genes: HCV, CoV2, DENV2, TCV, CYBA, BYDA, and CVB3, wherein the variant comprises truncation, terminal extension, and one, two, three, or more mutations, additions, or deletions as compared to the nucleic acid sequence from which it is derived.

[0172] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 6 and further comprises the nucleic acid sequence of SEQ ID NO: 92.

[0173] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:15.

[0174] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:7 and further comprises the nucleic acid sequence of SEQ ID NO:92.

[0175] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:24.

[0176] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:6 and further comprises the nucleic acid sequence of SEQ ID NO:12.

[0177] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:36.

[0178] In one embodiment, the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the mouse gene AES or a variant thereof, wherein the variant, compared with the nucleic acid sequence from which it is derived, comprises truncation, terminal extension, and one, two, three or more mutations, additions or deletions.

[0179] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:97 and further comprises the nucleic acid sequence of SEQ ID NO:12.

[0180] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:34.

[0181] In one embodiment, the artificial nucleic acid molecule comprises

[0182] a. at least one open reading frame (ORF); and

[0183] b. at least one 3'-untranslated region element (3'-UTR element), the 3'-UTR element comprising the nucleic acid sequence of SEQ ID NO:6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 19, 20, 21, 22, 23, 24, 28, 30, 31, 32, 33, 34, 35, 36, 94, 96, 97 or 98.

[0184] In a preferred embodiment, the artificial nucleic acid molecule comprises

[0185] a. at least one open reading frame (ORF); and

[0186] b. At least one 3'-untranslated region element (3'-UTR element), said 3'-UTR element comprising a nucleic acid sequence or a variant thereof of the 3'-UTR of a transcript derived from the following genes: HCV, CoV2, CVB3, AES, and AAT, said variant comprising a truncation, terminal extension, and / or 1, 2, 3, or more mutations, additions, or deletions as compared to the nucleic acid sequence from which it is derived.

[0187] In a preferred embodiment, said nucleic acid sequence is a nucleic acid sequence or a variant thereof of the 3'-UTR of a transcript derived from the following viral genes: HCV, CoV2, and CVB3, wherein said variant comprises a truncation, terminal extension, and / or 1, 2, 3, or more mutations, additions, or deletions as compared to the nucleic acid sequence from which it is derived.

[0188] In a preferred embodiment, said nucleic acid sequence is a nucleic acid sequence or a variant thereof of the 3'-UTR of a transcript derived from the murine gene AES, wherein said variant comprises a truncation, terminal extension, and / or 1, 2, 3, or more mutations, additions, or deletions as compared to the nucleic acid sequence from which it is derived.

[0189] In a preferred embodiment, said nucleic acid sequence is a nucleic acid sequence or a variant thereof of the 3'-UTR of a transcript derived from the human gene AAT, wherein said variant comprises a truncation, terminal extension, and / or 1, 2, 3, or more mutations, additions, or deletions as compared to the nucleic acid sequence from which it is derived.

[0190] In a preferred embodiment, said nucleic acid sequence is a nucleic acid sequence or a variant thereof of the 3'-UTR of a transcript derived from the bovine gene AES, wherein said variant comprises a truncation, terminal extension, and / or 1, 2, 3, or more mutations, additions, or deletions as compared to the nucleic acid sequence from which it is derived.

[0191] In a preferred embodiment, said nucleic acid sequence is a nucleic acid sequence or a variant thereof of the 3'-UTR of a transcript derived from the following viral genes: HCV, CoV2, and CVB3; or a nucleic acid sequence or a variant thereof of the 3'-UTR of a transcript derived from the murine gene AES; or a nucleic acid sequence or a variant thereof of the 3'-UTR of a transcript derived from the human gene AAT; or a nucleic acid sequence or a variant thereof of the 3'-UTR of a transcript derived from the bovine gene AES, wherein said variant comprises a truncation, terminal extension, and / or 1, 2, 3, or more mutations, additions, or deletions as compared to the nucleic acid sequence from which it is derived.

[0192] In an embodiment, said 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:6, 7, 8, 9, 10, 11, 12, 13, 14, or 15.

[0193] In an embodiment, said artificial nucleic acid molecule comprises

[0194] a. at least one open reading frame (ORF); and

[0195] b. at least one 3'-untranslated region element (3'-UTR element), said 3'-UTR element comprising a nucleic acid sequence of SEQ ID NO: 16, 42 or 43.

[0196] In a preferred embodiment, said 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 16.

[0197] In one embodiment, said artificial nucleic acid molecule comprises

[0198] a. at least one open reading frame (ORF); and

[0199] b. at least one 3'-untranslated region element (3'-UTR element), said 3'-UTR element comprising a nucleic acid sequence selected from the following:[[]]

[0200] (i) wherein said 3'-UTR element comprises a variant of the nucleic acid sequence shown in SEQ ID NO: 44, said variant compared to the nucleic acid sequence shown in SEQ ID NO: 44, comprising truncation, terminal extension and / or 1, 2, 3 or more mutations, additions or deletions; or

[0201] (ii) wherein said 3'-UTR element comprises a nucleic acid sequence or a variant thereof of the 3'-UTR of a transcript derived from the following genes: HCV, CoV2, DENV2, TCV, CYBA, BYDA, CVB3, AES and AAT, said variant compared to the nucleic acid sequence from which it is derived, comprising truncation, terminal extension and / or 1, 2, 3 or more mutations, additions or deletions; or

[0202] (iii) wherein said 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 16, 42 or 43.

[0203] In one embodiment, said artificial nucleic acid molecule comprises

[0204] a. at least one open reading frame (ORF); and

[0205] b. at least one 3'-untranslated region element (3'-UTR element), said 3'-UTR element comprising a nucleic acid sequence selected from the following:[[]]

[0206] SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 or 43.

[0207] The nucleic acid sequences of specific 3'-UTR elements are shown in Table 1.

[0208] Table 1. Nucleic acid sequences of 3'-UTR elements

[0209]

[0210]

[0211]

[0212] In a preferred embodiment, the artificial nucleic acid molecule comprises

[0213] a. at least one open reading frame (ORF); and

[0214] b. at least one 3'-untranslated region element (3'-UTR element), the 3'-UTR element comprising a nucleic acid sequence selected from:

[0215] (i) wherein the 3'-UTR element comprises a variant of the nucleic acid sequence shown in SEQ ID NO: 44, the variant comprising a truncation, terminal extension, and / or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence shown in SEQ ID NO: 44; or

[0216] (ii) wherein the 3'-UTR element comprises the nucleic acid sequence of the 3'-UTR of a transcript derived from the following genes: HCV, CoV2, CVB3, AES and AAT, or a variant thereof, the variant comprising a truncation, terminal extension, and / or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence from which it is derived; or

[0217] (iii) wherein the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 16.

[0218] In a particularly preferred embodiment, the artificial nucleic acid molecule comprises

[0219] a. at least one open reading frame (ORF); and

[0220] b. At least one 3'-untranslated region element (3'-UTR element), the 3'-UTR element comprising a nucleic acid sequence selected from:

[0221] (i) wherein the 3'-UTR element comprises a variant of the nucleic acid sequence shown in SEQ ID NO: 44, which variant, compared to the nucleic acid sequence shown in SEQ ID NO: 44, comprises truncation, terminal extension, and / or 1, 2, 3 or more mutations, additions or deletions; or

[0222] (ii) wherein the 3'-UTR element comprises the nucleic acid sequence or a variant thereof of the 3'-UTR of a transcript derived from the following genes: HCV, CoV2, CVB3, AES and AAT, which variant, compared to the nucleic acid sequence from which it is derived, comprises truncation, terminal extension, and / or 1, 2, 3 or more mutations, additions or deletions; or

[0223] (iii) wherein the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 16;

[0224] or the corresponding RNA sequences of the above nucleic acid sequences.

[0225] In a specific embodiment, the artificial nucleic acid molecule comprises

[0226] a. at least one open reading frame (ORF); and

[0227] b. at least one 3'-untranslated region element (3'-UTR element), the 3'-UTR element comprising a nucleic acid sequence selected from:

[0228] SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16.

[0229] As used herein, the term "5'-untranslated region element (5'-UTR element)" refers to a part of an artificial nucleic acid molecule that is located at the 5' end (i.e., "upstream") of an open reading frame and that is not translated into protein. Typically, the 5'-UTR starts at the transcription start site and ends at a nucleotide before the start codon of the open reading frame. The 5'-UTR plays a key role in regulating gene expression. The DNA sequence of the 5'-UTR can contain many cis-regulatory elements that can interact with the transcriptional machinery to regulate the abundance of messenger RNA (mRNA). In addition, the transcribed 5'-UTR consists of a variety of RNA-based regulatory elements, including the 5' cap structure, secondary structure, RNA-binding protein motifs, upstream open reading frames (uORFs), internal ribosome entry sites, terminal oligopyrimidine (TOP) tracts, and G-quadruplexes. These elements can alter the efficiency of mRNA translation; some can also affect mRNA transcription levels through changes in stability or degradation (see, e.g., Lim, Y., et al. Multiplexed functional genomic analysis of 5'untranslated region mutations across the spectrum of prostate cancer. Nat Commun 12, 4217 (2021)).

[0230] In a preferred embodiment, the artificial nucleic acid molecule further comprises at least one 5'-untranslated region element (5'-UTR element).

[0231] In a preferred embodiment, the 5'-untranslated region element (5'-UTR element) comprises the nucleic acid sequence of SEQ ID NO:45.

[0232] As used herein, the term "poly(A) sequence" or "poly(A) tail" refers to a nucleotide sequence that contains consecutive or non-consecutive adenosines. The poly(A) sequence is typically located at the 3' end of the RNA, such as the 3' end (downstream) of the 3'-UTR. In some embodiments, the poly(A) sequence does not contain nucleotides other than adenosines at its 3' end. The poly(A) sequence can be generated during the preparation of IVT-RNA by transcription of the coding sequence of a DNA template by a DNA-dependent RNA polymerase, or can be ligated to the free 3' end of the IVT-RNA, such as the 3' end of the 3'-UTR, by a DNA-independent RNA polymerase (poly(A) polymerase). In one embodiment, the artificial nucleic acid molecule further comprises a polyadenylate sequence.

[0233] As used herein, the term "polycytidylate sequence" refers to a nucleotide sequence that includes consecutive or non-consecutive cytidylate. The polycytidylate sequence is typically located at the 3'-end of RNA, such as at the 3'-end (downstream) of the 3'-UTR. In some embodiments, the polycytidylate sequence does not include nucleotides other than cytidylate at its 3'-end. In one embodiment, the artificial nucleic acid molecule further comprises a polycytidylate sequence.

[0234] As used herein, the term "5'-cap" generally refers to an N7-methylguanosine structure (also referred to as "m7G cap", "m7Gppp-") linked to the 5'-end of an mRNA via a 5'-to-5' triphosphate bond. The 5'-cap can be added co-transcriptionally to the RNA in vitro transcription (e.g., using an anti-reverse cap analog "ARCA"), or can be ligated to the RNA post-transcriptionally using a capping enzyme. In one embodiment, the artificial nucleic acid molecule further comprises a 5'-cap structure.

[0235] As used herein, a "stem-loop" (whether it is a histone stem-loop or not) can generally be present in single-stranded DNA, or more commonly in RNA. This structure is also referred to as a hairpin or hairpin loop, and generally consists of a stem and a (terminal) loop within a continuous sequence, wherein the stem is formed by two adjacent fully or partially reverse-complementary sequences separated by a short sequence that serves as a spacer to some extent, and the short sequence serving as the spacer becomes the loop of the stem-loop structure. These two adjacent fully or partially reverse-complementary sequences can be defined as, for example, stem-loop element stem 1 and stem 2. When these two adjacent fully or partially reverse-complementary sequences, e.g., stem-loop element stem 1 and stem 2, base-pair with each other, a double-stranded nucleic acid sequence fragment is formed, which contains an unpaired loop at its end formed by the short sequence located between stem-loop element stem 1 and stem 2 on the continuous sequence, thus forming a stem-loop.

[0236] As used herein, a "histone stem-loop" is derived from a histone gene (e.g., genes from histone families H1, H2A, H2B, H3, H4), and includes an intramolecular base-pairing of two adjacent fully or partially reverse-complementary sequences, thereby forming a stem-loop. In one embodiment, the artificial nucleic acid molecule further comprises a histone stem-loop.

[0237] In one embodiment, the artificial nucleic acid molecule further comprises a 5'-cap structure, a polycytidylate sequence, a polyadenylate sequence, or a histone stem-loop.

[0238] In one embodiment, the artificial nucleic acid molecule further comprises a 5'-cap structure and a polycytidylate sequence.

[0239] In one embodiment, the artificial nucleic acid molecule further comprises a 5'-cap structure and a polyadenylate sequence.

[0240] In one embodiment, the artificial nucleic acid molecule further comprises a 5' cap structure, a polycytidylic acid sequence, and a histone stem-loop.

[0241] In one embodiment, the artificial nucleic acid molecule further comprises a 5' cap structure, a polyadenylic acid sequence, and a histone stem-loop.

[0242] In one embodiment, the artificial nucleic acid molecule further comprises a 5' cap structure, a polycytidylic acid sequence, a polyadenylic acid sequence, and a histone stem-loop.

[0243] In a preferred embodiment, the artificial nucleic acid molecule comprises a polyadenylic acid sequence, and the polyadenylic acid sequence comprises the nucleic acid sequence of SEQ ID NO:46.

[0244] The artificial nucleic acid molecule defined herein can be prepared using any method known in the art, including synthetic methods such as solid-phase synthesis, and in vitro methods such as in vitro transcription reactions or in vivo reactions such as in vivo propagation of DNA plasmids in bacteria. The artificial nucleic acid molecule of the present invention can be codon-optimized for the host cell used for expression.

[0245] In a preferred embodiment, the open reading frame (ORF) is codon-optimized.

[0246] In one embodiment, the artificial nucleic acid molecule is RNA.

[0247] In a preferred embodiment, the artificial nucleic acid molecule is mRNA.

[0248] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 or 89.

[0249] In one embodiment, the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 or 62.

[0250] Modified nucleotides

[0251] In some ways, the mRNA includes modified nucleotides, and the modified nucleotides are selected from one or more of the following nucleotides: 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, pseudouridine, N-1-methyl-pseudouridine, 2-thiouridine, and 2-thiocytidine; methylated bases; inserted bases; 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose; thiophosphate groups and 5'-N-phosphoramidite linkages. And it is modified with the modified nucleotides described in PCT / CN2020 / 074825 and PCT / CN2020 / 106696.

[0252] Vectors and host cells

[0253] In yet another aspect, the present invention also provides an expression vector comprising the artificial nucleic acid molecule of the present invention. The expression vector may further comprise additional nucleic acid sequences, such as regulatory sequences and antibiotic resistance genes. The artificial nucleic acid molecule of the present invention may be present in one or more expression vectors.

[0254] In one embodiment, the vector is a DNA vector.

[0255] In one embodiment, the vector is a plasmid vector or a viral vector.

[0256] In a preferred embodiment, the vector is a plasmid vector. For example, the pUC57 plasmid vector.

[0257] In one embodiment, the vector is a circular molecule.

[0258] In one embodiment, the artificial nucleic acid molecule of the present invention is prepared as a recombinant nucleic acid. Recombinant nucleic acids can be prepared using techniques well known in the art, such as chemical synthesis, DNA recombination techniques (such as polymerase chain reaction (PCR) techniques), etc.

[0259] In yet another aspect, the present invention also provides a method for producing the artificial nucleic acid molecule of the present invention, the method comprising:

[0260] a) Synthesizing the artificial nucleic acid molecule of the present invention; or

[0261] b) Synthesizing the artificial nucleic acid molecule through the vector of the present invention.

[0262] In yet another aspect, the present invention also provides a method for increasing the translation efficiency of an artificial nucleic acid molecule, preferably an mRNA molecule or a vector, the method comprising linking an open reading frame to a 3'-UTR element as defined in the present invention.

[0263] The present invention also provides a cell comprising the artificial nucleic acid molecule or vector of the present invention. The artificial nucleic acid molecule or vector of the present invention can be introduced into a suitable cell by various methods known in the art. Such methods include, but are not limited to, liposome transfection, electroporation, viral transduction, and calcium phosphate transfection, etc.

[0264] In a preferred embodiment, the cell is used to express a peptide or protein encoded by the ORF in the artificial nucleic acid molecule of the present invention. Examples of cells include, but are not limited to, prokaryotic cells (such as bacteria, such as Escherichia coli) and eukaryotic cells (such as yeast, insect cells, mammalian cells). Suitable mammalian host cells include, but are not limited to, human cervical cancer cells (HeLa cells), human embryonic kidney cells (HEK cells, such as HEK 293 cells), Chinese hamster ovary (CHO) cells, and other mammalian cells.

[0265] In one embodiment, the cell is a mammalian cell.

[0266] In a preferred embodiment, the cell is a cell isolated from a human subject.

[0267] LIPID COMPOSITION

[0268] In yet another aspect, the present invention also provides a lipid composition. The lipid composition is a lipid delivery carrier, and the lipid can encapsulate the artificial nucleic acid molecule of the present invention to form nanoparticles, thereby delivering them into a living body.

[0269] As used herein, the term "lipid" refers to an organic compound that contains a hydrophobic moiety and optionally also contains a hydrophilic moiety. Lipids are generally insoluble in water but soluble in many organic solvents. Generally, amphiphilic lipids containing a hydrophobic moiety and a hydrophilic moiety can be organized into a lipid bilayer structure in an aqueous environment, such as existing in the form of vesicles. Lipids can include, but are not limited to: fatty acids, glycerides, phospholipids, sphingolipids, glycolipids, steroids, and cholesterol esters, etc.

[0270] As used herein, "lipid nanoparticle" or "LNP" refers to a lipid vesicle having a uniform lipid core, which is a particle formed by lipids, and the lipid components undergo intermolecular interactions to form a nanostructured entity. Nucleic acids (such as mRNA) are encapsulated in the lipid.

[0271] Particularly preferred lipid compositions can be, for example, the lipid polyplexes (LPPs) described herein. Methods for preparing such compositions can be as described herein. LPPs are particles having a core-shell structure, wherein the nucleic acid is contained within the polyplex, and the polyplex itself is encapsulated within a biocompatible lipid bilayer shell to form the lipid nanoparticles of the present invention. In some embodiments, the lipid compositions of the present invention are lipid polyplexes (LPPs). In some embodiments, the lipid compositions of the present invention are lipid polyplexes (LPPs) comprising artificial nucleic acid molecules.

[0272] In some embodiments, the lipids encapsulating the artificial nucleic acid molecules of the present invention are selected from one or more of the following lipids: cationic lipids, phospholipids, steroids, and / or polyethylene glycol-modified lipids. In a preferred embodiment, the cationic lipid is an ionizable cationic lipid.

[0273] The lipid compositions of the present invention comprise the artificial nucleic acid molecules of the present invention and lipids encapsulating the artificial nucleic acid molecules. The lipids encapsulating the artificial nucleic acid molecules comprise cationic lipids, phospholipids, steroids, and polyethylene glycol-modified lipids.

[0274] In one embodiment, the lipid composition comprises a cationic lipid, wherein the cationic lipid comprises DOTMA, DOTAP, DDAB, DOSPA, DODAC, DODAP, DC-Chol, DMRIE, DMOBA, DLinDMA, DLenDMA, CLinDMA, DMORIE, DLDMA, DMDMA, DOGS, N4-cholesteryl-spermine, DLin-KC2-DMA, DLin-MC3-DMA, a compound of formula (I), (II), (III), or (IV) as described herein, or a combination thereof. In a preferred embodiment, the cationic lipid comprises M5, MC3, ALC-0315, SM-102. In a preferred embodiment, the cationic lipid comprises SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2, or SW-II-140-2. In a preferred embodiment, the cationic lipid comprises M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2, or SW-II-140-2.

[0275] In one embodiment, the lipid composition comprises phospholipids and / or steroids. In one embodiment, the lipid composition comprises phospholipids as described herein, wherein the phospholipids comprise 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-doundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0Diether PC), 1-oleoyl-2-cholesteryl succinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), palmitoyl oleoyl phosphatidylethanolamine (POPE), distearoyl-phosphatidylethanolamine (DSPE), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoyl phosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-stearoylethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyl oleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), or a combination thereof. In one embodiment, the lipid composition comprises steroids as described herein, wherein the steroids comprise cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, α-tocopherol, and derivatives thereof.In one embodiment, the lipid composition comprises a phospholipid and a steroid as described herein. In one embodiment, the lipid composition comprises DOPE. In one embodiment, the lipid composition comprises DSPC. In one embodiment, the lipid composition comprises cholesterol. In one embodiment, the lipid composition comprises DOPE and cholesterol. In one embodiment, the lipid composition comprises DSPC and cholesterol.

[0276] In one embodiment, the lipid composition comprises a cationic lipid M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2, the phospholipid DOPE and cholesterol. In one embodiment, the lipid composition comprises a cationic lipid M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2, the phospholipid DSPC and cholesterol.

[0277] In some embodiments, the lipid encapsulating the artificial nucleic acid molecule of the present invention further comprises a polyethylene glycol-modified lipid. In one embodiment, the polyethylene glycol-modified lipid comprises DMG-PEG (e.g., DMG-PEG 2000), DOG-PEG and DSPE-PEG or a combination thereof. In one embodiment, the polyethylene glycol-modified lipid is DSPE-PEG. In one embodiment, the polyethylene glycol-modified lipid is DMG-PEG (e.g., DMG-PEG 2000).

[0278] In one embodiment, the lipid composition comprises a cationic lipid, DOPE, cholesterol and DSPE-PEG.

[0279] In one embodiment, the lipid composition comprises a cationic lipid, DSPC, cholesterol and DSPE-PEG.

[0280] In one embodiment, the lipid composition comprises a cationic lipid, DSPC, cholesterol and DMG-PEG.

[0281] In a preferred embodiment, the lipid composition comprises a cationic lipid, DOPE, cholesterol and DMG-PEG.

[0282] In a preferred embodiment, the lipid composition comprises a cationic lipid M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2, DOPE, cholesterol and DMG-PEG.

[0283] In some embodiments, the lipid composition of the present invention further comprises a cationic polymer, which associates with the artificial nucleic acid molecule to form a complex and is co-encapsulated in the lipid.

[0284] In one embodiment, the cationic polymer comprises poly-L-lysine, protamine, polyethyleneimine (PEI) or a combination thereof. In one embodiment, the cationic polymer is protamine. In one embodiment, the cationic polymer is polyethyleneimine.

[0285] In one embodiment, the amount of lipid in the lipid composition is calculated as a mole percentage (mol%), and the mole percentage is determined based on the total moles of lipid in the composition.

[0286] In one embodiment, the amount of cationic lipid in the lipid composition is about 10 - about 70 mol%. In some embodiments, the amount of cationic lipid in the lipid composition is about 20 - about 60 mol%, about 30 - about 50 mol%, about 35 - about 50 mol%, about 35 - about 45 mol%, about 38 - about 45 mol%, about 40 - about 45 mol%, about 40 - about 50 mol% or about 45 - about 50 mol%.

[0287] In one embodiment, the amount of phospholipid in the lipid composition is about 10 - about 70 mol%. In one embodiment, the amount of phospholipid in the lipid composition is about 20 - about 60 mol%, about 30 - about 50 mol%, about 10 - about 30 mol%, about 10 - about 20 mol% or about 10 - about 15 mol%.

[0288] In one embodiment, the amount of cholesterol in the lipid composition is about 10 - about 70 mol%. In one embodiment, the amount of cholesterol in the lipid composition is about 20 - about 60 mol%, about 24 - 44 mol%, about 30 - about 50 mol%, about 35 - about 40 mol%, about 35 - about 45 mol%, about 40 - about 45 mol% or about 45 - about 50 mol%.

[0289] In one embodiment, the amount of the polyethylene glycol-modified lipid in the lipid composition is about 0.05 to about 20 mol%. In one embodiment, the amount of the polyethylene glycol-modified lipid in the lipid composition is about 0.5 to about 15 mol%, about 1 to about 10 mol%, about 5 to about 15 mol%, about 1 to about 5 mol%, about 1 to about 1.5 mol%, about 1.5 to about 3 mol% or about 2 to 5 mol%.

[0290] In one embodiment, the lipid composition comprises 10 - 70 mol% of a cationic lipid, 10 - 70 mol% of a phospholipid, 10 - 70 mol% of a steroid, and 0.05 - 20 mol% of a polyethylene glycol-modified lipid. In a preferred embodiment, the lipid composition comprises 35 - 50 mol% of a cationic lipid, 10 - 30 mol% of a phospholipid, 24 - 44 mol% of a steroid, and 1 - 1.5 mol% of a polyethylene glycol-modified lipid.

[0291] In one embodiment, the LPP comprises the artificial nucleic acid molecule of the present invention and a lipid encapsulating the artificial nucleic acid molecule, wherein the lipid encapsulating the artificial nucleic acid molecule comprises a cationic lipid, a phospholipid, a steroid, and a polyethylene glycol-modified lipid; the LPP further comprises a cationic polymer, wherein the cationic polymer associates with the artificial nucleic acid molecule to form a complex. In one embodiment, the lipid composition of the present invention, which comprises the artificial nucleic acid molecule of the present invention and a lipid encapsulating the artificial nucleic acid molecule, wherein the lipid encapsulating the artificial nucleic acid molecule comprises a cationic lipid, a phospholipid, a steroid, and a polyethylene glycol-modified lipid; the lipid composition further comprises a cationic polymer, wherein the cationic polymer associates with the artificial nucleic acid molecule to form a complex and is co-encapsulated in the lipid to form a lipid polyplex. In one embodiment, the lipid composition comprises 2.5 - 20 mol% of a polyethylene glycol-modified lipid, based on the total amount of all lipids in the lipid composition. In one embodiment, the phospholipid is selected from 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), distearoyl phosphatidylcholine (DSPC), or a combination thereof. In one embodiment, the steroid is cholesterol. In one embodiment, the cationic polymer is protamine. In one embodiment, the polyethylene glycol-modified lipid is selected from 1,2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol (DMG-PEG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-poly(ethylene glycol) (DSPE-PEG), or a combination thereof. In one embodiment, the cationic lipid is selected from M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2, or SW-II-140-2.

[0292] In one embodiment, the lipids of the encapsulation complex comprise 50 mol% of M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2, 10 mol% of DOPE, 38.5 mol% of cholesterol and 1.5 mol% of DMG-PEG. In one embodiment, the lipids of the encapsulation complex comprise 40 mol% of M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2, 15 mol% of DOPE, 43.5 mol% of cholesterol and 1.5 mol% of DMG-PEG.

[0293] Cationic lipid

[0294] A cationic lipid is a lipid that can carry a net positive charge at a specified pH. Lipids with a net positive charge can associate with nucleic acids through electrostatic interactions.

[0295] Examples of cationic lipids include, but are not limited to, 1,2-di-O-octadecenyl-3-trimethylammonium-propane (DOTMA), 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), didecyldimethylammonium bromide (DDAB), 2,3-dioleoyloxy-N-[2(spermine carboxamide)ethyl]-N,N-dimethyl-l-propanamium trifluoroacetate (DOSPA), dioctadecyldimethyl ammonium chloride (DODAC), 1,2-dioleoyl-3-dimethylammonium-propane (DODAP), 3-(N—(N′,N′-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), 2,3-di(tetradecoxy)propyl-(2-hydroxyethyl)-dimethylazanium (DMRIE), N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 3-dimethylamino-2-(cholest-5-en-3-β-oxybutane-4-oxy)-1-(cis,cis-9,(3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan-4-oxy)-1-(cis,cis-9,12-octadecadienoxy)propane, CLinDMA), N-(2-aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)propan-1-aminium bromide (DMORIE), N,N-dimethyl-2,3-bis(dodecyloxy)propan-1-amine (DLDMA), N,N-dimethyl-2,3-bis(tetradecyloxy)propan-1-amine (DMDMA), dioctadecylamidoglycyl spermine (DOGS), N4-cholesteryl-spermine, 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA), a compound of formula (I), (II), (III) or (IV) as described herein, or a combination thereof.,

[0296] In some embodiments, the cationic lipid is preferably an ionizable cationic lipid. Ionizable cationic lipids carry a net positive charge at, for example, acidic pH and are neutral at higher pH (e.g., physiological pH). Examples of ionizable cationic lipids include, but are not limited to: dioctadecylamidoglycyl spermine (DOGS), N4-cholesteryl-spermine, 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA), compounds of formula (I), (II), (III), or (IV) as described herein, or combinations thereof.

[0297] In one embodiment, the cationic lipid comprises a compound of formula (I) or a pharmaceutically acceptable salt thereof:

[0298]

[0299] Wherein,

[0300] R 1 and R 2 are each independently selected from a bond, C 1 -C 12 alkyl, and C 2 -C 12 alkenyl;

[0301] R 3 and R 4 are each independently selected from C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 6 -C 10 aryl, and 5-10 membered heteroaryl; and R 3 and R 4 are each independently optionally substituted with t R 6 where t is an integer selected from 1-5;

[0302] R 6 are each independently selected from C 1 -C 12Alkyl and C 2 -C 12 alkenyl;

[0303] M 1 and M 2 each independently selected from a bond, H, -O-, -S-, -C(O)-, -OC(O)-, -C(O)O-, -OC(O)O-, -SC(S)-, -C(S)S-, a 3- to 10-membered heterocycle, -NR 7 -, or

[0304] R 5 together with M 1 and M 2 forms a 3- to 10-membered heterocycle together with the attached N atom, and the corresponding R 1 / R 3 or

[0305] either R 2 / R 4 is absent, and the heterocycle is optionally substituted by R 7 ;

[0306] R 5 is selected from a C 3-8 carbocycle, -C 1-12 alkylene-Q, where Q is selected from H, -OR 7 , -SR 7 , -OC(O)R 7 , -C(O)OR 7 , -N(R 7 )C(O)R 7 , -N(R 7 )S(O) 2 R 7 , -N(R 7 )C(S)R 7 , -N(R 7 ) 2 , cyano, C 3-8 carbocycle, a 3- to 10-membered heterocycle, C 6 -C 10 aryl, and the above groups are each optionally substituted by one or more C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, C 6 -C 10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocycle, halogen, hydroxy, oxo(=O);

[0307] m and n are each independently an integer selected from 0 to 12;

[0308] Each of said alkyl, alkenyl and alkylene groups is optionally and independently interrupted by one or more groups selected from: -O-, -S-, -NR 7 -, -C(O)-, -OC(O)-, -C(O)O-, -SC(S)-, -C(S)S-, C 3-8 carbocyclic ring, and each of said alkyl, alkenyl and alkylene groups is optionally substituted by one or more R 7 substituents;

[0309] R 7 are each independently selected from H, C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C 6 -C 10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocycle, halogen, C 3-8 carbocyclic ring, and each of the above groups is optionally substituted by one or more C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, C 6 -C 10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocycle, halogen, hydroxy, oxo (=O).

[0310] In one embodiment, R 1 and R 2 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl, such as C 1 -C 12 alkyl. In yet another embodiment, one of R 1 and R 2 is a bond and the other is independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl, such as C 1 -C 12 alkyl.

[0311] In one embodiment, R 3 and R 4 are each independently selected from C 1-C 12 alkyl, C 2 -C 12 alkenyl, C 6 -C 10 aryl and 5-10-membered heteroaryl. In yet another embodiment, R 3 and R 4 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl.

[0312] R 3 and R 4 may each independently be optionally substituted with t R 6 groups, where t is 1, 2, 3, 4, 5. In one embodiment, R 6 are each independently selected from C 1 -C 12 alkyl.

[0313] In yet another embodiment, at least one of R 3 and R 4 is C 6 -C 10 aryl or 5-10-membered heteroaryl, such as C 6 -C 10 aryl.

[0314] In one embodiment, R 5 is selected from C 3-8 carbocycle, -C 1-12 alkylene-Q. Q may be selected from H, -OR 7 , -SR 7 , -OC(O)R 7 , -C(O)OR 7 , -N(R 7 )C(O)R 7 , -N(R 7 )S(O) 2 R 7 , -N(R 7 )C(S)R 7 , -N(R 7 ) 2 , cyano, C 3-8 carbocycle, 3-10-membered heterocycle, C 6 -C 10 aryl. The above groups, including the groups encompassing the options for Q, may each optionally be substituted with one or more C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C12 alkoxy, C 6 -C 10 is substituted with aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocycle, halogen, hydroxy, oxo(=O).

[0315] In yet another embodiment, R 5 is selected from C 3-8 carbocycle, -C 1-12 alkylene-Q, where Q is selected from H, -OR 7 , -SR 7 , -OC(O)R 7 , -C(O)OR 7 , -N(R 7 )C(O)R 7 , -N(R 7 )S(O) 2 R 7 , -N(R 7 )C(S)R 7 , -N(R 7 ) 2 , cyano, C 3-8 carbocycle, 3- to 10-membered heterocycle, C 6 -C 10 aryl. The above groups, including the groups covering the options for Q, may each optionally be substituted with one or more C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, C 6 -C 10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocycle, halogen, hydroxy, oxo(=O).

[0316] In the compounds of formula (I), R 7 may each independently be selected from H, C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C 6 -C 10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocycle, halogen, C 3-8 carbocycle, preferably selected from H, C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C1 -C 12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C 6 -C 10 aryl and 5-10 membered heteroaryl. The above groups (when appropriate, e.g., H, C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, amino, carbamoyl, sulfonamide, C 6 -C 10 aryl, 5-10 membered heteroaryl, 3-10 membered heterocycle, C 3-8 carbocyclic ring) are each optionally substituted by one or more C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, C 6 -C 10 aryl, 5-10 membered heteroaryl, 3-10 membered heterocycle, halogen, hydroxy, oxo(=O).

[0317] In one embodiment, each of the groups in the above description, e.g., C 3-8 carbocyclic ring, -C 1-12 alkylene-Q, includes -OR 7 , -SR 7 , -OC(O)R 7 , -C(O)OR 7 , -N(R 7 )C(O)R 7 , -N(R 7 )S(O) 2 R 7 , -N(R 7 )C(S)R 7 , -N(R 7 ) 2 , C 3-8 carbocyclic ring, 3-10 membered heterocycle, C 6 -C 10 aryl, C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, amino, carbamoyl, sulfonamide, C 6 -C10 Aryl, 5-10 membered heteroaryl, 3-10 membered heterocycle, halogen, C 3-8 carbocyclic ring, etc. may each optionally be substituted by one or more C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, C 6 -C 10 aryl, 5-10 membered heteroaryl, 3-10 membered heterocycle, halogen, hydroxy, oxo(=O) substitution.

[0318] In one embodiment, the alkyl, alkenyl and alkylene groups (such as those mentioned in R 1 -R 7 ) in the compound of formula (I) may each optionally and independently be interrupted by one or more groups selected from: -O-, -S-, -NR 7 -, -C(O)-, -OC(O)-, -C(O)O-, -SC(S)-, -C(S)S-, C 3-8 carbocyclic ring, and the alkyl, alkenyl and alkylene groups are each optionally substituted by one or more R 7 . That is, in the chain (straight or branched) of the alkyl, alkenyl and alkylene groups, one or more groups selected from: -O-, -S-, -NR 7 -, -C(O)-, -OC(O)-, -C(O)O-, -SC(S)-, -C(S)S-, C 3-8 carbocyclic ring may each optionally be included.

[0319] R 7 are each independently selected from H, C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C 6 -C 10 aryl, 5-10 membered heteroaryl, 3-10 membered heterocycle, halogen, C 3-8 carbocyclic ring; preferably, R 7 are independently selected from H, C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C 6-C 10 Aryl and 5- to 10-membered heteroaryl. The above groups (when appropriate, e.g., H, C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, amino, carbamoyl, sulfonamide, C 6 -C 10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocycle, C 3-8 carbocyclic) are each optionally substituted by one or more C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, C 6 -C 10 aryl, 5- to 10-membered heteroaryl, 3- to 10-membered heterocycle, halogen, hydroxy, oxo (=O).

[0320] In the compounds of formula (I), m and n can each independently be an integer selected from 0-12, for example, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12. When taking 0, it means the corresponding group does not exist.

[0321] In one embodiment, M 1 or M 2 is a bond, the corresponding m or n is not 0, and the carbon chain before M 1 or M 2 is connected to the corresponding R 1 or R 2 .

[0322] In one embodiment, m or n is 0, the corresponding M 1 or M 2 is not a bond, and the N atom is directly connected to M 1 or M 2 .

[0323] In one embodiment, M 1 or M 2 is a bond, the corresponding m or n is 0, and the N atom is directly connected to the corresponding R 1 or R 2 .

[0324] In one embodiment, M 1 and M 2 are each independently selected from -C(O)-, -OC(O)-, -C(O)O- and -OC(O)O-. In yet another embodiment, M1 and M 2 are each independently selected from -NR 7 -, R 7 as described above.

[0325] In another embodiment, R 5 together with M 1 and M 2 forms a 3- to 10-membered heterocycle together with the attached N atom, and the corresponding R 1 / R 3 or R 2 / R 4 is absent, and the heterocycle is optionally substituted with R 7 as described above. 7 as described above.

[0326] In one embodiment, R 5 is selected from -C 1-12 alkylene-Q, where Q is selected from H, -OR 7 , -OC(O)R 7 , -C(O)OR 7 , -N(R 7 )C(O)R 7 , -N(R 7 ) 2 , cyano, R 7 as described above.

[0327] In a preferred embodiment, R 1 and R 2 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl;

[0328] wherein R 3 and R 4 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl; and R 3 and R 4 are each independently optionally substituted with t R 6 groups, where t is an integer selected from 1-5; R 6 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl.

[0329] M 1 and M 2Each independently selected from -OC(O)-, -C(O)O-, -OC(O)O-, -SC(S)- and -C(S)S-;

[0330] R 5 Selected from -C 1 - 12 alkylene-Q, where Q is selected from -OR 7 and -SR 7 , R 7 independently selected from H, C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C 6 -C 10 aryl and 5-10 membered heteroaryl;

[0331] m and n are each independently an integer selected from 1-12.

[0332] In a preferred embodiment, the cationic lipid comprises a lipid compound having the structure shown below or a pharmaceutically acceptable salt thereof:

[0333]

[0334]

[0335] In a preferred embodiment, the cationic lipid comprises M5 or SM-102.

[0336] In a preferred embodiment, the cationic lipid comprises a lipid compound having the structure shown below or a pharmaceutically acceptable salt thereof:

[0337]

[0338]

[0339] In a preferred embodiment, the cationic lipid comprises MC3.

[0340] In a preferred embodiment, the cationic lipid comprises a lipid compound having the structure shown below or a pharmaceutically acceptable salt thereof:

[0341]

[0342] In a preferred embodiment, the cationic lipid comprises ALC-0315.

[0343] In one embodiment, the cationic lipid comprises a compound of formula (I) or a pharmaceutically acceptable salt thereof:

[0344]

[0345] R 1 and R 2 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl;

[0346] R 3 and R 4 are each independently selected from C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 6 -C 10 aryl and 5-10 membered heteroaryl;

[0347] provided that at least one of R 3 and R 4 is C 6 -C 10 aryl or 5-10 membered heteroaryl, and R 3 and R 4 are each independently optionally substituted with t R 6 , where t is an integer selected from 1-5; R 6 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl;

[0348] M 1 and M 2 are each independently selected from -OC(O)-, -C(O)O-, -OC(O)O-, -SC(S)- and -C(S)S-;

[0349] R 5 is selected from -C 1-12 alkylene-Q, where Q is selected from -OR 7 and -SR 7 , and R 7 is independently selected from H, C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C 6 -C 10Aryl and 5- to 10-membered heteroaryl;

[0350] m and n are each independently an integer selected from 1 to 12.

[0351] In one embodiment, R 2 is selected from C 1 -C 12 alkyl. In another embodiment, R 2 is selected from C 1 -C 6 alkyl.

[0352] In one embodiment, one of R 3 and R 4 is C 6 -C 10 aryl or 5- to 10-membered heteroaryl, and the other is C 1 -C 12 alkyl or C 2 -C 12 alkenyl.

[0353] In one specific embodiment, R 3 and R 4 are each independently selected from C 1 -C 12 alkyl and phenyl, provided that at least one of R 3 and R 4 is phenyl. In another embodiment, one of R 3 and R 4 is phenyl and the other is C 1 -C 12 alkyl.

[0354] In yet another embodiment, R 3 and R 4 are each independently substituted with t R 6 groups, where t is an integer selected from 1 to 5; for example, 1, 2, 3, 4, or 5. Preferably, t is an integer from 1 to 3, such as 1, 2, or 3, especially 1 or 2.

[0355] In one embodiment, R 6 are each independently selected from C 1 -C 12 alkyl, such as C 1 -C 10 alkyl.

[0356] In one embodiment, t is 1 and R 6 is substituted on the benzene ring at the meta or para position relative to R 1 or R 2 .

[0357] In another embodiment, t is 2 and R6 at the meta- and para-positions relative to R on the benzene ring 1 or R 2 .

[0358] In one embodiment, R 4 is substituted at the 1-position or the terminal position of R 2 . The 1-position refers to the position of the C atom in R 2 that is directly connected to M 2 . The terminal position refers to the position of the C atom in R 2 that is the farthest from M 2 . In a specific embodiment, R 4 is selected from C 1 -C 12 alkyl, and R 3 is phenyl.

[0359] In one embodiment, R 3 is substituted at the 1-position or the terminal position of R 1 . The 1-position refers to the position of the C atom in R 1 that is directly connected to M 1 . The terminal position refers to the position of the C atom in R 1 that is the farthest from M 1 . In a specific embodiment, R 3 is selected from C 1 -C 12 alkyl, and R 4 is phenyl.

[0360] In one embodiment, M 1 and M 2 are each independently selected from -OC(O)-, -C(O)O-, and -OC(O)O-.

[0361] In one embodiment, R 5 is selected from -C 1-5 alkylene-Q, such as C 1 , C 2 , C 3 , C 4 or C 5 alkylene-Q. In an exemplary embodiment, R 5 is selected from -C 1-3 alkylene-Q, such as C 1 , C 2 or C 3 alkylene-Q.

[0362] In another embodiment, Q is selected from -OH and -SH, particularly -OH.

[0363] In some embodiments, m and n are each independently an integer selected from 2 - 9, such as 2, 3, 4, 5, 6, 7, 8, or 9. Preferably, m and n are each independently an integer selected from 2 - 7, such as 2, 3, 4, 5, 6, or 7, and more preferably, m and n are each independently an integer selected from 5 - 7, such as 5, 6, or 7.

[0364] In certain embodiments, the compound of formula (I) includes the compound shown in formula (II):

[0365]

[0366] or a pharmaceutically acceptable salt thereof, wherein each group is as defined herein.

[0367] In one embodiment,

[0368] R 1 is selected from C 1 -C 6 alkyl;

[0369] R 2 is selected from C 1 -C 10 alkyl;

[0370] R 4 is selected from C 1 -C 10 alkyl;

[0371] M 1 and M 2 are each independently selected from -OC(O)-, -C(O)O-, and -OC(O)O-;

[0372] R 5 is selected from -C 1-5 alkylene - Q, where Q is selected from -OR 7 and -SR 7 and R 7 is independently selected from H, C 1 -C 12 alkyl and C 2 -C 12 alkenyl;

[0373] R 6 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl, particularly C 1 -C 12 alkyl;

[0374] m and n are each independently an integer selected from 2 - 9, such as 2, 3, 4, 5, 6, 7, 8, or 9;

[0375] t is an integer selected from 1 - 3.

[0376] In one embodiment, R 5 is selected from -C 1-3 alkylene - Q, where Q is selected from -OH and -SH, particularly -OH.

[0377] In one embodiment, m and n are each independently an integer selected from 2 - 7, such as 2, 3, 4, 5, 6 or 7.

[0378] In some embodiments, t is 1 or 2.

[0379] In one embodiment, R 4 is substituted at the 1 - position or the terminal position of R 2 . The 1 - position refers to the position of the C atom in R 2 that is directly connected to M 2 . The terminal position refers to the position of the C atom in R 2 that is the farthest from M 2 .

[0380] In one embodiment, t is 1, and R 6 is substituted at the meta - position or para - position relative to R 1 on the benzene ring.

[0381] In another embodiment, t is 2, and R 6 is substituted at the meta - position and para - position relative to R 1 on the benzene ring.

[0382] In certain embodiments, the compound of formula (I) includes the compound shown in formula (III):

[0383]

[0384] or a pharmaceutically acceptable salt thereof, wherein each group is as defined herein.

[0385] In one embodiment,

[0386] R 1 is selected from C 1 -C 6 alkyl;

[0387] R 2 is selected from C 1 -C 10 alkyl;

[0388] R 4 is selected from C 1 -C 10 alkyl;

[0389] R 5 is selected from -C1-3 An alkylene - Q, where Q is selected from -OH and -SH, especially -OH;

[0390] t is 1 or 2;

[0391] R 6 is selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl, especially C 1 -C 12 alkyl;

[0392] m and n are each independently an integer selected from 2 - 7, such as 2, 3, 4, 5, 6, or 7.

[0393] In one embodiment, R 4 is substituted at the 1 - position or the last position of R 2 The 1 - position refers to the position of the C atom in R 2 that is directly connected to the moiety. The last position refers to the position of the C atom in R 2 that is the farthest from the moiety.

[0394] In one embodiment, t is 1, and R 6 is substituted at the meta - position or para - position on the benzene ring relative to R 1 .

[0395] In another embodiment, t is 2, and R 6 is substituted at the meta - position and para - position on the benzene ring relative to R 1 .

[0396] In certain embodiments, the compound of formula (I) includes the compound shown in formula (IV):

[0397]

[0398] or a pharmaceutically acceptable salt thereof, wherein each group is as defined herein.

[0399] In one embodiment,

[0400] R 1 is selected from C 1 -C 6 alkyl;

[0401] R 2 is selected from C 1 -C 10 alkyl;

[0402] R 4 is selected from C 1 -C 10 alkyl;

[0403] t is 1 or 2;

[0404] R 6 each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl, especially C 1 -C 12 alkyl;

[0405] m and n are each independently an integer selected from 2 - 7, such as 2, 3, 4, 5, 6 or 7.

[0406] In one embodiment, R 4 is substituted at the 1 - position or the last position of R 2 The 1 - position refers to the position of the C atom in R 2 that is directly connected to the moiety. The last position refers to the position of the C atom in R 2 that is the farthest from the moiety.

[0407] In one embodiment, t is 1 and R 6 is substituted at the meta - position or para - position relative to R 1 on the benzene ring.

[0408] In another embodiment, t is 2 and R 6 is substituted at the meta - position and para - position relative to R 1 on the benzene ring.

[0409] In a particular embodiment, in the substituents of the lipid compound of the present invention (e.g., R 1 -R 7 ), there is no alkenyl.

[0410] In a preferred embodiment, the cationic lipid comprises a lipid compound having the structure shown below or a pharmaceutically acceptable salt thereof:

[0411]

[0412]

[0413]

[0414] In a preferred embodiment, the cationic lipid comprises the following lipid compounds: SW - II - 115, SW - II - 121, SW - II - 122, SW - II - 134 - 3, SW - II - 138 - 2, SW - II - 139 - 2 or SW - II - 140 - 2.

[0415] In a preferred embodiment, the cationic lipid comprises the following lipid compounds: M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2.

[0416] Phospholipid

[0417] The lipid composition of the present invention contains phospholipids, which can assist the cell penetration of the lipid composition.

[0418] Examples of phospholipids include, but are not limited to: 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-doundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), palmitoyl oleoyl phosphatidylethanolamine (POPE), distearoyl-phosphatidylethanolamine (DSPE), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoyl phosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-stearoylethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyl oleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), or combinations thereof.

[0419] Steroid

[0420] The lipid composition of the present invention contains steroids, which can act as structural components of the lipid composition.

[0421] Examples of steroids include, but are not limited to, for example, cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, α-tocopherol, and derivatives thereof.

[0422] Polyethylene glycol-modified lipid

[0423] As used herein, the term "polyethylene glycol-modified lipid" or "PEG-modified lipid" or "PEG lipid" refers to a molecule comprising a polyethylene glycol moiety and a lipid moiety, which is a lipid modified with polyethylene glycol. PEG lipids may be selected from the non-limiting group consisting of: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide (PEG-CER), PEG-modified dialkylamine, PEG-modified diacylglycerol (PEG-DEG), PEG-modified dialkylglycerol, or combinations thereof. For example, examples of polyethylene glycol-modified lipids include, but are not limited to: 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG), 1,2-dioleoyl-rac-glycerol, methoxypolyethylene glycol (DOGPEG), and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-poly(ethylene glycol) (DSPE-PEG).

[0424] In one embodiment, the polyethylene glycol-modified lipid is DMG-PEG, such as DMG-PEG 2000. In one embodiment, DMG-PEG 2000 has the following structure:

[0425]

[0426] where the average value of n is 44.

[0427] Cationic polymer

[0428] As used herein, the term "cationic polymer" refers to any ionic polymer capable of carrying a net positive charge at a specified pH and thereby electrostatically binding to nucleic acids. Examples of cationic polymers include, but are not limited to: poly-L-lysine, protamine, polyethyleneimine (PEI), or combinations thereof. Polyethyleneimine may be linear or branched polyethyleneimine.

[0429] The term "protamine" refers to a low molecular weight basic protein rich in arginine, which is present in the sperm cells of various animals (especially fish) and binds to DNA in place of histone. In a preferred embodiment, the cationic polymer is protamine (such as protamine sulfate).

[0430] PHARMACEUTICAL COMPOSITION

[0431] The present invention also provides a pharmaceutical composition, which comprises the artificial nucleic acid molecule of the present invention, the vector of the present invention, the cell of the present invention or the lipid composition of the present invention, and a pharmaceutically acceptable carrier.

[0432] Pharmaceutically acceptable carriers may include, but are not limited to: diluents, binders and adhesives, lubricants, disintegrants, preservatives, vehicles, dispersants, glidants, sweeteners, coatings, excipients, preservatives, antioxidants (such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, α-tocopherol, citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, etc.), solubilizers, gelling agents, softeners, solvents (such as water, alcohol, acetic acid and syrup), buffers (such as phosphate buffer, histidine buffer and acetate buffer), surfactants (such as nonionic surfactants, such as polysorbate 80, polysorbate 20, poloxamer or polyethylene glycol), antibacterial agents, antifungal agents, isotonic agents (such as trehalose, sucrose, mannitol, sorbitol, lactose, glucose), absorption delaying agents, chelating agents and emulsifying agents. For a pharmaceutical composition comprising an artificial nucleic acid molecule, a vector, a cell or a lipid composition, suitable carriers may be selected from buffers (such as citrate buffer, acetate buffer, phosphate buffer, histidine buffer, histidine salt buffer), isotonic agents (such as trehalose, sucrose, mannitol, sorbitol, lactose, glucose), nonionic surfactants (such as polysorbate 80, polysorbate 20, poloxamer) or combinations thereof.

[0433] The pharmaceutical compositions provided herein can be in various dosage forms, including but not limited to solid, semi-solid, liquid, powder or lyophilized forms. For a pharmaceutical composition comprising an artificial nucleic acid molecule, a vector, a cell or a lipid composition, the preferred dosage forms can generally be, for example, injection solutions and lyophilized powders.

[0434] The pharmaceutical compositions provided herein can be administered to a subject by any method known in the art, such as by systemic or local administration. Routes of administration include, but are not limited to, parenteral (e.g., intravenous, intraperitoneal, intradermal, intramuscular, subcutaneous or intracavitary), topical (e.g., intratumoral), epidural or mucosal (e.g., intranasal, oral, vaginal, rectal, sublingual or topical). Preferably, the pharmaceutical composition is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (such as by injection or infusion). The administration method can be, for example, injection or infusion.

[0435] TREATMENT

[0436] In yet another aspect, the present invention relates to the use of the artificial nucleic acid molecules, vectors, cells, lipid compositions or pharmaceutical compositions of the present invention in the preparation of vaccines or drugs for gene therapy.

[0437] In yet another aspect, the present invention relates to the use of the artificial nucleic acid molecules, vectors, cells, lipid compositions or pharmaceutical compositions of the present invention in the preparation of drugs for treating or preventing diseases.

[0438] The artificial nucleic acid molecules, vectors, cells, lipid compositions or pharmaceutical compositions of the present invention can be used to treat diseases, disorders or conditions. Specifically, the artificial nucleic acid molecules, vectors, cells, lipid compositions or pharmaceutical compositions of the present invention can be used to treat diseases, disorders or conditions characterized by the loss or abnormal activity of a protein or polypeptide. For example, an artificial nucleic acid molecule, vector, cell, lipid composition or pharmaceutical composition comprising mRNA encoding a missing or abnormal polypeptide can be administered or delivered to a cell. The mRNA can then be translated to produce the polypeptide, thereby reducing or eliminating the problems caused by the absence or abnormal activity of the polypeptide. Since translation can occur rapidly, these methods and artificial nucleic acid molecules, vectors, cells, lipid compositions or pharmaceutical compositions are useful for treating acute diseases, disorders or conditions such as sepsis, stroke and myocardial infarction.

[0439] Diseases, disorders or conditions characterized by malfunctioning or abnormal protein or polypeptide activity that can be treated with the artificial nucleic acid molecules, vectors, cells, lipid compositions or pharmaceutical compositions of the present invention include, but are not limited to, rare diseases, infectious diseases (in the form of vaccines and therapeutic agents), cancers and proliferative diseases, genetic diseases (such as cystic fibrosis), autoimmune diseases, neurodegenerative diseases, cardiovascular and renal vascular diseases, and metabolic diseases. There are a variety of diseases, disorders or conditions that can be characterized by loss of protein activity (or a substantial decrease such that proper protein function does not occur). These proteins may be absent, or they may be substantially non-functional. Specific examples of malfunctioning proteins are missense mutant variants of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which give rise to malfunctioning protein variants of the CFTR protein, thereby causing cystic fibrosis. The present invention provides a method for treating such diseases, disorders or conditions in a subject by administering the artificial nucleic acid molecules, vectors, cells, lipid compositions or pharmaceutical compositions of the present invention, wherein the RNA can be mRNA encoding a polypeptide that antagonizes or otherwise overcomes the abnormal protein activity present in the cells of the subject.

[0440] The artificial nucleic acid molecules, vectors, cells, lipid compositions or pharmaceutical compositions of the present invention can be administered to a subject in any reasonable amount and by any route of administration that is effective for the prevention, treatment, diagnosis of a disease, disorder or condition or for any other purpose. The specific amount administered to a given subject can vary depending on the species, age and general condition of the subject; the purpose of administration; the specific composition; the mode of administration, etc.

[0441] In some embodiments, the artificial nucleic acid molecules, vectors, cells, lipid compositions or pharmaceutical compositions of the present invention can be administered to a subject by any method known to those skilled in the art, such as parenterally, orally, transmucosally, transdermally, intramuscularly, intravenously, intradermally, subcutaneously or intraperitoneally.

[0442] KIT

[0443] The present invention also provides a kit that contains the artificial nucleic acid molecules, vectors, cells, lipid compositions or pharmaceutical compositions of the present invention, and instructions for use. The kit can also contain a suitable container. In certain embodiments, the kit also contains a device for administration. The kit generally includes a label indicating the intended use and / or method of use of the contents of the kit. The term "label" includes any written or recorded material provided on or with the kit or otherwise provided with the kit. Beneficial effects

[0444] The artificial nucleic acid molecule, vector, cell, lipid composition or pharmaceutical composition of the present invention can exhibit excellent effects, such as but not limited to: 1) improving the translation efficiency of the contained mRNA; and / or 2) the contained mRNA having high stability.

[0445] EXAMPLES

[0446] Further understanding of the present invention can be obtained by referring to some specific examples given herein. These examples are only for illustrating the present invention and are not intended to limit the scope of the present invention in any way. Obviously, various modifications and changes can be made to the present invention without departing from the essence of the present invention. Therefore, these modifications and changes are also within the scope of protection required by this application. The ratios used herein include percentages and are by weight unless otherwise specified.

[0447] Experimental materials

[0448] The cationic lipid according to formula (I) is synthesized by Sihuan Bio or prepared with reference to, for example, CN110520409A, WO2018081480A1 or US11,246,933B1; phosphatidylcholine (DOPE) is purchased from CordenPharma; cholesterol is purchased from Sigma-Aldrich; mPEG2000-DMG (i.e., DMG-PEG 2000) is purchased from Avanti Polar Lipids, Inc.; PBS is purchased from Invitrogen; protamine sulfate is purchased from Beijing Siliang Pharmaceutical Co., Ltd.; mPEG2000-DSPE is purchased from lipoid GmbH; DSPC is purchased from Avanti Polar Lipids, Inc.

[0449] Example 1 Synthesis of the compound according to formula (I)

[0450] General considerations

[0451] Unless otherwise indicated, all solvents and reagents used are commercially available and used as received. 1 1H NMR spectra were recorded at 300 K using a Bruker Ultrashield 300 MHz instrument in CDCl 3 3. 1 Chemical shifts are reported in parts per million (ppm) relative to

[0452] The procedures described below can be used to synthesize compounds SW-II-115 to SW-II-140-2.

[0453] The following abbreviations are used herein:

[0454] THF: Tetrahydrofuran

[0455] MeCN: Acetonitrile

[0456] LAH: Lithium aluminum hydride

[0457] DCM: Dichloromethane

[0458] DMAP: 4-Dimethylaminopyridine

[0459] LDA: Lithium diisopropylamide

[0460] rt: Room temperature

[0461] DME: 1,2-Dimethoxyethane

[0462] n-BuLi: n-Butyllithium

[0463] CPME: Cyclopentyl methyl ether

[0464] EDCI: N-(3-Dimethylaminopropyl)-N'-ethylcarbodiimide

[0465] DIEA: N,N-Diisopropylethylamine

[0466] PE: Petroleum ether

[0467] EA: Ethyl acetate

[0468] A. Compound SW-II-115

[0469]

[0470] 1. Synthesis of Intermediate 3

[0471]

[0472] To a solution of Compound 1 (10 g, 45 mmol, 1 eq.) and Compound 2 (7.8 g, 54 mmol, 1.2 eq.) in DCM (100 mL) was added EDCI (17.3 g, 90 mmol, 2 eq.) and DMAP (2.2 g, 18 mmol, 0.4 eq.), and then DIEA (23.2 g, 180 mmol, 4 eq.) was added. The reaction mixture was stirred at room temperature under N 2Stir for 16 h under protection. TLC (petroleum ether: ethyl acetate = 30:1) showed that compound 1 was consumed and the desired product was formed. The reaction mixture was diluted with DCM (20 mL) and washed with H 2 O (40 mL), dried over anhydrous Na 2 SO 4 and filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with petroleum ether: ethyl acetate (1:0 - 20:1), to give compound 3 as a colorless oil (4.365 g, 28%).

[0473] 2. Synthesis of Intermediate 5

[0474]

[0475] A solution of compound 3 (500 mg, 1.437 mmol, 1 eq.) and compound 4 (2.63 g, 43.103 mmol, 30 eq.) in EtOH was stirred at 60 °C for 16 h under N 2 protection. TLC (DCM:MeOH = 10:1) showed that compound 3 was consumed, and TLC (DCM / MeOH = 10 / 1) showed a new major spot observed. The reaction mixture was concentrated under reduced pressure. The residue was diluted with EtOAc (50 mL) and washed with H 2 O (3 × 50 mL). The organic layer was dried over anhydrous Na 2 SO 4 and filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1:0 - 10:1, v / v), to give compound 5 as a yellow oil (264 mg, 56%).

[0476] 3. Synthesis of Intermediate 8

[0477]

[0478] To a mixture of compound 6 (500 mg, 1.712 mmol, 1 eq.) and compound 7 (1.113 g, 8.562 mmol, 5 eq) in dioxane / water (5 mL / 0.5 mL) was added Pd(dppf)Cl 2 (112 mg, 0.171 mmol, 0.1 eq.) and potassium carbonate (709 mg, 5.136 mmol, 3 eq.). The mixture was stirred at 100 °C overnight under N 2 atmosphere. TLC (PE:EA = 15:1) showed that the reaction was complete and a new major spot was observed. The mixture was extracted with EA and washed with water. The organic layer was dried over anhydrous Na 2 SO 4Dry, filter and concentrate in vacuo. The residue was purified by silica gel column chromatography, eluting with PE:EA (1:0 - 10:1) to give the compound 8 (455 mg, 88%) as a colorless oil.

[0479] 4. Synthesis of Intermediate 9

[0480]

[0481] At 0 °C and under N 2 protection, to a solution of compound 8 (455 mg, 1.497 mmol, 1 eq.) in THF (5 mL) was added LiAlH 4 (1.5 mL, 1.497 mmol, 1 M in THF, 1 eq.). The mixture was stirred at room temperature under N 2 for 2 h. TLC (PE:EtOAc = 5:1) showed the reaction was complete and a new major spot was observed. The mixture was quenched with water (1.5 mL) and treated with 2 N HCl to adjust the pH between 6 and 7, extracted with EA and washed with brine. The organic layer was dried over anhydrous Na 2 SO 4 and filtered and concentrated in vacuo to give the crude compound 9 (419 mg, >100%) as a colorless oil, which was used without further purification.

[0482] 5. Synthesis of Intermediate 10

[0483]

[0484] To a solution of compound 1 (339 mg, 1.518 mmol, 1 eq.) and compound 9 (419 mg, 1.518 mmol, 1 eq.) in DCM (4 mL) was added EDCI (583 mg, 3.036 mmol, 2 eq.) and DMAP (74 mg, 0.607 mmol, 0.4 eq.), then DIEA (783 mg, 6.072 mmol, 4 eq.) was added. The reaction mixture was stirred at room temperature under N 2 for 16 h. TLC (petroleum ether:ethyl acetate = 10:1) showed the formation of the desired product. The reaction mixture was extracted with EA and washed with water. The organic layer was dried over anhydrous Na 2 SO 4 and filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with petroleum ether:ethyl acetate (1:0 - 10:1) to give the compound 10 (443 mg, 60.7%) as a colorless oil.

[0485] 6. Synthesis of the Final Product SW-II-115

[0486]

[0487] To a mixed solvent of CPME / CH 3 CN (3 mL / 3 mL) containing Compound 10 (307 mg, 0.64 mmol, 1 eq.) and Compound 5 (210 mg, 0.64 mmol, 1 eq.) was added K 2 CO 3 (530 mg, 3.84 mmol, 6 eq.) and KI (212 mg, 1.28 mmol, 2 eq.). After the addition was complete, the mixture was stirred overnight at 90 °C under N 2 . TLC (DCM:MeOH = 10:1) showed that the reaction was complete and a new major spot was observed. The mixture was extracted with EA and washed with water. The organic layer was dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM:MeOH (1:0 - 10:1, v / v) to give Compound SW-II-115 as a yellow oil (266 mg, 57%).

[0488] LCMS: Rt: 1.293 min; MS m / z (ELSD): 730.5 [M+H] + ;

[0489] HPLC: 99.472% purity, ELSD; RT = 4.895 min.

[0490] 1 H NMR (400 MHz, CDCl 3 ) δ 7.21–6.99 (m, 3H), 5.05 (s, 2H), 4.05 (t, J = 6.8 Hz, 2H), 3.58 (t, J = 5.3 Hz, 2H), 2.69–2.46 (m, 10H), 2.31 (dt, J = 20.0, 7.5 Hz, 4H), 1.69–1.18 (m, 51H), 0.89 (dt, J = 12.4, 6.3 Hz, 9H).

[0491] 13 C NMR (101 MHz, CDCl 3)δ173.90(s),173.68(s),140.80(d,J=13.0Hz),133.31(s),129.25(d,J=16.2Hz),128.30(s),125.75(s),77.30(d,J=11.5Hz),77.04(s),76.72(s),66.22(s),64.43(s),58.12(s),55.72(s),53.90(s),34.32(d,J=1.9Hz),32.69(s),32.48(s),31.81(d,J=11.2Hz),31.25(s),29.59–28.91(m),28.66(s),27.17(s),26.64(s),25.94(s),24.91(d,J=5.1Hz),22.65(d,J=3.3Hz),14.10(s).

[0492] B. Compound SW-II-118

[0493]

[0494] 1. Synthesis of Intermediate 3

[0495]

[0496] Compound 1 (1.22 g, 5.0 mmol, 1.0 eq.) and Compound 2 (765 mg, 7.5 mmol, 1.5 eq.), Pd(PPh 3 ) 4 (tetrakis(triphenylphosphine)palladium, 289 mg, 0.25 mmol, 0.05 eq.) and K 2 CO 3 (1.38 g, 10.0 mmol, 2.0 eq.) in toluene (10 ml) and H 2 O (1 ml) were stirred at 110 °C under N 2 protection for 1 hour. TLC (petroleum ether:ethyl acetate = 19:1) showed that Compound 1 was consumed and a new spot was observed. The reaction mixture was diluted with DCM (50 mL) and washed with H 2 O (40 mL), dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with petroleum ether:ethyl acetate (1:0 - 10:1), to give Compound 3 as a colorless oil (0.5 g, 45%).

[0497] 1 H NMR (400 MHz, CDCl 3)δ7.16(dd, J=23.5, 8.1Hz, 4H), 4.14(q, J=7.1Hz, 2H), 3.57(s, 2H), 2.64–2.48(m, 2H), 1.66–1.51(m, 2H), 1.35(dd, J=15.0, 7.4Hz, 2H), 1.25(t, J=7.1Hz, 3H), 0.92(t, J=7.3Hz, 3H).

[0498] 2. Synthesis of Intermediate 4

[0499]

[0500] At -78 °C, LiAlH 4 (193 mg, 5.09 mmol, 4.0 eq.) was added to a solution of compound 3 (280 mg, 1.27 mmol, 1.0 eq.) in THF (10 mL). Then the reaction was carried out at 10 °C for 3 hours. TLC showed that the reaction was good. The reaction was concentrated and diluted with Na 2 SO 4 (20 mL) and extracted with EA (30 mL x 2). The organic phase was dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure to obtain compound 4 (3.12 g, crude product) as a yellow oil.

[0501] 3. Synthesis of Intermediate 6

[0502]

[0503] A solution of compound 4 (215 mg, 1.2 mmol, 1.0 eq.), compound 5 (404 mg, 1.8 mmol, 1.5 eq.), EDCI (1.15 g, 6.0 mmol, 5.0 eq.), DMAP (732 mg, 1.8 eq.), DIEA (1.29 g, 12.0 mmol, 10.0 eq.) and DIEA (1.29 g, 12.0 mmol, 10.0 eq.) in DCM (5 mL) was stirred at 10 °C for 16 h under N 2 protection. TLC (DCM:MeOH = 10:1) showed that the reaction was complete and a new main spot was observed. The mixture was concentrated under reduced pressure and the residue was purified by silica gel column chromatography, eluting with PE:EA (1:0 - 10:1, v / v) to obtain compound 6 (145 mg, 31%) as a colorless oil.

[0504] 1 1H NMR (400 MHz, CDCl 3)δ7.12(s,4H),4.27(t,J=7.1Hz,2H),3.52(t,J=6.7Hz,1H),3.40(t,J=6.8Hz,1H),2.90(t,J=7.1Hz,2H),2.65–2.50(m,2H),2.28(t,J=7.5Hz,2H),1.93–1.70(m,2H),1.64–1.56(m,4H),1.44–1.27(m,8H),0.92(t,J=7.3Hz,3H).

[0505] 4. Synthesis of the final product SW-II-118

[0506]

[0507] A mixture containing compound 6 (140 mg, 0.37 mmol, 1.0 eq.), compound 7 (243 mg, 0.55 mmol, 1.5 eq.), K 2 CO 3 (153 mg, 1.11 mmol, 3.0 eq.) and KI (123 mg, 0.74 mmol, 2.0 eq.) was stirred at 90 °C for 16 h in a mixed solvent of CPME (1 mL) and CH 3 CN (1 mL) under N 2 . The reaction mixture was concentrated under reduced pressure, and the residue was diluted with EtOAc (50 mL) and washed with NaHCO 3 (30 mL). The organic layer was dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM:MeOH (1:0 - 10:1, v / v) to give SW-II-118 as a yellow oil (105 mg, 61%).

[0508] LCMS: Rt: 1.946 min; MS m / z (ELSD): 744.4 [M+H] + ;

[0509] HPLC: 99.64% purity, ELSD; RT = 5.875 min.

[0510] 1 1H NMR (400 MHz, CDCl 3) δ 7.11 (s, 4H), 4.91–4.79 (m, 1H), 4.26 (t, J = 7.2 Hz, 2H), 3.80–3.68 (m, 2H), 2.90 (t, J = 7.1 Hz, 4H), 2.81–2.67 (m, 4H), 2.62–2.52 (m, 2H), 2.28 (td, J = 7.5, 2.6 Hz, 4H), 1.64–1.51 (m, 11H), 1.38–1.17 (m, 42H), 0.93–0.82 (m, 9H).

[0511] 13 C NMR (101 MHz, CDCl 3 ) δ 173.61 (d, J = 11.7 Hz), 141.11 (s), 134.90 (s), 128.74 (s), 128.51 (s), 77.40 (s), 77.08 (s), 76.77 (s), 74.17 (s), 64.90 (s), 57.48 (s), 56.24 (s), 53.98 (s), 35.25 (s), 34.66 (d, J = 14.4 Hz), 34.16 (d, J = 5.1 Hz), 33.67 (s), 31.86 (s), 29.52 (d, J = 2.4 Hz), 29.24 (s), 29.21–28.74 (m), 26.90 (d, J = 4.9 Hz), 25.42–24.92 (m), 24.92–24.88 (m), 24.74 (s), 22.67 (s), 22.37 (s), 14.04 (d, J = 15.7 Hz).

[0512] C. Compound SW-II-120

[0513]

[0514] 1. Synthesis of Intermediate 3

[0515]

[0516] Containing Compound 1 (1.22 g, 5.0 mmol, 1.0 eq.), Compound 2 (1.30 mg, 10.0 mmol, 2.0 eq.), Pd(PPh 3 ) 4 (289 mg, 0.25 mmol, 0.05 eq.) and K 2 CO 3 (1.38 g, 10.0 mmol, 2.0 eq.) in a mixed solution of toluene (10 ml) and H 2 O (1 ml) at 110 °C, N 2Stir under protection for 1 hour. TLC (petroleum ether: ethyl acetate = 19:1) showed that compound 1 was consumed and a new spot was observed. The reaction mixture was diluted with DCM (50 mL) and washed with H 2 O (40 mL), dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with petroleum ether: ethyl acetate (1:0 - 10:1) to give compound 3 as a colorless oil (0.78 g, 62%).

[0517] 1 H NMR (400 MHz, CDCl 3 ) δ 7.19 (d, J = 8.1 Hz, 2H), 7.13 (d, J = 8.1 Hz, 2H), 4.14 (q, J = 7.1 Hz, 2H), 3.57 (s, 2H), 2.62–2.51 (m, 2H), 1.58 (d, J = 11.1 Hz, 2H), 1.35–1.21 (m, 9H), 0.88 (t, J = 6.7 Hz, 3H).

[0518] 2. Synthesis of Intermediate 4

[0519]

[0520] LiAlH 4 (477 mg, 12.56 mmol, 4.0 eq.) was added to a solution of compound 3 (780 mg, 3.14 mmol, 1.0 eq.) in THF (10 mL) at -78 °C, and then the reaction was stirred at 10 °C for 3 hours. TLC showed that the reaction proceeded well. The reaction was concentrated and diluted with Na 2 SO 4 (20 mL), extracted with EA (30 mL * 2). The organic phase was dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure to give compound 4 as a colorless oil (640 mg, crude).

[0521] 3. Synthesis of Intermediate 6

[0522]

[0523] A solution of compound 4 (640 mg, 3.10 mmol, 1.0 eq.), compound 5 (1.06 g, 4.70 mmol, 1.5 eq.), EDCI (2.98 g, 15.5 mmol, 5.0 eq.), DMAP (1.85 g, 15.0 eq.) and DIEA (4.0 g, 31.0 mmol, 10.0 eq.) in DCM (10 mL) was stirred at 10 °C for 16 h under N 2 protection. TLC (DCM:MeOH = 10:1) showed the reaction was complete and a new major spot was observed. The mixture was concentrated under reduced pressure and the residue was purified by silica gel column chromatography, eluting with PE:EA (1:0 - 10:1, v / v) to give compound 6 as a colorless oil (465 mg, 36%).

[0524] 4. Synthesis of the final product SW-II-120

[0525]

[0526] A mixture of compound 6 (100 mg, 0.25 mmol, 1.0 eq.), compound 7 (161 mg, 0.36 mmol, 1.5 eq.), K 2 CO 3 (104 mg, 0.75 mmol, 3.0 eq.) and KI (83 mg, 0.50 mmol, 2.0 eq.) in CPME (1 mL) and CH 3 CN (1 mL) was stirred at 90 °C for 16 h under N 2 . The reaction mixture was concentrated under reduced pressure and the residue was diluted with EtOAc (50 mL) and washed with NaHCO 3 (30 mL). The organic layer was dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM:MeOH (1:0 - 10:1, v / v) to give SW-II-120 as a yellow oil (100 mg, 52%).

[0527] LCMS: Rt: 2.500 min; MS m / z (ELSD): 772.4 [M + H] + ;

[0528] HPLC: 99.70% purity, ELSD; RT = 8.675 min.

[0529] 1 H NMR (400 MHz, CDCl 3) δ 7.07 (d, J = 8.9 Hz, 4H), 4.89–4.73 (m, 1H), 4.23 (t, J = 7.2 Hz, 2H), 3.83–3.65 (m, 2H), 2.87 (t, J = 7.2 Hz, 4H), 2.82–2.67 (m, 4H), 2.61–2.45 (m, 2H), 2.25 (td, J = 7.5, 2.5 Hz, 4H), 1.65–1.44 (m, 15H), 1.27 (dd, J = 13.2, 11.3 Hz, 42H), 0.85 (t, J = 6.8 Hz, 9H).

[0530] 13 C NMR (101 MHz, CDCl 3 ) δ 173.57 (d, J = 11.5 Hz), 141.13 (s), 134.88 (s), 128.73 (s), 128.48 (s), 77.45 (s), 77.13 (s), 76.81 (s), 74.14 (s), 64.89 (s), 57.34 (s), 56.17 (s), 53.92 (s), 35.57 (s), 34.64 (d, J = 16.1 Hz), 34.14 (d, J = 3.3 Hz), 31.79 (d, J = 13.4 Hz), 31.49 (s), 29.50 (d, J = 2.2 Hz), 29.23 (s), 29.10–28.71 (m), 26.85 (d, J = 5.0 Hz), 25.49–25.38 (m), 25.13 (d, J = 35.4 Hz), 24.72 (s), 22.63 (d, J = 5.8 Hz), 14.11 (s).

[0531] D. Compound SW-II-121

[0532]

[0533] 1. Synthesis of Intermediate 3

[0534]

[0535] To a solution of Compound 1 (1.3 g, 5.86 mmol, 1.5 eq.) and Compound 2 (1 g, 3.9 mmol, 1.0 eq.) in DCM (20 mL) was added EDCI (1.495 g, 7.8 mmol, 2.0 eq.), DMAP (0.19 g, 1.56 mmol, 0.4 eq.) and DIEA (2.57 mL, 15.6 mmol, 4.0 eq.). The reaction mixture was stirred at room temperature under N 2Stir for 16 h. TLC (petroleum ether: ethyl acetate = 19:1) showed that compound 2 was consumed and the desired product was formed. The reaction mixture was diluted with DCM (20 mL) and washed with H 2 O (40 mL), dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with petroleum ether: ethyl acetate (1:0 - 10:1), to give compound 3 as a yellow oil (1.2 g, 66.9%).

[0536] 1 H NMR (400 MHz, CDCl 3 ) δ 4.92–4.82 (m, 1H), 3.42 (t, J = 6.8 Hz, 2H), 2.31 (t, J = 7.5 Hz, 2H), 1.95–1.82 (m, 2H), 1.70–1.19 (m, 36H), 0.90 (t, J = 6.8 Hz, 6H).

[0537] 2. Synthesis of Intermediate 5

[0538]

[0539] A solution of compound 3 (5.2 g, 11.30 mmol, 1.0 eq.) and compound 4 (20.6 g, 339 mmol, 30 eq.) in EtOH (5 mL) was stirred at 60 °C for 16 h under N 2 protection. TLC (petroleum ether: ethyl acetate = 19:1) showed that compound 3 was consumed and TLC (DCM / MeOH = 10 / 1) showed a new major spot was observed. The reaction mixture was concentrated under reduced pressure, the residue was diluted with EtOAc (50 mL) and washed with H 2 O (3 × 50 mL). The organic layer was dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM:MeOH (1:0 - 10:1, v / v), to give compound 5 as a yellow oil (3 g, 60%).

[0540] 3. Synthesis of Intermediate 8

[0541]

[0542] To a mixed solution of toluene / water (10 mL / 1 mL) containing compound 6 (1 g, 4.115 mmol, 1 eq.) and compound 7 (889 mg, 6.173 mmol, 1.5 eq) was added Pd(pph 3 ) 4(238 mg, 0.206 mmol, 0.05 eq.), K 2 CO 3 (1.7 g, 12.35 mmol, 3 eq). The mixture was stirred at 110 °C under N 2 for 2 h. TLC (PE:EA = 10:1) showed the reaction was complete and a new main spot was observed. The mixture was extracted with EA and washed with water. The organic layer was dried over anhydrous Na 2 SO 4 , filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with PE:EA (1:0 - 10:1), to give the compound 8 as a colorless oil (714 mg, 66%).

[0543] 4. Synthesis of Intermediate 9

[0544]

[0545] N 2 Under protection, to the mixture in a solution of compound 8 (714 mg, 2.725 mmol, 1 eq.) in THF (7 mL) at 0 °C was added LiAlH 4 (2.7 mL, 2.725 mmol, 1 M in THF, 1 eq.). The mixture was stirred at room temperature for 2 h. TLC (PE:EtOAc = 10:1) showed the reaction was complete and a new main spot was observed. The mixture was quenched with water (2.7 mL) and treated with 2 N HCl to adjust the pH between 6 and 7, extracted with EA and washed with brine. The organic layer was dried over anhydrous Na 2 SO 4 , filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with PE:EA (1:0 - 10:1), to give the compound 9 as a colorless oil (103 mg, 63%).

[0546] 5. Synthesis of Intermediate 11

[0547]

[0548] To a solution of compound 9 (300 mg, 1.364 mmol, 1 eq.) and compound 10 (363 mg, 1.64 mmol, 1.2 eq.) in DCM (3 mL) were added EDCI (524 mg, 2.728 mmol, 2 eq.), DMAP (67 mg, 0.546 mmol, 0.4 eq.), and DIEA (704 mg, 5.456 mmol, 4 eq.). The reaction mixture was stirred at room temperature under N 2Stir for 16 h. TLC (petroleum ether: ethyl acetate = 10:1) showed the formation of the desired product. The reaction mixture was extracted with EA and washed with water. The organic layer was dried over anhydrous Na 2 SO 4 , filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with petroleum ether: ethyl acetate (1:0 - 10:1) to give the compound 11 as a colorless oil (169 mg, 29%).

[0549] 6. Synthesis of the final product SW-II-121

[0550]

[0551] To a solution of compound 11 (169 mg, 0.399 mmol, 1 eq.) and compound 5 (176 mg, 0.399 mmol, 1 eq.) in CPME / CH 3 CN (2 mL / 2 mL) was added K 2 CO 3 (330 mg, 2.394 mmol, 6 eq.) and KI (132 mg, 0.798 mmol, 2 eq.). After the addition was complete, the mixture was stirred at 90 °C under N 2 overnight. TLC (DCM: MeOH = 10:1) showed the reaction was complete and a new major spot was observed. The mixture was extracted with EA and washed with water. The organic layer was dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM: MeOH (1:0 - 10:1, v / v) to give the compound SW-II-121 as a yellow oil (145 mg, 46%).

[0552] LCMS: Rt: 1.493 min; MS m / z (ELSD): 786.5 [M + H] + ;

[0553] HPLC: 99.869% purity, ELSD; RT = 10.655 min.

[0554] 1 H NMR (400 MHz, CDCl 3) δ 7.11 (s, 4H), 4.92–4.80 (m, 1H), 4.26 (t, J = 7.2 Hz, 2H), 3.80 (s, 2H), 2.87 (dd, J = 26.6, 19.4 Hz, 7H), 2.62–2.51 (m, 2H), 2.28 (td, J = 7.2, 3.6 Hz, 4H), 1.75–1.45 (m, 14H), 1.42–1.09 (m, 45H), 0.88 (t, J = 6.8 Hz, 9H).

[0555] 13 C NMR (101 MHz, CDCl 3 ) δ 173.61 (d, J = 12.3 Hz), 141.20 (s), 134.90 (s), 128.75 (s), 128.51 (s), 77.35 (s), 77.03 (s), 76.72 (s), 74.21 (s), 64.93 (s), 54.15 (s), 35.59 (s), 34.66 (d, J = 16.6 Hz), 34.16 (d, J = 3.0 Hz), 31.85 (d, J = 4.4 Hz), 31.55 (s), 29.64–29.15 (m), 29.15–28.78 (m), 26.85 (d, J = 4.5 Hz), 25.33 (s), 24.95 (s), 24.72 (s), 22.68 (s), 14.12 (s).

[0556] E. Compound SW-II-122

[0557]

[0558] 1. Synthesis of Compound 3

[0559]

[0560] Compound 1 (1 g, 4.65 mmol, 1 eq.) and Compound 2 (726 mg, 5.58 mmol, 1.2 eq.) were dissolved in toluene / water (10 / 1, 20 mL), and then K 2 CO 3 (1.92 g, 13.9 mmol, 3 eq.) and Pd(pph 3 ) 4 (269 mg, 0.23 mmol, 0.05 eq) were added to the mixture. The reaction mixture was heated to 110 °C and stirred for 2 h in N 2 . TLC (petroleum ether / ethyl acetate = 19 / 1) showed that Compound 1 was consumed and a new major spot was observed. The reaction mixture was washed with H 2It was quenched with O (80 mL) and extracted with ethyl acetate (60 mL×3). The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with petroleum ether / ethyl acetate (1 / 0 - 10 / 1) to obtain the yellow oily compound 3 (800 mg, 78%).

[0561] 2. Synthesis of Compound 4

[0562]

[0563] Under nitrogen protection at 0 °C, LiAlH 4 (3.2 mL, 3.18 mmol, 1 eq) was added to compound 3 (700 mg, 3.18 mmol, 1.0 eq.) dissolved in THF (14 mL). The reaction mixture was stirred at room temperature under nitrogen protection for 2 h. TLC (PE / EtOAc = 10 / 1) showed that the reaction was complete and a new major spot was observed. The mixture was quenched with water (3.2 mL) and 1 M HCl (3.2 mL) respectively. Then water (6 mL) was added to the mixture, and it was extracted with ethyl acetate (60 mL×3). The organic layer was washed with brine (30 mL×2), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate / petroleum ether = 1 / 10 to obtain the yellow oily compound 4 (600 mg, 98%).

[0564] 3. Synthesis of Compound 6

[0565]

[0566] Compound 4 (680 mg, 3.5 mmol, 1.0 eq.) and compound 5 (1.13 g, 5.1 mmol, 1.5 eq.) were dissolved in DCM (10 mL). EDCI (1.20 g, 6.25 mmol, 2.0 eq.), DMAP (166 mg, 1.36 mmol, 0.4 eq.) and DIEA (1.78 g, 13.8 mmol, 4.0 eq.) were added to the mixture. After the addition, the reaction mixture was stirred at room temperature under nitrogen protection overnight. TLC (DCM / MeOH = 30 / 1) showed that the starting materials were consumed and a new spot was formed. The mixture was quenched with water (70 mL) and extracted with DCM (80 mL×3). The combined organic layers were washed with brine (2×20 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate / petroleum ether = 3 / 97 solution to obtain the yellow oily compound 6 (680 mg, 48.5%).

[0567] 4. Synthesis of SW-II-122

[0568]

[0569] Compound 6 (108 mg, 0.27 mmol, 1.2 eq) and compound 7 (100 mg, 0.23 mmol, 1 eq.) were dissolved in CPME (2 mL) and CH 3 CN (2 mL). Potassium carbonate (157 mg, 1.14 mmol, 5.0 eq) and potassium iodide (75 mg, 0.45 mmol, 2.0 eq) were added to the mixture. After the addition, the reaction mixture was stirred at 90 °C for 16 h under nitrogen protection. TLC (DCM / MeOH = 10 / 1) showed the completion of the reaction. The reaction mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with DCM / MeOH (1 / 0 - 10:1, v / v), to give SW-II-122 (68 mg, 40%) as a colorless oil.

[0570] LCMS: Rt: 1.487 min; MS m / z (ELSD): 758.5 [M+H] + ;

[0571] HPLC: 97.3% purity, ELSD; RT = 7.622 min.

[0572] 1 H NMR (400 MHz, CDCl 3 ) δ 7.32 (d, J = 26.4 Hz, 1H), 7.17 (dd, J = 27.2, 21.1 Hz, 3H), 5.09 (s, 2H), 4.91–4.79 (m, 1H), 3.85 (s, 2H), 2.98 (s, 2H), 2.87 (s, 4H), 2.65–2.54 (m, 2H), 2.35 (t, J = 7.6 Hz, 2H), 2.28 (t, J = 7.6 Hz, 2H), 1.74–1.57 (m, 9H), 1.50 (d, J = 5.6 Hz, 4H), 1.37–1.15 (m, 43H), 0.94–0.80 (m, 9H).

[0573] 13 C NMR (101 MHz, CDCl 3)δ173.55(d,J=2.4Hz),143.35(s),135.92(s),128.67–128.19(m),125.47(s),77.36(s),77.04(s),76.73(s),74.22(s),66.27(s),57.15(s),56.74(s),54.14(s),35.88(s),34.55(s),34.15(d,J=3.6Hz),31.79(d,J=15.2Hz),31.43(s),29.52(d,J=2.8Hz),29.25(s),28.92(dd,J=14.2,5.8Hz),26.77(d,J=4.8Hz),25.33(s),24.92(s),24.71(s),24.48(s),22.64(d,J=6.8Hz),14.12(s).

[0574] F. Compound SW-II-127

[0575]

[0576] 1. Synthesis of Compound 3

[0577]

[0578] Compound 1 (1.3 g, 5.86 mmol, 1.5 eq.) and Compound 2 (1 g, 3.9 mmol, 1.0 eq.) were dissolved in DCM (20 mL). To this mixture, EDCI (1.495 g, 7.8 mmol, 2.0 eq.) and DMAP (0.19 g, 1.56 mmol, 0.4 eq.) were added, and then DIEA (2.57 mL, 15.6 mmol, 4.0 eq.) was added. The reaction mixture was stirred at room temperature for 16 h under nitrogen protection. TLC (petroleum ether / ethyl acetate = 19 / 1) showed that Compound 2 was consumed and the desired product was formed. The reaction mixture was diluted with DCM (20 mL) and washed with H 2 O (40 mL), dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (1 / 0 - 10 / 1) to give Compound 3 as a yellow oil (1.2 g, 66.9%).

[0579] 1 H NMR (400 MHz, CDCl 3)δ 4.92–4.82 (m, 1H), 3.42 (t, J = 6.8 Hz, 2H), 2.31 (t, J = 7.5 Hz, 2H), 1.95–1.82 (m, 2H), 1.70–1.19 (m, 36H), 0.90 (t, J = 6.8 Hz, 6H).

[0580] 2. Synthesis of Compound 5

[0581]

[0582] Compound 3 (5.2 g, 11.30 mmol, 1.0 eq.) and compound 4 (20.6 g, 339 mmol, 30 eq.) were added to EtOH (5 mL), and then the mixture was stirred at 60 °C for 16 h under nitrogen protection. TLC (petroleum ether / ethyl acetate = 19 / 1) showed that compound 3 was consumed and TLC (DCM / MeOH = 10 / 1) showed the observation of a new major spot. The reaction mixture was concentrated under reduced pressure. The residue was diluted with EtOAc (50 mL) and washed with H 2 O (3 X 50 mL). The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1 / 0 - 10:1, v / v) to give compound 5 as a yellow oil (3 g, 60%).

[0583] 1 1H NMR (400 MHz, CDCl 3 )δ 4.95–4.75 (m, 1H), 3.74–3.58 (m, 2H), 2.87–2.74 (m, 2H), 2.69–2.56 (m, 2H), 2.36 (s, 2H), 2.28 (t, J = 7.5 Hz, 2H), 1.65–1.42 (m, 8H), 1.38–1.17 (m, 30H), 0.88 (t, J = 6.8 Hz, 6H).

[0584] 3. Synthesis of Compound 8

[0585]

[0586] Compound 7 (522 mg, 2.5 mmol, 1.2 eq.) and compound 6 (400 mg, 2.083 mmol, 1 eq.) were dissolved in DCM (4 mL). To this mixture was added EDCI (800 mg, 4.166 mmol, 2 eq.), DMAP (102 mg, 0.833 mmol, 0.4 eq.) and DIEA (1.075 mg, 8.332 mmol, 4 eq.). After the addition, the reaction mixture was stirred overnight at room temperature under nitrogen protection. TLC (PE:EA = 10:1) showed that the starting materials were consumed and a new spot was formed. The reaction mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 10 / 1), to give compound 8 (454 mg, 57%) as a colorless oil.

[0587] 4. Synthesis of SW-II-127

[0588]

[0589] Compound 8 (100 mg, 0.262 mmol, 1 eq.) and compound 5 (139 mg, 0.314 mmol, 1.2 eq.) were dissolved in CPME / CH3CN (1 mL / 1 mL). To this mixture was added potassium carbonate (217 mg, 1.572 mmol, 6 eq.) and potassium iodide (87 mg, 0.524 mmol, 2 eq.). After the addition, the reaction mixture was stirred overnight at 90 °C under nitrogen protection. TLC (DCM / MeOH = 10 / 1) showed that the reaction was complete and the desired product was formed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1 / 0 - 10:1, v / v), to give compound SW-II-127 (42.49 mg, 22%) as a yellow oil.

[0590] LCMS: Rt: 1.323 min; MS m / z (ELSD): 744.5 [M+H] + ;

[0591] HPLC: 99.742% purity, ELSD; RT = 7.339 min.

[0592] 1 1H NMR (400 MHz, CDCl 3)δ 7.25 (s, 2H), 7.17 (d, J = 8.0 Hz, 2H), 5.07 (s, 2H), 4.91–4.82 (m, 1H), 3.83 (s, 2H), 2.90 (d, J = 44.8 Hz, 5H), 2.64–2.55 (m, 2H), 2.35 (t, J = 7.4 Hz, 2H), 2.28 (t, J = 7.5 Hz, 2H), 1.76–1.46 (m, 14H), 1.42–1.19 (m, 41H), 0.88 (t, J = 6.8 Hz, 9H).

[0593] 13 C NMR (101 MHz, CDCl 3 )δ 173.50 (d, J = 8.5 Hz), 133.17 (s), 128.61 (s), 128.34 (s), 77.29 (d, J = 11.4 Hz), 77.03 (s), 76.71 (s), 74.23 (s), 66.19 (s), 54.20 (s), 35.71 (s), 34.56 (s), 34.10 (d, J = 8.8 Hz), 31.80 (d, J = 15.4 Hz), 31.43 (s), 29.53 (d, J = 2.5 Hz), 29.25 (s), 28.95 (d, J = 10.5 Hz), 28.63 (s), 26.71 (d, J = 18.2 Hz), 25.33 (s), 24.93 (s), 24.62 (s), 22.65 (d, J = 6.6 Hz), 14.13 (s).

[0594] G. Compound SW-II-134-1

[0595]

[0596] 1. Synthesis of Compound 3

[0597]

[0598] To a mixture of Compound 1 (500 mg, 2.283 mmol, 1 eq.) and Compound 2 (890 mg, 6.849 mmol, 3 eq.) in toluene / water (5 mL / 1 mL) was added palladium acetate (51 mg, 0.228 mmol, 0.1 eq.), Ruphos (213 mg, 0.457 mmol, 0.2 eq.), and potassium carbonate (945 mg, 6.849 mmol, 3 eq.). The mixture was stirred overnight at 110 °C under nitrogen. TLC (PE / EA = 20 / 1) showed the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 20 / 1), to give Compound 3 as a colorless oil (723 mg, 99.6%).

[0599] 2. Synthesis of Compound 4

[0600]

[0601] At 0 °C under a nitrogen atmosphere, lithium aluminum hydride (2.3 mL, 2.27 mmol, 1 M in THF, 1 eq.) was added to a mixture of Compound 3 (723 mg, 2.27 mmol, 1 eq.) in THF (8 mL). The mixture was stirred at room temperature for 3 hours. TLC (PE / EA = 5 / 1) indicated the reaction was complete and a new major spot was observed. The mixture was quenched with water (2.3 mL) and treated with 2 N hydrochloric acid to adjust the pH between 6 and 7, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo to give Compound 4 as a colorless oil (381 mg, 58%) without further purification.

[0602] 3. Synthesis of Compound 6

[0603]

[0604] To a mixture of Compound 4 (381 mg, 1.3 mmol, 1 eq.) and Compound 5 (352 mg, 1.6 mmol, 1.2 eq.) in DCM (4 mL) were added EDCI (499 mg, 2.6 mmol, 2 eq.) and DMAP (63 mg, 0.52 mmol, 0.4 eq.), and then DIEA (671 mg, 5.2 mmol, 4 eq.) was added. The reaction mixture was stirred under nitrogen at room temperature for 16 h. TLC (petroleum ether / ethyl acetate = 20 / 1) showed the formation of the desired product. The reaction mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (1 / 0 - 20 / 1), to give Compound 6 as a colorless oil (272 mg, 44%).

[0605] 4. Synthesis of SW-II-134-1

[0606]

[0607] To a mixture of Compound 6 (150 mg, 0.303 mmol, 1 eq.) and Compound 7 (110 mg, 0.333 mmol, 1.1 eq.) in CPME / CH 3 CN (2 mL / 2 mL) were added potassium carbonate (251 mg, 1.818 mmol, 6 eq.) and potassium iodide (101 mg, 0.61 mmol, 2 eq.). After addition, the mixture was stirred under nitrogen at 90 °C overnight. TLC (DCM / MeOH = 15 / 1) showed the completion of the reaction and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1 / 0 - 10:1, v / v), to give SW-II-134-1 as a yellow oil (168 mg, 75%).

[0608] LCMS: Rt: 1.276 min; MS m / z (ELSD): 744.4 [M + H] + ;

[0609] HPLC: 98.481% purity, ELSD; RT = 10.724 min.

[0610] 1 1H NMR (400 MHz, CDCl 3) δ 7.06 (d, J = 7.6 Hz, 1H), 7.01–6.93 (m, 2H), 4.25 (t, J = 7.3 Hz, 2H), 4.05 (t, J = 6.8 Hz, 2H), 3.85–3.72 (m, 2H), 2.98–2.69 (m, 8H), 2.62–2.48 (m, 4H), 2.29 (t, J = 7.5 Hz, 4H), 1.72–1.48 (m, 14H), 1.45–1.17 (m, 36H), 0.89 (dt, J = 11.9, 6.0 Hz, 9H).

[0611] 13 C NMR (101 MHz, CDCl 3 ) δ 173.78 (d, J = 16.7 Hz), 140.72 (s), 138.81 (s), 134.91 (s), 129.70 (s), 129.22 (s), 126.19 (s), 77.30 (d, J = 11.4 Hz), 77.03 (s), 76.72 (s), 65.02 (s), 64.49 (s), 57.42 (s), 56.36 (s), 54.08 (s), 34.76 (s), 34.22 (d, J = 4.2 Hz), 32.74 (s), 32.36 (s), 31.81 (d, J = 9.1 Hz), 31.35 (d, J = 5.3 Hz), 29.49 (d, J = 2.8 Hz), 29.24 (d, J = 2.2 Hz), 28.92 (s), 28.66 (s), 26.86 (s), 25.93 (s), 25.04 (s), 24.78 (d, J = 6.6 Hz), 22.65 (d, J = 2.6 Hz), 14.10 (s).

[0612] H. Compound SW-II-134-2

[0613]

[0614] 1. Synthesis of Compound 3

[0615]

[0616] To a mixture of Compound 1 (500 mg, 2.283 mmol, 1 eq.) and Compound 2 (1.08 g, 6.849 mmol, 3 eq.) in toluene / water (5 mL / 1 mL) was added palladium acetate (51 mg, 0.228 mmol, 0.1 eq.), Ruphos (213 mg, 0.457 mmol, 0.2 eq.), and potassium carbonate (945 mg, 6.849 mmol, 3 eq.). The mixture was stirred overnight at 110 °C under nitrogen. TLC (PE / EA = 20 / 1) showed the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 20 / 1), to give Compound 3 as a colorless oil (854 mg, 100%).

[0617] 2. Synthesis of Compound 4

[0618]

[0619] Under 0 °C and nitrogen atmosphere, to a mixture of Compound 3 (854 mg, 2.28 mmol, 1 eq.) in THF (9 mL) was added lithium aluminum hydride (2.3 mL, 2.28 mmol, 1 M in THF, 1 eq.). The mixture was stirred at room temperature for 3 h. TLC (PE / EA = 5 / 1) indicated the reaction was complete and a new major spot was observed. The mixture was quenched with water (2.3 mL) and treated with 2 N hydrochloric acid to adjust the pH between 6 and 7, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo to give Compound 4 as a colorless oil (724 mg, 92%) without further purification.

[0620] 3. Synthesis of Compound 6

[0621]

[0622] To a mixture of Compound 4 (724 mg, 2.09 mmol, 1 eq.) and Compound 5 (560 mg, 2.51 mmol, 1.2 eq.) in DCM (8 mL) was added EDCI (803 mg, 4.18 mmol, 2 eq.) and DMAP (102 mg, 0.84 mmol, 0.4 eq.), followed by the addition of DIEA (1.078 g, 8.36 mmol, 4 eq.). The reaction mixture was stirred under nitrogen at room temperature for 16 h. TLC (petroleum ether / ethyl acetate = 20 / 1) showed the formation of the desired product. The reaction mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (1 / 0 - 20 / 1) to afford Compound 6 as a colorless oil (473 mg, 41%).

[0623] 4. Synthesis of SW-II-134-2

[0624]

[0625] To a mixture of Compound 6 (150 mg, 0.27 mmol, 1 eq.) and Compound 7 (108 mg, 0.33 mmol, 1.1 eq.) in CPME / CH 3 CN (2 mL / 2 mL) was added potassium carbonate (225 mg, 1.63 mmol, 6 eq.) and potassium iodide (90 mg, 0.54 mmol, 2 eq.). After addition, the mixture was stirred under nitrogen at 90 °C overnight. TLC (DCM / MeOH = 15 / 1) showed completion of the reaction and the observation of a new major spot. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1 / 0 - 10:1, v / v) to afford SW-II-134-2 as a yellow oil (71.77 mg, 33%).

[0626] LCMS: Rt: 1.527 min; MS m / z (ELSD): 800.4 [M+H] + ;

[0627] HPLC: 97.311% purity, ELSD; RT = 9.025 min.

[0628] 1 H NMR (400 MHz, CDCl 3)δ7.06(d, J = 7.6 Hz, 1H), 6.96(d, J = 9.6 Hz, 2H), 4.25(t, J = 7.3 Hz, 2H), 4.05(t, J = 6.8 Hz, 2H), 3.80–3.66(m, 2H), 2.86(dd, J = 12.8, 5.6 Hz, 4H), 2.78–2.67(m, 4H), 2.60–2.52(m, 4H), 2.29(t, J = 7.5 Hz, 4H), 1.57(dt, J = 15.8, 7.3 Hz, 14H), 1.30(d, J = 20.3 Hz, 45H), 0.88(t, J = 6.7 Hz, 9H).

[0629] 13 C NMR(101MHz, CDCl 3 )δ173.82(d, J = 16.9 Hz), 140.73(s), 138.82(s), 134.91(s), 129.71(s), 129.23(s), 126.19(s), 77.36(s), 77.14(d, J = 20.4 Hz), 76.72(s), 65.03(s), 64.49(s), 57.57(s), 56.13(s), 54.02(s), 34.76(s), 34.25(d, J = 4.2 Hz), 32.76(s), 32.37(s), 31.89(d, J = 5.3 Hz), 31.40(d, J = 6.0 Hz), 29.84(d, J = 3.7 Hz), 29.63–29.14(m), 28.97(s), 28.65(s), 26.93(s), 25.66(d, J = 54.4 Hz), 24.80(d, J = 6.6 Hz), 22.68(d, J = 1.8 Hz), 14.12(s).

[0630] I. Compound SW-II-134-3

[0631]

[0632] 1. Synthesis of Compound 3

[0633]

[0634] To a mixture of Compound 1 (10 g, 45 mmol, 1 eq.) and Compound 2 (7.8 g, 54 mmol, 1.2 eq.) in DCM (100 mL) was added EDCI (17.3 g, 90 mmol, 2 eq.) and DMAP (2.2 g, 18 mmol, 0.4 eq.), and then DIEA (23.2 g, 180 mmol, 4 eq.) was added. The reaction mixture was stirred under nitrogen at room temperature for 16 h. TLC (petroleum ether / ethyl acetate = 30 / 1) showed that Compound 1 was consumed and the desired product was formed. The reaction mixture was extracted with ethyl acetate (20 mL) and washed with water (40 mL × 3), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (1 / 0 - 20 / 1), to give Compound 3 as a colorless oil (4.365 g, 28%).

[0635] 2. Synthesis of Compound 5

[0636]

[0637] A mixture of Compound 3 (5 g, 14.38 mmol, 1 eq.) and Compound 4 (8.8 g, 143.7 mmol, 10 eq.) in ethanol (2 mL) was stirred under nitrogen at 55 °C for 16 h. TLC (DCM / MeOH = 10 / 1) showed the observation of a new major spot. The reaction mixture was extracted with ethyl acetate (50 mL) and washed with water (3 × 50 mL). The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1 / 0 - 10:1, v / v), to give Compound 5 as a yellow oil (1.008 g, 21%).

[0638] 3. Synthesis of Compound 8

[0639]

[0640] To a mixture of compound 6 (500 mg, 2.283 mmol, 1 eq.) and compound 7 (699 mg, 6.849 mmol, 3 eq) in toluene / water (5 mL / 1 mL) was added palladium acetate (51 mg, 0.228 mmol, 0.1 eq.), Ruphos (213 mg, 0.457 mmol, 0.2 eq.) and potassium carbonate (945 mg, 6.849 mmol, 3 eq). The mixture was stirred overnight at 110 °C under nitrogen. TLC (PE / EA = 20 / 1) showed the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 20 / 1) to give compound 8 as a colorless oil (507 mg, 85%).

[0641] 4. Synthesis of compound 9

[0642]

[0643] Under 0 °C and nitrogen atmosphere, to a mixture of compound 8 (507 mg, 1.935 mmol, 1 eq.) in THF (5 mL) was added lithium aluminum hydride (2 mL, 1.935 mmol, 1 M in THF, 1 eq.). The mixture was stirred at room temperature for 3 h. TLC (PE / EA = 5 / 1) indicated the reaction was complete and a new major spot was observed. The mixture was quenched with water (2 mL) and treated with 2 N hydrochloric acid to adjust the pH between 6 and 7, extracted with ethyl acetate and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to give compound 9 as a colorless oil (492 mg, >100%) without further purification.

[0644] 5. Synthesis of compound 10

[0645]

[0646] To a mixture of compound 9 (492 mg, 2.103 mmol, 1 eq.) and compound 1 (563 mg, 2.523 mmol, 1.2 eq.) in DCM (5 mL) were added EDCI (808 mg, 4.206 mmol, 2 eq.) and DMAP (103 mg, 0.84 mmol, 0.4 eq.), and then DIEA (1.085 g, 8.412 mmol, 4 eq.) was added. The reaction mixture was stirred under nitrogen at room temperature for 16 h. TLC (petroleum ether / ethyl acetate = 15 / 1) showed the formation of the desired product. The reaction mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (1 / 0 - 10 / 1) to give compound 10 as a colorless oil (329 mg, 36%).

[0647] 6. Synthesis of SW-II-134-3

[0648]

[0649] To a mixture of compound 10 (150 mg, 0.34 mmol, 1 eq.) and compound 5 (134 mg, 0.41 mmol, 1.2 eq.) in CPME / CH 3 CN (2 mL / 2 mL) were added potassium carbonate (282 mg, 2.04 mmol, 6 eq.) and potassium iodide (113 mg, 0.68 mmol, 2 eq.). After addition, the mixture was stirred under nitrogen at 90 °C overnight. TLC (DCM / MeOH = 10 / 1) showed the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1 / 0 - 10:1, v / v) to give SW-II-134-3 as a yellow oil (63.59 mg, 25%).

[0650] LCMS: Rt: 1.247 min; MS m / z (ELSD): 688.3 [M + H] + ;

[0651] HPLC: 95.945% purity, ELSD; RT = 6.186 min.

[0652] 1 H NMR (400 MHz, CDCl 3)δ7.07(d,J=7.6Hz,1H),6.97(dd,J=9.9,2.2Hz,2H),4.26(t,J=7.2Hz,2H),4.05(t,J=6.8Hz,2H),2.88(dd,J=14.8,7.6Hz,4H),2.78–2.74(m,2H),2.67–2.54(m,8H),2.29(t,J=7.5Hz,4H),1.68–1.47(m,15H),1.37–1.22(m,27H),0.98–0.86(m,9H).

[0653] 13 C NMR(101MHz,CDCl 3 )δ173.86(d,J=17.1Hz),140.66(s),138.76(s),134.93(s),129.74(s),129.24(s),126.19(s),77.36(s),77.04(s),76.72(s),65.01(s),64.48(s),57.73(s),55.73(s),53.93(s),34.76(s),34.28(d,J=3.9Hz),33.54(d,J=4.5Hz),32.41(s),31.95(d,J=16.5Hz),29.49(s),29.15(dd,J=21.1,2.4Hz),28.66(s),27.04(s),25.95(d,J=3.3Hz), 24.85(d,J=6.6Hz),22.98–22.58(m),14.08(d,J=7.5Hz).

[0654] J.SW-II-135-1

[0655]

[0656] 1. Synthesis of Compound 3

[0657]

[0658] Compound 1 (500 mg, 2.16 mmol, 1.0 eq.) and Compound 2 (750 mg, 6.46 mmol, 3.0 eq.) were dissolved in toluene / H 2 O (5 mL / 1 mL). Ruphos (201 mg, 0.43 mmol, 0.2 eq), Pd(OAc) 2 (48.5 mg, 0.22 mmol, 0.1 eq) and Cs 2 CO 3(2.10 g, 6.46 mmol, 3.0 eq.). The reaction mixture was heated under reflux at 110 °C for 16 h under nitrogen protection. TLC (petroleum ether / ethyl acetate = 10 / 1) showed that the reaction was complete and the desired product was formed. The reaction mixture was washed with H 2 O (40 mL) and extracted three times with EA (50 mL). The obtained organic phase was washed twice with brine (20 mL), dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with petroleum ether / ethyl acetate (1 / 0 - 30 / 1) to give the yellow oily compound 3 (540 mg, 82.44%).

[0659] 2. Synthesis of Compound 4

[0660]

[0661] Under nitrogen protection at 0 °C, LiAlH 4 (3.55 mL, 3.55 mmol, 1 M in THF, 2 eq.) was added to compound 3 (540 mg, 1.78 mmol, 1.0 eq.) dissolved in THF (5 mL). The reaction mixture was stirred at room temperature for 2 h under nitrogen protection. TLC (PE / EtOAc = 10 / 1) showed that the reaction was complete and a new major spot was observed. The mixture was quenched with water (10 mL), then the pH was adjusted to 6 - 7 with 1 M hydrochloric acid and extracted three times with ethyl acetate (50 mL). The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 / 0 - 10 / 1) to give the colorless oily compound 4 (442 mg, 90.2%).

[0662] 3. Synthesis of Compound 6

[0663]

[0664] Compound 4 (442 mg, 1.60 mmol, 1.0 eq.) and compound 5 (428.5 mg, 1.92 mmol, 1.2 eq.) were dissolved in DCM (5 mL). EDCI (612 mg, 3.2 mmol, 2.0 eq.) and DMAP (78.2 mg, 0.64 mmol, 0.4 eq.) were added to this mixture, and then DIEA (826 mg, 6.4 mmol, 4.0 eq.) was added. The reaction mixture was stirred at room temperature for 16 h under nitrogen protection. TLC (petroleum ether / ethyl acetate = 10 / 1) showed that compound 4 was consumed and the desired product was formed. The reaction mixture was washed with H 2Washed with O (40 mL) and extracted three times with EA (50 mL). The obtained organic phase was washed twice with brine (20 mL) and dried over anhydrous Na 2 SO 4 . It was filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with petroleum ether / ethyl acetate (1 / 0 - 10 / 1), and a yellow oily compound 3 (342 mg, 44.5%) was obtained.

[0665] 4. Synthesis of SW-II-135-1

[0666]

[0667] Compound 6 (175 mg, 0.365 mmol, 1.2 eq.) and compound 7 (100 mg, 0.304 mmol, 1.0 eq) were dissolved in CPME / CH 3 CN (1 mL / 1 mL). Potassium carbonate (210 mg, 1.52 mmol, 5.0 eq) and potassium iodide (101 mg, 0.61 mmol, 2.0 eq) were added to the mixture. After the addition, the reaction mixture was stirred at 90 °C overnight under nitrogen protection. TLC (DCM / MeOH = 10 / 1) showed that the reaction was complete and the desired product was formed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with DCM / MeOH (1 / 0 - 10:1, v / v), and a yellow oily compound SW-II-135-1 (83.89 mg, 55.6%) was obtained.

[0668] LCMS: Rt: 1.356 min; MS m / z (ELSD): 730.5 [M + H] + ;

[0669] HPLC: 100% purity at ELSD; RT = 12.614 min.

[0670] 11H NMR (400 MHz, CDCl3) δ 6.97 (d, J = 7.6 Hz, 1H), 6.91–6.74 (m, 2H), 4.76 (s, 1H), 3.99 (dt, J = 13.6, 6.4 Hz, 4H), 3.72–3.58 (m, 2H), 2.85–2.73 (m, 2H), 2.72–2.61 (m, 4H), 2.59–2.41 (m, 6H), 2.22 (dd, J = 13.2, 7.2 Hz, 4H), 1.93–1.79 (m, 2H), 1.62–1.41 (m, 14H), 1.23 (d, J = 24.4 Hz, 32H), 0.82 (ddd, J = 13.6, 8.0, 5.6 Hz, 9H).

[0671] 13 13C NMR (101 MHz, CDCl3) δ 172.81 (d, J = 6.4 Hz), 139.55 (s), 137.38 (s), 137.14 (s), 128.16 (d, J = 2.4 Hz), 124.69 (s), 76.51 (s), 76.19 (s), 75.88 (s), 63.43 (s), 62.78 (s), 56.53 (s), 54.90 (s), 52.84 (s), 33.23 (d, J = 2.4 Hz), 31.73 (s), 31.28 (s), 30.91 (dd, J = 20.0, 6.4 Hz), 30.10 (d, J = 3.2 Hz), 29.29 (s), 28.36 (d, J = 22.8 Hz), 28.23 (s), 27.97 (s), 27.64 (s), 25.92 (s), 24.92 (s), 24.34 (s), 23.84 (s), 21.62 (d, J = 7.6 Hz), 13.08 (d, J = 4.7 Hz).

[0672] K. Compound SW-II-135-2

[0673]

[0674] SW-II-135-2

[0675] 1. Synthesis of Compound 3

[0676]

[0677] Compound 1 (500 mg, 2.16 mmol, 1.0 eq.) and Compound 2 (931 mg, 6.46 mmol, 3.0 eq.) were dissolved in toluene / H 2In O(5 mL / 1 mL), Ruphos (201 mg, 0.43 mmol, 0.2 eq), Pd(OAc) 2 (48.5 mg, 0.22 mmol, 0.1 eq) and Cs 2 CO 3 (2.10 g, 6.46 mmol, 3.0 eq.) were added to the mixture. The reaction mixture was heated under reflux at 110 °C for 16 h under nitrogen protection. TLC (petroleum ether / ethyl acetate = 10 / 1) showed that the reaction was complete and the desired product was formed. The reaction mixture was washed with H 2 O (40 mL) and extracted three times with EA (50 mL). The resulting organic phase was washed twice with brine (20 mL), dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (1 / 0 - 30 / 1), to give the yellow oily compound 3 (651 mg, 84%).

[0678] 2. Synthesis of Compound 4

[0679]

[0680] Under nitrogen protection at 0 °C, LiAlH 4 (3.62 mL, 3.62 mmol, 1 M in THF, 2 eq.) was added to compound 3 (651 mg, 1.81 mmol, 1.0 eq.) dissolved in THF (7 mL). The reaction mixture was warmed to room temperature and stirred for 2 h under nitrogen protection. TLC (PE / EtOAc = 10 / 1) showed that the reaction was complete and a new major spot was observed. The mixture was quenched with water (10 mL), then the pH was adjusted to 6 - 7 with 1 M hydrochloric acid, and extracted three times with ethyl acetate (50 mL). The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 10 / 1), to give the colorless oily compound 4 (571 mg, 95.2%).

[0681] 3. Synthesis of Compound 6

[0682]

[0683] Compound 4 (571 mg, 1.72 mmol, 1.0 eq.) and compound 5 (459 mg, 2.06 mmol, 1.2 eq.) were dissolved in DCM (6 mL). To this mixture, EDCI (657 mg, 3.44 mmol, 2.0 eq.) and DMAP (84 mg, 0.68 mmol, 0.4 eq.) were added, and then DIEA (887.5 mg, 6.88 mmol, 4.0 eq.) was added. The reaction mixture was stirred at room temperature for 16 h under nitrogen protection. TLC (petroleum ether / ethyl acetate = 10 / 1) showed that compound 4 was consumed and the desired product was formed. The reaction mixture was washed with H 2 O (50 mL) and extracted three times with EA (60 mL). The obtained organic phase was washed twice with brine (25 mL), dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (1 / 0 - 10 / 1) to give compound 3 as a yellow oil (245 mg, 26.5%).

[0684] 4. Synthesis of SW-II-135-2

[0685]

[0686] Compound 6 (245 mg, 0.456 mmol, 1.5 eq.) and compound 7 (100 mg, 0.3 mmol, 1.0 eq) were dissolved in CPME / CH 3 CN (1 mL / 1 mL). To this mixture, potassium carbonate (210 mg, 1.52 mmol, 5.0 eq) and potassium iodide (101 mg, 0.61 mmol, 2.0 eq) were added. After the addition, the reaction mixture was stirred at 90 °C overnight under nitrogen protection. TLC (DCM / MeOH = 10 / 1) showed that the reaction was complete and the desired product was formed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1 / 0 - 10:1, v / v) to give SW-II-135-2 as a yellow oil (31.41 mg, 21.9%).

[0687] LCMS: Rt: 1.608 min; MS m / z (ELSD): 786.4 [M + H] + ;

[0688] HPLC: 95.16% purity, ELSD; RT = 7.919 min.

[0689] 1¹H NMR (400 MHz, CDCl 3 ) δ 6.98 (d, J = 7.6 Hz, 1H), 6.87 (d, J = 2.4 Hz, 2H), 4.28–4.13 (m, 1H), 4.04–3.95 (m, 4H), 3.94–3.84 (m, 2H), 3.14–2.89 (m, 6H), 2.59–2.43 (m, 6H), 2.23 (dd, J = 13.8, 7.2 Hz, 4H), 1.88–1.82 (m, 2H), 1.70 (s, 4H), 1.57–1.46 (m, 10H), 1.33–1.16 (m, 40H), 0.90–0.72 (m, 9H).

[0690] 13 ¹³C NMR (100 MHz, CDCl 3 ) δ 172.82 (d, J = 6.8 Hz), 139.61 (s), 137.29 (d, J = 16.4 Hz), 128.15 (s), 124.67 (s), 76.41 (s), 76.09 (s), 75.77 (s), 63.50 (s), 62.87 (s), 55.49 (s), 54.92 (s), 52.98 (s), 33.16 (d, J = 2.4 Hz), 31.77 (s), 31.33 (s), 30.80 (d, J = 6.5 Hz), 30.42 (d, J = 3.6 Hz), 29.29 (s), 28.99–28.66 (m), 28.47 (s), 28.23 (d, J = 2.8 Hz), 28.06–27.45 (m), 25.58 (s), 24.91 (s), 23.71 (s), 22.79 (s), 21.66 (s), 13.10 (s).

[0691] L. Compound SW-II-136-2

[0692]

[0693] SW-II-136-2

[0694] 1. Synthesis of Compound 3

[0695]

[0696] Compound 1 (3 g, 13.70 mmol, 1.0 eq.) and Compound 2 (5.34 g, 41.09 mmol, 3.0 eq.) were dissolved in toluene / H 2 ₂O (30 mL / 3 mL). Ruphos (1.28 g, 2.74 mmol, 0.2 eq) and Pd(OAc)2 (308.3 mg, 1.37 mmol, 0.1 eq) and K 2 CO 3 (5.67 g, 41.10 mmol, 3.0 eq.). The reaction mixture was heated under reflux at 110 °C for 16 h under nitrogen protection. TLC (PE / EA = 10 / 1) showed that the reaction was complete and the desired product was formed. The reaction mixture was washed with H 2 O (90 mL) and extracted three times with EA (110 mL). The obtained organic phase was washed twice with brine (40 mL), dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 / 0 - 30 / 1), to give the yellow oily compound 3 (1.98 g, 45.5%).

[0697] 2. Synthesis of compound 4

[0698]

[0699] Under nitrogen protection at 0 °C, LiAlH 4 (1 M, 12.45 mL, 2.0 eq) was added to compound 3 (1.98 g, 6.23 mmol, 1.0 eq.) dissolved in THF (20 mL). The reaction mixture was stirred at room temperature under nitrogen protection for 2 h. TLC (PE / EtOAc = 10 / 1) showed that the reaction was complete and a new main spot was observed. The mixture was quenched with H 2 O (70 mL), then the pH was adjusted to 6 - 7 with 1 M hydrochloric acid, and extracted three times with EA (80 mL). The organic layer was washed with brine, dried over anhydrous Na 2 SO 4 , filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 / 0 - 10 / 1), to give the colorless oily compound 4 (1.28 g, 71.1%).

[0700] 3. Synthesis of compound 7

[0701]

[0702] Under nitrogen protection at 0 °C, DMSO (3.63 g, 51.72 mmol, 15 eq), TEA (1.25 g, 12.4 mmol, 4.0 eq) and PySO 3(1.27 g, 7.97 mmol, 2.57 eq). The mixture was stirred at 0 °C for 30 minutes and then warmed to room temperature and stirred for 90 minutes under nitrogen protection. Then compound 6 (4.74 g, 13.62 mmol, 3.0 eq.) was added to the mixture, and the reaction mixture was reacted at 25 °C for 2 hours under nitrogen protection. TLC (PE / EA = 10 / 1) showed that the reaction was complete and the desired product was formed. The reaction mixture was washed with H 2 O (60 mL) and extracted three times with EA (70 mL). The resulting organic phase was washed twice with brine (40 mL), dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 10 / 1), to give compound 7 as a yellow oil (345 mg, 27.9%).

[0703] 4. Synthesis of compound 8

[0704]

[0705] Compound 7 (340 mg, 0.95 mmol, 1.0 eq.) and Pd / C (100 mg) were added to MeOH (4 ml). The reaction mixture was stirred at room temperature under hydrogen protection for 16 h. TLC (PE / EA = 10 / 1) showed that the starting material was completely consumed and the desired product was formed. The reaction mixture was filtered through diatomaceous earth and washed with MeOH (40 mL × 2), dried over anhydrous Na 2 SO 4 and the filtrate was concentrated under reduced pressure to obtain compound 8 as a pale yellow oil (298 mg, 88.2%).

[0706] 5. Synthesis of compound 9

[0707]

[0708] Under nitrogen protection at 0 °C, LiAlH 4 (1 M, 1.66 mL, 2.0 eq) was added to compound 8 (298 mg, 0.83 mmol, 1.0 eq) dissolved in THF (3 mL). The reaction mixture was warmed to room temperature and stirred for 2 hours under nitrogen protection. TLC (PE / EtOAc = 10 / 1) showed that the reaction was complete and a new major spot was observed. The mixture was quenched with H 2 O (20 mL), then the pH was adjusted to 6 - 7 with 1 M hydrochloric acid, and extracted three times with EA (30 mL). The organic layer was washed with brine, dried over anhydrous Na 2 SO 4Dry, filter, and concentrate under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 10 / 1) to afford compound 9 as a colorless oil (254 mg, 98.3%).

[0709] 6. Synthesis of Compound 11

[0710]

[0711] Dissolve compound 9 (254 mg, 0.80 mmol, 1.0 eq.) and compound 10 (214 mg, 0.96 mmol, 1.2 eq.) in DCM (3 mL). Add EDCI (305.6 mg, 1.6 mmol, 2.0 eq.) and DMAP (39 mg, 0.32 mmol, 0.4 eq.) to the mixture, then add DIEA (412.8 mg, 3.2 mmol, 4.0 eq.). The reaction mixture was stirred at room temperature for 16 h under nitrogen protection. TLC (PE / EA = 10 / 1) showed that compound 9 was consumed and the desired product was formed. The reaction mixture was adjusted to pH = 4 - 6 with 1 M hydrochloric acid and extracted three times with EA (30 mL). The resulting organic phase was washed twice with brine (15 mL) and dried over anhydrous Na 2 SO 4 Dry, filter and concentrate under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 7 / 1) to afford compound 11 as a yellow oil (210 mg, 50.5%).

[0712] 7. Synthesis of SW-II-136-2

[0713]

[0714] Dissolve compound 11 (200 mg, 0.38 mmol, 1.2 eq.) and compound 12 (105 mg, 0.32 mmol, 1.0 eq) in CPME / CH 3 CN (1.5 mL / 1.5 mL). Add K 2 CO 3 (220.2 mg, 1.60 mmol, 5.0 eq) and KI (106 mg, 0.64 mmol, 2.0 eq) to the mixture. After addition, the reaction mixture was stirred at 90 °C overnight under nitrogen protection. TLC (DCM / MeOH = 10 / 1) showed that the reaction was complete and the desired product was formed. The mixture was extracted with EA and washed with water. The organic layer was dried over anhydrous Na 2 SO 4Dry, filter and concentrate under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1 / 0 - 10:1, v / v) to give the compound SW-II-136-2 as a yellow oil (208 mg, 90.4%).

[0715] LCMS: Rt: 2.146 min; MS m / z (ELSD): 773.3 [M+H] + ;

[0716] HPLC: 99.49% purity, ELSD; RT = 8.055 min.

[0717] 1 H NMR (400 MHz, CDCl 3 ) δ 7.04 (d, J = 7.6 Hz, 1H), 6.92 (d, J = 9.6 Hz, 2H), 4.45 (s, 1H), 4.06 (dd, J = 12.0, 5.2 Hz, 4H), 3.64 (t, J = 5.2 Hz, 2H), 2.72 (t, J = 5.2 Hz, 2H), 2.65–2.50 (m, 10H), 2.29 (t, J = 7.6 Hz, 4H), 1.69–1.48 (m, 18H), 1.41–1.24 (m, 36H), 0.95–0.78 (m, 9H).

[0718] 13 C NMR (101 MHz, CDCl 3 ) δ 173.86 (d, J = 2.8 Hz), 140.48 (s), 139.24 (s), 138.01 (s), 129.13 (d, J = 14.8 Hz), 125.67 (s), 77.37 (s), 77.05 (s), 76.73 (s), 64.45 (s), 64.23 (s), 57.88 (s), 55.91 (s), 53.94 (s), 35.07 (s), 34.29 (d, J = 3.2 Hz), 32.79 (s), 32.35 (s), 31.82 (d, J = 8.4 Hz), 31.38 (s), 29.50 (d, J = 2.4 Hz), 29.16 (dd, J = 18.0, 2.0 Hz), 28.66 (s), 28.35 (s), 27.78 (s), 27.08 (s), 26.02 (d, J = 17.2 Hz), 24.89 (d, J = 1.6 Hz), 22.65 (s), 14.10 (s).

[0719] M. Compound SW-II-137-1

[0720]

[0721] 1. Synthesis of Compound 3

[0722]

[0723] Compound 1 (500 mg, 1.95 mmol, 1.0 eq.) was dissolved in toluene (5.0 mL), and then Compound 2 (239 mg, 2.34 mmol, 1.2 eq.), Pd(PPh 3 ) 4 (225 mg, 0.19 mmol, 0.1 eq), water (1 mL), and K 2 CO 3 (808 g, 5.85 mmol, 3.0 eq.) were added. The reaction was carried out at 110 °C for 3 hours under nitrogen protection. TLC (PE / EA = 5 / 1) showed that the raw materials had reacted completely and the desired product was formed. The reaction mixture was added with H 2 O (70 mL), and extracted with EA (80 mL × 3). The combined organic phases were washed with saturated brine (2 × 30 mL), dried over anhydrous Na 2 SO 4 , filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 5:1, v / v) to obtain a colorless oily compound (320 mg, 70%).

[0724] 2. Synthesis of Compound 4

[0725]

[0726] Compound 3 (300 mg, 1.28 mmol, 1.0 eq.) was dissolved in THF (4.0 mL), and LAH (97 mg, 2.56 mmol, 2.0 eq) was added at 0 °C under nitrogen protection. Then the reaction was carried out at room temperature for 2 hours. TLC (PE / EA = 10 / 1) showed that the raw materials had reacted completely and the desired product was formed. The reaction was quenched with HCl (1 M, 4 mL) solution and H 2 O (10 mL), and extracted with EA (50 mL × 3). The organic phases were washed with saturated brine (2 × 30 mL), dried over anhydrous Na 2 SO 4 , filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 10 / 1, v / v) to obtain a yellow oily compound 4 (224 mg, 84.8%).

[0727] 3. Synthesis of Compound 6

[0728]

[0729] Compound 4 (90 mg, 0.47 mmol, 1.0 eq.) was dissolved in DCM (3.0 mL), and compound 5 (127 mg, 0.56 mmol, 1.2 eq.), EDCI (180 mg, 0.94 mmol, 2.0 eq.), DIEA (242 mg, 1.88 mmol, 4.0 eq.) and DMAP (23 mg, 0.18 mmol, 0.4 eq.) were added. Then, the reaction was carried out overnight at room temperature under nitrogen protection. TLC (PE / EA = 20 / 1) showed that the raw materials had reacted completely and the desired product was formed. The reaction was quenched with HCl (1 M) solution, the pH was adjusted to 4 - 6, and it was extracted with EA (40 mL × 3). The combined organic phases were washed with saturated brine (2 × 30 mL), and anhydrous Na 2 SO 4 dried, filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 20 / 1, v / v) to give compound 6 as a colorless oil (90 mg, 48.6%).

[0730] 4. Synthesis of SW-II-137-1

[0731]

[0732] Compound 6 (90 mg, 0.25 mmol, 1.0 eq.) was dissolved in MeCN (2 mL), and compound 7 (110 mg, 0.25 mmol, 1.0 eq), KI (76 mg, 0.50 mmol, 2.0 eq), CPME (2 mL) and K 2 CO 3 (157 mg, 1.25 mmol, 5.0 eq) were added. The reaction was carried out at 90 °C overnight under nitrogen protection. TLC (DCM / MeOH = 10 / 1) showed that the raw materials had reacted completely and the desired product was formed. The reaction was quenched with water (50 mL), and extracted with EA (40 mL × 3). The combined organic phases were washed with saturated brine (2 × 30 mL), and anhydrous Na 2 SO 4 dried, filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1 / 0 - 10 / 1, v / v) to give a yellow oil compound (98 mg, 52.12%, SW-II-137-1).

[0733] LCMS: Rt: 1.596 min; MS m / z (ELSD): 758.4 [M + H] + ;

[0734] HPLC: 98.02% purity, ELSD; RT = 5.993 min.

[0735] 1 H NMR (400 MHz, CDCl 3 ) δ 7.02 (d, J = 8.8 Hz, 4H), 4.92–4.71 (m, 1H), 4.01 (t, J = 6.4 Hz, 2H), 3.78 (s, 1H), 3.55 (t, J = 5.2 Hz, 2H), 2.76–2.40 (m, 10H), 2.21 (dd, J = 15.6, 7.7 Hz, 4H), 1.95–1.80 (m, 2H), 1.49 (ddd, J = 24.4, 15.8, 6.2 Hz, 15H), 1.34–1.13 (m, 37H), 0.82 (dt, J = 13.6, 7.2 Hz, 9H).

[0736] 13 C NMR (101 MHz, CDCl 3 ) δ 173.79 (s), 173.57 (s), 140.49 (s), 138.30 (s), 128.43 (s), 128.22 (s), 77.43 (s), 77.11 (s), 76.79 (s), 74.11 (s), 63.66 (s), 57.96 (s), 55.75 (s), 53.90 (s), 35.22 (s), 34.63 (s), 34.20 (d, J = 11.6 Hz), 33.70 (s), 31.80 (d, J = 11.2 Hz), 30.30 (s), 29.51 (d, J = 2.8 Hz), 29.13 (dd, J = 9.6, 6.8 Hz), 27.12 (d, J = 2.8 Hz), 26.29 (s), 25.31 (s), 24.97 (d, J = 15.6 Hz), 22.66 (s), 22.37 (s), 14.02 (d, J = 15.2 Hz) .

[0737] N. Compound SW-II-137-2

[0738]

[0739] 1. Synthesis of Compound 3

[0740]

[0741] Compound 1 (500 mg, 2.06 mmol, 1.0 eq.), Compound 2 (286 mg, 2.47 mmol, 1.2 eq.), Pd(PPh 3 ) 4 (119 mg, 0.1 mmol, 0.1 eq) and K 2 CO 3(851 mg, 6.21 mmol, 3.0 eq.) was dissolved in toluene (5.0 mL), and water (0.5 mL) was added. Then, the reaction was carried out at 110 °C for 3 hours under nitrogen protection. TLC (PE / EA = 5 / 1) showed that the raw material had completely reacted and the desired compound was formed. The reaction was quenched with H 2 O (70 mL), and extracted with EA (80 mL × 3). The organic phase was washed with saturated brine (2 × 30 mL), and dried over anhydrous Na 2 SO 4 . It was filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with (PE / EA = 5 / 1, v / v) to obtain the colorless oily compound 3 (420 mg, 87.5%).

[0742] 2. Synthesis of Compound 4

[0743]

[0744] Compound 3 (420 mg, 1.78 mmol, 1.0 eq.) was dissolved in THF (3.0 mL), and LAH (1 M, 7 mL, 2.0 eq) was added dropwise at 0 °C under nitrogen protection. Then, the reaction was carried out at room temperature for 2 hours. TLC (PE / EA = 5 / 1) showed that the raw material had reacted completely and the desired product was formed. The reaction was quenched with HCl (1 M, 4 mL) solution and H 2 O (10 mL), and extracted with EA (50 mL × 3). The organic phase was washed with saturated brine (2 × 30 mL), and dried over anhydrous Na 2 SO 4 . It was filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with (PE / EA = 5 / 1, v / v) to obtain the colorless oily compound 4 (320 mg, 94%).

[0745] 3. Synthesis of Compound 6

[0746]

[0747] Compound 4 (320 mg, 1.55 mmol, 1.0 eq.) was dissolved in DCM (4.0 mL), and compound 5 (416 mg, 1.86 mmol, 1.2 eq.), EDCI (594 mg, 3.11 mmol, 2.0 eq.), DIEA (802 mg, 6.21 mmol, 4.0 eq.) and DMAP (76 mg, 0.62 mmol, 0.4 eq.) were added. Then, the reaction was carried out at room temperature overnight under nitrogen protection. TLC (PE / EA = 20 / 1) showed that the raw materials had reacted completely and the desired product was formed. The reaction was quenched with HCl (1 M) solution and the pH was adjusted to 4 - 6, and extracted with DCM (60 mL × 3). The organic phase was washed with saturated brine (2 × 35 mL), and dried over anhydrous Na2 SO 4 Dry, filter and concentrate under reduced pressure. The residue was purified by silica gel column chromatography and eluted with (PE / EA = 5 / 1, v / v) to give the colorless oily compound 6 (300 mg, 47.17%).

[0748] 4. Synthesis of SW-II-137-2

[0749]

[0750] Compound 6 (167 mg, 0.41 mmol, 1.2 eq.), compound 7 (150 mg, 0.34 mmol, 1.0 eq), KI (113 mg, 0.68 mmol, 2.0 eq) and CPME (2 mL) were dissolved in MeCN (2 mL), and K 2 CO 3 (235 mg, 1.70 mmol, 5.0 eq) was added. The reaction was carried out at 90 °C overnight under nitrogen protection. TLC (DCM / MeOH = 10 / 1) showed that the raw materials reacted completely and the desired product was formed. The reaction was quenched with water (50 mL) and extracted with EA (60 ml x 3). The organic phase was dried over anhydrous Na 2 SO 4 dried, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography and eluted with DCM / MeOH (1 / 0 - 10 / 1, v / v) to give the light yellow oily compound (105 mg, 40.3%, SW-II-137-2).

[0751] LCMS: Rt: 1.660 min; MS m / z (ELSD): 772.4 [M+H] + ;

[0752] HPLC: 98.38% purity, ELSD; RT = 8.743 min.

[0753] 1 1H NMR (400 MHz, CDCl 3 ) δ 7.10 (d, J = 8.8 Hz, 4H), 5.04–4.74 (m, 1H), 4.08 (t, J = 6.4 Hz, 2H), 3.58 (t, J = 5.2 Hz, 2H), 2.65 (dd, J = 9.6, 5.6 Hz, 4H), 2.60–2.44 (m, 6H), 2.29 (dd, J = 16.4, 7.6 Hz, 4H), 2.01–1.88 (m, 2H), 1.59 (dt, J = 9.2, 7.2 Hz, 6H), 1.54–1.42 (m, 8H), 1.39–1.11 (m, 41H), 0.88 (dt, J = 11.8, 6.0 Hz, 9H).

[0754] 13 C NMR(101MHz,CDCl 3 )δ173.86(s),173.63(s),140.59(s),138.34(s),128.45(s),128.24(s),77.36(s),77.04(s),76.72(s),74.14(s),63.69(s),58.11(s),55.71(s),53.90(s),35.53(s),34.68(s),34.23(d,J=14.8Hz),31.82(d,J=11.6Hz),31.56(s),31.26(s),30.32(s),29.53(d,J=2.8Hz),29.19(dd,J=8.0,4.4Hz),27.20(d,J=2.4Hz),26.64(s),25.33(s),25.02(d,J=15.6Hz),22.62(d,J=11.6Hz),14.08(d,J=8.0Hz).

[0755] O. Compound SW-II-137-3

[0756]

[0757] 1. Synthesis of Compound 3

[0758]

[0759] To a mixture of Compound 1 (11.8 g, 53 mmol, 1.2 eq.) and Compound 2 (11.2 g, 44 mmol, 1 eq.) in DCM (110 mL) was added EDCI (16.9 g, 88 mmol, 2 eq.) and DMAP (2.1 g, 18 mmol, 0.4 eq.), and then DIEA (22.7 g, 176 mmol, 4 eq.) was added. The reaction mixture was stirred under nitrogen at room temperature for 16 h. TLC (petroleum ether / ethyl acetate = 30 / 1) showed that Compound 1 was consumed and the desired product was formed. The reaction mixture was extracted with ethyl acetate (200 mL) and washed with water (200 mL × 3), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (1 / 0 - 20 / 1) to give Compound 3 as a colorless oil (7.391 g, 37%).

[0760] 2. Synthesis of Compound 5

[0761]

[0762] A mixture of compound 3 (7.391 mg, 16.07 mmol, 1 eq.) and compound 4 (29.4 g, 482.02 mmol, 30 eq.) in ethanol (2 mL) was stirred under nitrogen at 55 °C for 16 h. TLC (DCM / MeOH = 10 / 1) showed the observation of a new major spot. The reaction mixture was extracted with ethyl acetate (100 mL) and washed with water (3 × 100 mL). The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1 / 0 - 10:1, v / v) to give compound 5 as a yellow oil (3.695 g, 52%).

[0763] 3. Synthesis of compound 8

[0764]

[0765] To a mixture of compound 6 (1 g, 4.12 mmol, 1 eq.) and compound 7 (803 g, 6.17 mmol, 1.5 eq) in 1,4 - dioxane / water (10 mL / 1 mL) was added Pd(dtbpf)Cl 2 (269 mg, 0.41 mmol, 0.1 eq.) and potassium carbonate (1.7 g, 12.36 mmol, 3 eq). The mixture was stirred under nitrogen at 100 °C overnight. TLC (PE / EA = 20 / 1) showed the completion of the reaction and the observation of a new major spot. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 20 / 1) to give compound 8 as a colorless oil (568 mg, 56%).

[0766] 4. Synthesis of compound 9

[0767]

[0768] Under 0 °C and nitrogen atmosphere, lithium aluminum hydride (2.3 mL, 2.29 mmol, 1 M in THF, 1 eq.) was added to a mixture of compound 8 (568 mg, 2.29 mmol, 1 eq.) in THF (6 mL). The mixture was stirred at room temperature for 3 h. TLC (PE / EA = 5 / 1) indicated the completion of the reaction and the observation of a new major spot. The mixture was quenched with water (2.3 mL) and treated with 2 N hydrochloric acid to adjust the pH between 6 and 7, extracted with ethyl acetate and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to give compound 9 as a colorless oil (541 mg, >100%) without further purification.

[0769] 5. Synthesis of Compound 10

[0770]

[0771] To a mixture of Compound 9 (441 mg, 2 mmol, 1 eq.) and Compound 1 (536 mg, 2.4 mmol, 1.2 eq.) in DCM (5 mL) were added EDCI (768 mg, 4 mmol, 2 eq.) and DMAP (98 mg, 0.8 mmol, 0.4 eq.), and then DIEA (1.032 g, 8 mmol, 4 eq.) was added. The reaction mixture was stirred under nitrogen at room temperature for 16 h. TLC (petroleum ether / ethyl acetate = 10 / 1) showed the formation of the desired product. The reaction mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (1 / 0 - 10 / 1), to give Compound 10 as a colorless oil (372 mg, 44%).

[0772] 6. Synthesis of SW-II-137-3

[0773]

[0774] To a mixture of Compound 10 (150 mg, 0.353 mmol, 1 eq.) and Compound 5 (156 mg, 0.353 mmol, 1 eq.) in CPME / CH 3 CN (2 mL / 2 mL) were added potassium carbonate (244 mg, 1.765 mmol, 6 eq.) and potassium iodide (117 mg, 0.706 mmol, 2 eq.). After addition, the mixture was stirred under nitrogen at 90 °C overnight. TLC (DCM / MeOH = 10 / 1) showed completion of the reaction and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1 / 0 - 10:1, v / v), to give Compound SW-II-137-3 as a yellow oil (56.17 mg, 20%).

[0775] LCMS: Rt: 1.550 min; MS m / z (ELSD): 786.4 [M+H] + ;

[0776] HPLC: 98.597% purity, ELSD; RT = 13.153 min.

[0777] 1 H NMR (400 MHz, CDCl 3) δ 7.09 (s, 4H), 4.92–4.78 (m, 1H), 4.08 (t, J = 6.6 Hz, 2H), 3.62 (t, J = 5.2 Hz, 2H), 2.78–2.50 (m, 10H), 2.35–2.22 (m, 4H), 2.00–1.88 (m, 2H), 1.57 (ddd, J = 28.9, 13.5, 4.5 Hz, 14H), 1.38–1.20 (m, 42H), 0.88 (t, J = 6.8 Hz, 9H).

[0778] 13 C NMR (101 MHz, CDCl 3 ) δ 173.83 (s), 173.60 (s), 140.60 (s), 138.33 (s), 128.44 (s), 128.24 (s), 77.36 (s), 77.04 (s), 76.72 (s), 74.15 (s), 63.69 (s), 57.95 (s), 55.83 (s), 53.95 (s), 35.56 (s), 34.65 (s), 34.21 (d, J = 13.0 Hz), 31.81 (d, J = 12.3 Hz), 31.54 (s), 30.32 (s), 29.52 (d, J = 3.1 Hz), 29.34–28.94 (m), 27.13 (d, J = 2.5 Hz), 26.31 (s), 25.33 (s), 24.99 (d, J = 15.7 Hz), 22.64 (d, J = 5.7 Hz), 14.11 (s).

[0779] P. Compound SW-II-138-1

[0780]

[0781] 1. Synthesis of Compound 2

[0782]

[0783] Compound 1 (4 g, 16.46 mmol, 1.0 eq.) was dissolved in MeOH (40 mL), and SOCl 2 (3.9 g, 32.92 mmol, 2.0 eq) was added dropwise at 0 °C. Then the reaction was carried out at room temperature for 1 hour. TLC (PE / EA = 5 / 1) showed that the raw materials were consumed and the desired product was formed. The system was directly dried by rotary evaporation under reduced pressure. NaHCO 3 (70 mL) solution was added to the residue, and the mixture was extracted with EA (80 mL × 3). The combined organic phases were washed with saturated brine (2 × 30 mL), and anhydrous Na 2 SO 4Dry, filter and rotary evaporate under reduced pressure. The residue was purified by silica gel column chromatography and eluted with PE / EA (1 / 0 - 5:1, v / v) to give the yellow oily compound 2 (4.1 mg, 95%).

[0784] 2. Synthesis of Compound 4

[0785]

[0786] Compound 2 (500 mg, 1.95 mmol, 1.0 eq.), Compound 3 (239 mg, 2.34 mmol, 1.2 eq.), Pd(PPh 3 ) 4 (225 mg, 0.19 mmol, 0.1 eq) and K 2 CO 3 (808 g, 5.85 mmol, 3.0 eq.) were dissolved in toluene (5.0 mL) and water (1 mL) was added. Then the reaction was carried out at 110 °C for 3 hours under nitrogen protection. TLC (PE / EA = 5 / 1) showed that the starting materials were consumed and the desired product was formed. The reaction was quenched with H 2 O (70 mL), and extracted with EA (80 mL × 3). The combined organic phases were washed with saturated brine (2 × 30 mL), dried over anhydrous Na 2 SO 4 , filtered and rotary evaporated under reduced pressure. The residue was purified by silica gel column chromatography and eluted with PE / EA (1 / 0 - 5:1, v / v) to give the yellow oily compound 4 (320 mg, 70%).

[0787] 3. Synthesis of Compound 5

[0788]

[0789] Compound 4 (300 mg, 1.28 mmol, 1.0 eq.) was dissolved in THF (4.0 mL), and LAH (97 mg, 2.56 mmol, 2.0 eq) was added at 0 °C. Then the reaction was carried out at room temperature for 2 hours under nitrogen protection. TLC (PE / EA = 5 / 1) showed that the starting materials were consumed and the desired product was formed. The reaction was quenched with HCl (1 M, 4 mL) solution and H 2 O (10 mL), and extracted with EA (50 mL × 3). The organic phases were washed with saturated brine (2 × 30 mL), dried over anhydrous Na 2 SO 4 , filtered and rotary evaporated under reduced pressure. The residue was purified by silica gel column chromatography and eluted with PE / EA (1 / 0 - 5:1, v / v) to give the yellow oily compound 5 (224 mg, 84.8%).

[0790] 4. Synthesis of Compound 7

[0791]

[0792] Compound 7 (224 mg, 1.09 mmol, 1.0 eq.) was dissolved in DCM (3.0 mL), and compound 6 (290 mg, 1.30 mmol, 1.2 eq.), EDCI (415 mg, 2.17 mmol, 2.0 eq.), DIEA (561 mg, 4.35 mmol, 4.0 eq.) and DMAP (53 mg, 0.43 mmol, 0.4 eq.) were added. Then, the reaction was carried out overnight at room temperature under nitrogen protection. TLC (PE / EA = 30 / 1) showed that the raw materials were consumed and the desired product was formed. The reaction was quenched with HCl (1 M) solution and the pH was adjusted to 4 - 6, and then extracted with DCM (80 mL × 3). The combined organic phases were washed with saturated brine (2 × 30 mL), and anhydrous Na 2 SO 4 was dried, filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 30:1, v / v) to give compound 7 as a colorless oil (208 mg, 46.7%).

[0793] 5. Synthesis of SW-II-138-1

[0794]

[0795] Compound 10 (110 mg, 0.25 mmol, 1 eq.), compound 7 (153 mg, 0.37 mmol, 1.5 eq), KI (83 mg, 0.50 mmol, 2.0 eq) and CPME (2 mL) were dissolved in MeCN (2 mL), and K 2 CO 3 (172 mg, 1.25 mmol, 5.0 eq) was added. The reaction was carried out overnight at 90 °C under nitrogen protection. TLC (DCM / MeOH = 10 / 1) showed that the raw materials were consumed and the desired product was formed. The reaction was directly concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1 / 0 - 10:1, v / v) to give a light yellow oil compound (65 mg, 32%, SW-II-138-1).

[0796] LCMS: Rt: 1.684 min; MS m / z (ELSD): 772.4 [M + H] + ;

[0797] HPLC: 96.56% purity, ELSD; RT = 6.346 min.

[0798] 1 1H NMR (400 MHz, CDCl 3)δ7.09(s,4H),4.86(s,1H),4.09(d,J=6.0Hz,2H),3.97(s, 2H),3.07(d,J=38.8Hz,6H),2.69–2.51(m,4H),2.28(td,J=7.3,3.6Hz,4H),1.79(s,4H),1.70–1.46(m,16H),1.42–1.17(m,37H),0.90(dt,J=13.6,7.2Hz,9H).

[0799] 13 C NMR(101MHz,CDCl 3 )δ173.80(s),173.53(s),140.32(s),139.13(s),128.28(d,J=13.6Hz),77.43(s),77.11(s),76.80(s),74.21(s),64.22(s),56.85(s),55.98(s),53.93(s),35.22(s),35.01(s),34.54(s),34.14(d,J=5.6Hz),33.71(s),31.85(s),29.50(d,J=2.8Hz),29.22(s),29.12–28.60(m),28.26(s),27.78(s),26.70(d,J=4.4Hz),25.31(s),24.82(d,J=17.6Hz),24.28(s),22.65(s),22.37(s),14.03(d,J=15.2Hz).

[0800] Q.SW-II-138-2

[0801]

[0802] 1. Synthesis of Compound 3

[0803]

[0804] Compound 1 (500 mg, 1.95 mmol, 1.0 eq.), Compound 2 (271 mg, 2.34 mmol, 1.2 eq.), Pd(PPh 3 ) 4 (225 mg, 0.20 mmol, 0.1 eq) and K 2 CO 3(809g, 5.86 mmol, 3.0 eq.) was dissolved in toluene (5.0 mL), and water (1 mL) was added. Then, the reaction was carried out at 110 °C for 3 hours under nitrogen protection. TLC (PE / EA = 5 / 1) showed that the raw materials were consumed completely and the desired product was formed. The reaction was quenched by adding water (70 mL), and extracted with EA (80 mL × 3). The combined organic phases were washed with saturated brine (2 × 30 mL), dried over anhydrous Na 2 SO 4 and filtered, and then concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 30:1, v / v) to give the colorless oily compound 3 (320 mg, 70%).

[0805] 2. Synthesis of Compound 4

[0806]

[0807] Compound 3 (320 mg, 1.29 mmol, 1.0 eq.) was dissolved in THF (3.0 mL), and LAH (67 mg, 1.77 mmol, 2.0 eq.) was added at 0 °C. Then, the reaction was carried out at room temperature for 2 hours under nitrogen protection. TLC (PE / EA = 5 / 1) showed that the raw materials were consumed completely and the desired product was formed. The reaction was quenched with HCl (1 M, 2 mL) solution and H 2 O (10 mL), and extracted with EA (50 mL × 3). The combined organic phases were washed with saturated brine (2 × 30 mL), dried over anhydrous Na 2 SO 4 and filtered, and then concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 30:1, v / v) to give the colorless oily compound 4 (180 mg, 64%).

[0808] 3. Synthesis of Compound 6

[0809]

[0810] Compound 4 (180 mg, 0.82 mmol, 1.0 eq.) was dissolved in DCM (3.0 mL), and compound 5 (245 mg, 1.10 mmol, 1.2 eq.), EDCI (347 mg, 1.82 mmol, 2.0 eq.), DIEA (470 mg, 3.63 mmol, 4.0 eq.) and DMAP (45 mg, 0.36 mmol, 0.4 eq.) were added. Then, the reaction was carried out overnight at room temperature under nitrogen protection. TLC (PE / EA = 30 / 1) showed that the raw materials were consumed completely and the desired product was formed. The reaction was quenched with HCl (1 M) solution and the pH was adjusted to 5 - 6, and extracted with DCM (80 mL × 3). The combined organic phases were washed with saturated brine (2 × 30 mL), dried over anhydrous Na2 SO 4 Dry, filter and rotary evaporate under reduced pressure. The residue was purified by silica gel column chromatography and eluted with PE / EA (1 / 0 - 30:1, v / v) to give the colorless oily compound 6 (220 mg, 63.6%).

[0811] 4. Synthesis of SW-II-138-2

[0812]

[0813] Compound 6 (158 mg, 0.37 mmol, 1.5 eq.), compound 7 (110 mg, 0.25 mmol, 1.0 eq), KI (83 mg, 0.50 mmol, 2.0 eq) and CPME (2 mL) were dissolved in MeCN (2 mL), and K 2 CO 3 (172 mg, 1.25 mmol, 5.0 eq.) was added. Then, the reaction was carried out at 90 °C overnight under nitrogen protection. TLC (DCM / MeOH = 10 / 1) showed that the starting materials were consumed and the desired product was formed. The reaction mixture was directly rotary evaporated under reduced pressure, and the residue was purified by silica gel column chromatography and eluted with DCM / MeOH (1 / 0 - 10:1, v / v) to give the colorless oily target product (100 mg, 51%, SW-II-138-2).

[0814] LCMS: Rt: 1.834 min; MS m / z (ELSD): 786.4 [M+H] + ;

[0815] HPLC: 99.20% purity, ELSD; RT = 7.990 min.

[0816] 1 H NMR (400 MHz, CDCl 3 ) δ 7.00 (s, 4H), 4.88–4.73 (m, 2H), 4.00 (t, J = 5.6 Hz, 2H), 3.81–3.54 (m, 2H), 3.00–2.81 (m, 2H), 2.81–2.65 (m, 4H), 2.50 (dd, J = 16.4, 8.4 Hz, 4H), 2.20 (td, J = 7.6, 3.2 Hz, 4H), 1.56 (ddd, J = 18.4, 10.4, 5.2 Hz, 13H), 1.43 (d, J = 5.6 Hz, 4H), 1.34–1.07 (m, 40H), 0.81 (dt, J = 11.2, 5.6 Hz, 9H).

[0817] 13 C NMR (101 MHz, CDCl 3)δ173.78(s), 173.52(s), 140.32(s), 139.11(s), 128.25(d, J=11.6Hz), 77.49(s), 77.17(s), 76.85(s), 74.14(s), 64.17(s), 57.25(s), 55.82(s), 53.85(s), 35.50(s), 35.01(s), 34.56(s), 34.14(d, J=7.2Hz), 31.84(s), 31.53(s), 31.23(s), 29.49(d, J=2.8Hz), 29.21(s), 28.94(dd, J=6.4, 4.4Hz), 28.25(s), 27.77(s), 26.84(d, J=4.4Hz), 25.30(s), 25.25–24.59(m), 22.59(d, J=11.2Hz), 14.05(d, J=7.6Hz).

[0818] R.SW-II-138-3

[0819]

[0820] 1. Synthesis of Compound 3

[0821]

[0822] Compound 1 (500 mg, 1.95 mmol, 1.0 eq.), Compound 2 (305 mg, 2.34 mmol, 1.2 eq.), Pd(PPh 3 ) 4 (225 mg, 0.20 mmol, 0.1 eq) and K 2 CO 3 (809 g, 5.86 mmol, 3.0 eq.) were dissolved in toluene (5.0 mL) and water (1 mL) was added. Then, the reaction was carried out at 110 °C for 3 hours under nitrogen protection. TLC (PE / EA = 5 / 1) showed that the raw materials were completely consumed and the desired compound was formed. The reaction was quenched by adding water (80 mL) and extracted with EA (80 mL × 3). The combined organic phases were washed with saturated brine (2 × 40 mL), dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 5:1, v / v) to give Compound 3 as a colorless oil (260 mg, 51.3%).

[0823] 2. Synthesis of Compound 4

[0824]

[0825] Compound 3 (260 mg, 0.99 mmol, 1.0 eq.) was dissolved in THF (4.0 mL), and LAH (75 mg, 1.98 mmol, 2.0 eq) was added at 0 °C. Then, the reaction was carried out at room temperature for 2 hours under nitrogen protection. TLC (PE / EA = 5 / 1) showed that the raw material had reacted completely and the desired compound was formed. The reaction was quenched with HCl (1 M, 4 mL) solution and H 2 O (20 mL), and extracted with EA (50 mL × 3). The combined organic phases were washed with saturated brine (2 × 30 mL), and anhydrous Na 2 SO 4 dried, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 / 0 - 5:1, v / v) to obtain compound 4 (230 mg, 98%) as a colorless oil.

[0826] 3. Synthesis of Compound 6

[0827]

[0828] Compound 4 (240 mg, 1.03 mmol, 1.0 eq.) was dissolved in DCM (4.0 mL), and compound 5 (275 mg, 1.23 mmol, 1.2 eq.), EDCI (392 mg, 2.07 mmol, 2.0 eq.), DIEA (530 mg, 4.10 mmol, 4.0 eq.) and DMAP (50 mg, 0.41 mmol, 0.4 eq.) were added successively. Then, the reaction was carried out at room temperature overnight under nitrogen protection. TLC (PE / EA = 20 / 1) showed that the raw materials were consumed and the desired compound was formed. The reaction was quenched with HCl (1 M) and the pH was adjusted to 5 - 6, and extracted with DCM (80 mL × 3). The combined organic phases were washed with saturated brine (2 × 30 mL), and anhydrous Na 2 SO 4 dried, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 / 0 - 20:1, v / v) to obtain compound 6 (180 mg, 40.9%) as a colorless oil.

[0829] 4. Synthesis of SW-II-138-3

[0830]

[0831] Compound 6 (164 mg, 0.37 mmol, 1 eq.), compound 7 (110 mg, 0.24 mmol, 1.0 eq), KI (83 mg, 0.49 mmol, 2.0 eq) and CPME (2 mL) were dissolved in MeCN (2 mL), and K 2 CO 3(172 mg, 1.24 mmol, 5.0 eq). Then, the reaction was carried out at 90 °C overnight under nitrogen protection. TLC (DCM / MeOH = 10 / 1) showed that the raw materials were consumed completely and the desired product was formed. The reaction mixture was directly concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1 / 0 - 10:1, v / v) to obtain the target product as a colorless oil (108 mg, 52.76%, SW-II-138-3).

[0832] LCMS: Rt: 2.007 min; MS m / z (ELSD): 800.4 [M+H] + ;

[0833] HPLC: 97.95% purity, ELSD; RT = 9.455 min.

[0834] 1 1H NMR (400 MHz, CDCl 3 ) δ 7.08 (s, 4H), 4.86 (p, J = 6.4 Hz, 1H), 4.08 (s, 2H), 3.60 (t, J = 5.2 Hz, 3H), 2.76–2.42 (m, 10H), 2.28 (td, J = 7.6, 2.8 Hz, 4H), 1.70–1.42 (m, 18H), 1.28 (d, J = 20.0 Hz, 41H), 0.88 (t, J = 6.8 Hz, 9H).

[0835] 13 13C NMR (101 MHz, CDCl 3 ) δ 173.85 (s), 173.59 (s), 140.39 (s), 139.15 (s), 128.27 (d, J = 12.0 Hz), 77.38 (s), 77.07 (s), 76.75 (s), 74.13 (s), 64.17 (s), 58.06 (s), 55.75 (s), 53.92 (s), 35.57 (s), 35.03 (s), 34.66 (s), 34.22 (d, J = 13.2 Hz), 31.81 (d, J = 12.4 Hz), 31.54 (s), 29.52 (d, J = 2.9 Hz), 29.34–28.95 (m), 28.29 (s), 27.79 (s), 27.16 (d, J = 3.6 Hz), 26.50 (s), 25.32 (s), 24.99 (d, J = 17.6 Hz), 22.64 (d, J = 5.6 Hz), 14.10 (s).

[0836] S. Compound SW-II-139-1

[0837]

[0838] 1. Synthesis of Compound 3

[0839]

[0840] To a mixture of Compound 1 (1 g, 4.37 mmol, 1 eq.) and Compound 2 (852 g, 6.55 mmol, 1.5 eq) in 1,4 - dioxane / water (10 mL / 1 mL) was added Pd(dtbpf)Cl 2 (286 mg, 0.437 mmol, 0.1 eq.) and potassium carbonate (1.8 g, 13.11 mmol, 3 eq). The mixture was stirred at 100 °C under nitrogen overnight. TLC (PE / EA = 20 / 1) showed the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 20 / 1) to give Compound 3 as a colorless oil (691 mg, 68%).

[0841] 2. Synthesis of Compound 4

[0842]

[0843] Under 0 °C and nitrogen atmosphere, to a mixture of Compound 3 (691 mg, 2.95 mmol, 1 eq.) in THF (7 mL) was added lithium aluminum hydride (3 mL, 2.95 mmol, 1 M in THF, 1 eq.). The mixture was stirred at room temperature for 3 hours. TLC (PE / EA = 5 / 1) indicated the reaction was complete and a new major spot was observed. The mixture was quenched with water (3 mL) and treated with 2 N hydrochloric acid to adjust the pH between 6 and 7, extracted with ethyl acetate and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to give Compound 4 as a colorless oil (547 mg, 90%) without further purification.

[0844] 3. Synthesis of Compound 6

[0845]

[0846] To a mixture of Compound 4 (447 mg, 2.17 mmol, 1 eq.) and Compound 5 (581 mg, 2.6 mmol, 1.2 eq.) in DCM (5 mL) was added EDCI (833 mg, 4.34 mmol, 2 eq.) and DMAP (106 mg, 0.87 mmol, 0.4 eq.), followed by the addition of DIEA (1.12 g, 8.68 mmol, 4 eq.). The reaction mixture was stirred under nitrogen at room temperature for 16 h. TLC (petroleum ether / ethyl acetate = 15 / 1) showed the formation of the desired product. The reaction mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (1 / 0 - 20 / 1), to give Compound 6 as a colorless oil (455 mg, 51%).

[0847] 4. Synthesis of SW-II-139-1

[0848]

[0849] To a mixture of Compound 6 (150 mg, 0.365 mmol, 1 eq.) and Compound 7 (161 mg, 0.365 mmol, 1 eq.) in CPME / CH 3 CN (2 mL / 2 mL) was added potassium carbonate (252 mg, 1.825 mmol, 6 eq.) and potassium iodide (121 mg, 0.73 mmol, 2 eq.). After addition, the mixture was stirred under nitrogen at 90 °C overnight. TLC (DCM / MeOH = 10 / 1) showed completion of the reaction and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1 / 0 - 10:1, v / v), to give SW-II-139-1 as a yellow oil (54.53 mg, 19%).

[0850] LCMS: Rt: 1.521 min; MS m / z (ELSD): 772.4 [M+H] + ;

[0851] HPLC: 99.637% purity, ELSD; RT = 12.347 min.

[0852] 1 H NMR (400 MHz, CDCl 3)δ 7.20 (t, J = 7.7 Hz, 1H), 7.03 (t, J = 6.8 Hz, 3H), 4.94–4.78 (m, 1H), 4.27 (t, J = 7.2 Hz, 2H), 3.65 (t, J = 5.1 Hz, 2H), 2.90 (t, J = 7.2 Hz, 2H), 2.73 (t, J = 4.9 Hz, 2H), 2.67–2.41 (m, 6H), 2.28 (td, J = 7.5, 2.7 Hz, 4H), 1.67–1.45 (m, 14H), 1.41–1.19 (m, 42H), 0.88 (dd, J = 7.9, 5.7 Hz, 9H).

[0853] 13 C NMR (101 MHz, CDCl 3 )δ 173.65 (d, J = 11.3 Hz), 143.17 (s), 137.67 (s), 129.04 (s), 128.34 (s), 126.61 (s), 126.11 (s), 77.30 (d, J = 11.6 Hz), 77.04 (s), 76.72 (s), 74.16 (s), 64.85 (s), 57.88 (s), 55.93 (s), 53.97 (s), 35.94 (s), 35.13 (s), 34.64 (s), 34.20 (d, J = 10.5 Hz), 31.80 (d, J = 13.7 Hz), 31.50 (s), 29.52 (d, J = 2.9 Hz), 29.34–28.92 (m), 27.08 (d, J = 3.9 Hz), 26.10 (s), 25.33 (s), 25.05 (s), 24.82 (s), 22.64 (d, J = 6.5 Hz), 14.11 (s).

[0854] T. Compound SW-II-139-2

[0855]

[0856] 1. Synthesis of Compound 3

[0857]

[0858] To a mixture of Compound 1 (1 g, 4.37 mmol, 1 eq.) and Compound 2 (668 g, 6.55 mmol, 1.5 eq) in 1,4-dioxane / water (10 mL / 1 mL) was added Pd(dtbpf)Cl 2(286 mg, 0.437 mmol, 0.1 eq.) and potassium carbonate (1.8 g, 13.11 mmol, 3 eq.). The mixture was stirred overnight at 100 °C under nitrogen. TLC (PE / EA = 20 / 1) showed the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 20 / 1) to give the compound 3 (605 mg, 67%) as a colorless oil.

[0859] 2. Synthesis of Compound 4

[0860]

[0861] At 0 °C under nitrogen atmosphere, lithium aluminum hydride (3 mL, 2.94 mmol, 1 M in THF, 1 eq.) was added to a mixture of compound 3 (605 mg, 2.94 mmol, 1 eq.) in THF (7 mL). The mixture was stirred at room temperature for 3 h. TLC (PE / EA = 5 / 1) indicated the reaction was complete and a new major spot was observed. The mixture was quenched with water (3 mL) and treated with 2 N hydrochloric acid to adjust the pH between 6 and 7, extracted with ethyl acetate and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to give the compound 4 (534 mg, >100%) as a colorless oil without further purification.

[0862] 3. Synthesis of Compound 6

[0863]

[0864] EDCI (937 mg, 4.88 mmol, 2 eq.) and DMAP (119 mg, 0.976 mmol, 0.4 eq.) were added to a mixture of compound 4 (434 mg, 2.44 mmol, 1 eq.) and compound 5 (652 mg, 2.93 mmol, 1.2 eq.) in DCM (5 mL), and then DIEA (1.259 g, 9.76 mmol, 4 eq.) was added. The reaction mixture was stirred at room temperature under nitrogen for 16 h. TLC (petroleum ether / ethyl acetate = 15 / 1) showed the formation of the desired product. The reaction mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (1 / 0 - 20 / 1) to give the compound 6 (355 mg, 38%).

[0865] 4. Synthesis of SW-II-139-2

[0866]

[0867] To a mixture of compound 6 (122 mg, 0.319 mmol, 1 eq.) and compound 7 (140 mg, 0.319 mmol, 1 eq.) in CPME / CH 3 CN (2 mL / 2 mL) was added potassium carbonate (220 mg, 1.595 mmol, 5 eq.) and potassium iodide (106 mg, 0.638 mmol, 2 eq.). After addition, the mixture was stirred overnight at 90 °C under nitrogen. TLC (DCM / MeOH = 10 / 1) showed completion of the reaction and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1 / 0 - 10:1, v / v) to afford compound SW-II-139-2 as a yellow oil (45.48 mg, 19%).

[0868] LCMS: Rt: 1.346 min; MS m / z (ELSD): 744.3 [M+H] + ;

[0869] HPLC: 97.994% purity, ELSD; RT = 11.235 min.

[0870] 1 H NMR (400 MHz, CDCl 3 ) δ 7.20 (t, J = 7.8 Hz, 1H), 7.03 (t, J = 7.6 Hz, 3H), 4.91–4.81 (m, 1H), 4.27 (t, J = 7.2 Hz, 2H), 3.89–3.75 (m, 2H), 2.99–2.79 (m, 7H), 2.64–2.48 (m, 2H), 2.28 (td, J = 7.5, 3.1 Hz, 4H), 1.74–1.08 (m, 53H), 0.90 (dt, J = 13.6, 7.2 Hz, 9H).

[0871] 13 C NMR (101 MHz, CDCl 3)δ173.60(d,J=11.7Hz),143.13(s),137.65(s),129.06(s),128.34(s),126.64(s),126.11(s),77.30(d,J=11.4Hz),77.04(s),76.72(s),74.22(s),64.88(s),57.28(s),56.55(s),54.11(s),35.60(s),35.12(s),34.56(s),34.15(d,J=4.0Hz),33.68(s),31.86(s),29.52(d,J=2.8Hz),29.24(s),28.91(dd,J=7.0,4.2Hz),26.81(d,J=3.9Hz),25.33(s),25.12–24.98(m),24.83(d,J=22.2Hz),22.67(s),22.40(s),14.04(d,J=14.4Hz).

[0872] U. Compound SW-II-140-1

[0873]

[0874] 1. Synthesis of Compound 3

[0875]

[0876] To a mixture of Compound 1 (1 g, 4.37 mmol, 1 eq.) and Compound 2 (852 g, 6.55 mmol, 1.5 eq) in 1,4-dioxane / water (10 mL / 1 mL) was added Pd(dppf)Cl 2 (286 mg, 0.437 mmol, 0.1 eq.) and potassium carbonate (1.8 g, 13.11 mmol, 3 eq). The mixture was stirred overnight at 100 °C under nitrogen. TLC (PE / EA = 20 / 1) showed the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 20 / 1) to give Compound 3 as a colorless oil (748 mg, 73%).

[0877] 2. Synthesis of Compound 4

[0878]

[0879] At 0 °C and under a nitrogen atmosphere, lithium aluminum hydride (3.2 mL, 3.2 mmol, 1 M in THF, 1 eq.) was added to a mixture of compound 3 (748 mg, 3.2 mmol, 1 eq.) in THF (8 mL). The mixture was stirred at room temperature for 3 hours. TLC (PE / EA = 5 / 1) indicated the completion of the reaction and a new major spot was observed. The mixture was quenched with water (3 mL) and treated with 2 N hydrochloric acid to adjust the pH between 6 and 7, extracted with ethyl acetate and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to give compound 4 (493 mg, 75%) as a colorless oil, without further purification.

[0880] 3. Synthesis of Compound 6

[0881]

[0882] EDCI (733 mg, 3.82 mmol, 2 eq.) and DMAP (93 mg, 0.76 mmol, 0.4 eq.) were added to a mixture of compound 4 (393 mg, 1.91 mmol, 1 eq.) and compound 5 (511 mg, 2.29 mmol, 1.2 eq.) in DCM (5 mL), and then DIEA (986 mg, 7.64 mmol, 4 eq.) was added. The reaction mixture was stirred at room temperature under nitrogen for 16 hours. TLC (petroleum ether / ethyl acetate = 15 / 1) showed the formation of the desired product. The reaction mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (1 / 0 - 20 / 1) to give compound 6 (327 mg, 42%) as a colorless oil.

[0883] 4. Synthesis of SW-II-140-1

[0884]

[0885] To a mixture of compound 6 (150 mg, 0.365 mmol, 1 eq.) and compound 7 (161 mg, 0.365 mmol, 1 eq.) in CPME / CH 3Potassium carbonate (302 mg, 2.19 mmol, 6 eq.) and potassium iodide (121 mg, 0.73 mmol, 2 eq.) were added to the mixture in CN (2 mL / 2 mL). After the addition, the mixture was stirred under nitrogen at 90 °C overnight. TLC (DCM / MeOH = 10 / 1) showed the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1 / 0 - 10:1, v / v) to give the compound SW-II-140-1 as a yellow oil (180 mg, 64%).

[0886] LCMS: Rt: 1.568 min; MS m / z (ELSD): 772.4 [M+H] + ;

[0887] HPLC: 98.053% purity, ELSD; RT = 8.702 min.

[0888] 1 H NMR (400 MHz, CDCl 3 ) δ 7.23–7.05 (m, 4H), 4.95–4.79 (m, 1H), 4.25 (t, J = 7.4 Hz, 2H), 3.62 (t, J = 4.8 Hz, 2H), 2.96 (dd, J = 15.4, 8.0 Hz, 2H), 2.74–2.49 (m, 8H), 2.28 (dd, J = 14.2, 7.2 Hz, 4H), 1.67–1.44 (m, 14H), 1.41–1.20 (m, 42H), 0.90 (dt, J = 13.2, 7.1 Hz, 9H).

[0889] 13 C NMR (101 MHz, CDCl 3)δ173.68(d,J=10.2Hz),141.26(s),135.23(s),129.73(s),129.37(s),126.72(s),125.92(s),77.35(s),77.03(s),76.71(s),74.17(s),64.52(s),57.99(s),55.87(s),53.94(s),34.66(s),34.21(d,J=11.5Hz),32.75(s),31.83(d,J=9.8Hz),31.32(s),29.65–28.88(m),27.15(d,J=3.7Hz),26.35(s),25.33(s),25.07(s),24.83(s),22.66(d,J=3.4Hz),14.12(s).

[0890] V.SW-II-140-2

[0891]

[0892] 1. Synthesis of Compound 3

[0893]

[0894] To a mixture of Compound 1 (1 g, 4.37 mmol, 1 eq.) and Compound 2 (668 g, 6.55 mmol, 1.5 eq) in 1,4-dioxane / water (10 mL / 1 mL) was added Pd(dppf)Cl 2 (286 mg, 0.437 mmol, 0.1 eq.) and potassium carbonate (1.8 g, 13.11 mmol, 3 eq). The mixture was stirred overnight at 100 °C under nitrogen. TLC (PE / EA = 20 / 1) showed the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0 - 20 / 1) to give Compound 3 as a colorless oil (406 mg, 45%).

[0895] 2. Synthesis of Compound 4

[0896]

[0897] At 0 °C and under a nitrogen atmosphere, lithium aluminum hydride (2 mL, 1.97 mmol, 1 M in THF, 1 eq.) was added to a mixture of compound 3 (406 mg, 1.97 mmol, 1 eq.) in THF (5 mL). The mixture was stirred at room temperature for 3 hours. TLC (PE / EA = 5 / 1) indicated the completion of the reaction and a new major spot was observed. The mixture was quenched with water (2 mL) and treated with 2 N hydrochloric acid to adjust the pH between 6 and 7, extracted with ethyl acetate and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to give compound 4 as a colorless oil (341 mg, 97%) without further purification.

[0898] 3. Synthesis of Compound 6

[0899]

[0900] EDCI (518 mg, 2.7 mmol, 2 eq.) and DMAP (66 mg, 0.54 mmol, 0.4 eq.) were added to a mixture of compound 4 (241 mg, 1.35 mmol, 1 eq.) and compound 5 (361 mg, 1.62 mmol, 1.2 eq.) in DCM (3 mL), and then DIEA (697 mg, 5.4 mmol, 4 eq.) was added. The reaction mixture was stirred at room temperature under nitrogen for 16 hours. TLC (petroleum ether / ethyl acetate = 15 / 1) showed the formation of the desired product. The reaction mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (1 / 0 - 20 / 1) to give compound 6 as a colorless oil (185 mg, 32%).

[0901] 4. Synthesis of SW-II-140-2

[0902]

[0903] To a mixture of compound 6 (185 mg, 0.483 mmol, 1 eq.) and compound 7 (213 mg, 0.483 mmol, 1 eq.) in CPME / CH 3Potassium carbonate (400 mg, 2.898 mmol, 6 eq.) and potassium iodide (160 mg, 0.966 mmol, 2 eq.) were added to the mixture in CN (2 mL / 2 mL). After the addition, the mixture was stirred under nitrogen at 90 °C overnight. TLC (DCM / MeOH = 10 / 1) showed the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1 / 0 - 10:1, v / v) to give the compound SW-II-140-2 as a yellow oil (161 mg, 45%).

[0904] LCMS: Rt: 1.696 min; MS m / z (ELSD): 744.3 [M+H] + ;

[0905] HPLC: 94.658% purity, ELSD; RT = 5.938 min.

[0906] 1 H NMR (400 MHz, CDCl 3 ) δ 7.22–7.03 (m, 4H), 4.94–4.78 (m, 1H), 4.25 (t, J = 7.3 Hz, 2H), 3.70–3.54 (m, 2H), 2.96 (t, J = 7.4 Hz, 2H), 2.77–2.41 (m, 8H), 2.28 (dd, J = 14.3, 7.1 Hz, 4H), 1.65–1.18 (m, 52H), 0.91 (dt, J = 13.3, 7.1 Hz, 9H).

[0907] 13 C NMR (101 MHz, CDCl 3)δ173.67(d, J = 10.8 Hz), 141.22(s), 135.23(s), 129.73(s), 129.39(s), 126.72(s), 125.92(s), 77.36(s), 77.04(s), 76.72(s), 74.17(s), 64.52(s), 57.92(s), 55.92(s), 53.96(s), 34.66(s), 34.21(d, J = 11.2 Hz), 33.51(s), 32.44(s), 31.83(d, J = 9.3 Hz), 29.53(d, J = 2.9 Hz), 29.14(dd, J = 11.3, 8.5 Hz), 27.12(d, J = 4.1 Hz), 26.23(s), 25.33(s), 25.06(s), 24.82(s), 22.73(d, J = 9.9 Hz), 14.08(d, J = 8.8 Hz).

[0908] Example 2. Gene Cloning of Plasmids Containing Different 3'-UTR Elements and Internal Reference Control Plasmids

[0909] The plasmids containing different 3'-UTR elements are as follows: Different 3'-UTR elements (sequences shown in SEQ ID NO: 1 - 43) are cloned into the middle region between the stop codon downstream of the reporter gene Firefly Luciferase and the poly(A) sequence by means of gene homologous recombination, that is, the 3'-UTR region shown in Figure 1, and the rest are the same. The plasmid containing only the poly(A) sequence after the stop codon downstream of Firefly Luciferase and without the tested 3'-UTR element is used as a reference construct. Figure 2 shows an exemplary test artificial nucleic acid molecule (SEQ ID NO: 99, where the exemplary 3'-UTR element is SEQ ID NO: 1), and the underlined part is the tested 3'-UTR element. Except for the underlined element, all elements of this sequence shown in Figure 2 are the same as the reference artificial nucleic acid molecule (SEQ ID NO: 100). Therefore, the difference between SEQ ID NO: 99 and SEQ ID NO: 100 is only that there are different tested 3'-UTR elements before the poly(A) sequence.

[0910] The internal reference control plasmid is: The reporter gene Firefly Luciferase is replaced with the renilla luciferase gene (Rluc), and the other sequences of the plasmid are the same.

[0911] The plasmids containing different 3'-UTR elements and the internal reference control plasmid are synthesized by Shanghai Sangon Biotech Co., Ltd. through total gene synthesis.

[0912] A pair of primers (upstream universal primer: 5’TTGGACCCTCGTACAGAAGCTAATACG 3’; and downstream specific complementary long primer carrying poly(T)) and a PCR amplification kit based on high-fidelity DNA polymerase (Novoprotein Scientific Inc.) were used for PCR amplification to obtain a DNA template.

[0913] Example 3. Preparation of mRNA

[0914] Using the purified (Takara purification kit) PCR product prepared in Example 2 as a template, a co-transcriptional capping reaction was carried out using T7 RNA polymerase for in vitro transcription of RNA, thereby generating Cap1 mRNA. 1-Methyl-pseudouridine-triphosphate was added instead of uridine triphosphate (UTP) during in vitro transcription. Therefore, the modification ratio of 1-methyl-pseudouracil in the in vitro transcribed Cap1 mRNA was 100%. After the transcription was completed, DNase I (Thermo Fisher Scientific Inc.) was used to digest the DNA template to reduce the risk brought by the residual DNA template. Dynabeads Myone (Thermo Fisher Scientific Inc.) was used to purify the mRNA. The purified mRNA was dissolved in 1 mM sodium citrate buffer (pH 6.5 + / - 0.1), sterile filtered, and stored frozen at -80 °C until use.

[0915] Example 4. Cellular expression verification of the effect of candidate 3'-UTR elements on reporter genes

[0916] HEK-293 cells in good growth state were seeded into a 96-well cell culture plate at a seeding density of 3.5×10 4 cells / well, and then placed in a 37 °C cell culture incubator for 18 - 24 hours. Using Lipofectamine Messenger MAX reagent (Thermo Fisher), the mRNA of the plasmid containing the reporter gene firefly luciferase and the mRNA of the internal reference control plasmid containing the reporter gene sea pansy luciferase in Example 3 were co-transfected into HEK293 cells in the 96-well plate at an mRNA mass ratio of 2:1 per well (a total of 100 ng mRNA), and three replicates were set for each sample. The cell plate transfected with mRNA was placed in a 37 °C, 5% CO 2 cell culture incubator for 24 hours.

[0917] The transfected cell samples were detected using a dual-luciferase reporter gene assay kit (Vazyme, DL101-01). First, pretreatment was carried out. The cell lysate was added to a 96-well cell plate at 100 μL / well. Then, 14 μL of the lysed cell supernatant was carefully aspirated and transferred to a 96-well black microplate. Next, 70 μL of the firefly luciferase substrate equilibrated to room temperature was added to the microplate. After rapid mixing, an enzyme-linked immunosorbent assay (ELISA) reader (BioTek) was immediately used. After shaking the plate for 10 seconds, the relative light unit (RLU) value of firefly luciferase was detected at a wavelength of 560 nm. After the detection was completed, 70 μL of the freshly prepared Renilla luciferase substrate working solution was added to the above reaction solution. After rapid mixing, an ELISA reader (BioTek) was immediately used, and the RLU value of Renilla luciferase was detected at a wavelength of 480 nm. The actual report for each well was the ratio of the RLU of firefly luciferase (Fluc) to the RLU of Renilla luciferase (Rluc) in each well (Fluc / Rluc). During data analysis, the Fluc / Rluc of the artificial nucleic acid molecule containing only the poly(A) sequence was used as the reference nucleic acid molecule, and the ratio of the Fluc / Rluc of the artificial nucleic acid molecule containing different 3'-UTR elements to be tested relative to the reference was the final relative expression level. According to the results of three independent repeated experiments, the effects of different 3'-UTR elements on the expression of the reporter gene were analyzed, a statistical histogram was drawn, and statistical analysis was performed.

[0918] The experimental results are shown in Figure 3 and Table 2. The translation efficiency of most of the artificial nucleic acid molecules containing the 3'-UTR elements to be tested was higher than that of the reference nucleic acid molecule. Among them, the relative expression levels of the artificial nucleic acid molecules containing the 3'-UTR elements (SEQ ID NO: 1-16) numbered U3006, U3008, U3009, U3010, U3011, U3016, U3020, U3030, U3051, U3053, U3055, U3056, U3057, U3058, U3060, and U3067 were greater than 1.9, indicating higher translation efficiency.

[0919] Table 2. Results of cell expression verification

[0920]

[0921]

[0922] Example 5. Preparation of LPP preparation

[0923] 5.1. Experimental materials

[0924] The cationic lipid SW-II-140-2 was synthesized by Shanghai MicroLife Sciences Co., Ltd.; the helper phospholipid (DOPE) was purchased from CordenPharma; cholesterol was purchased from Sigma-Aldrich; mPEG2000-DMG (i.e., DMG-PEG 2000) was purchased from Avanti Polar Lipids, Inc.; PBS was purchased from Invitrogen; protamine sulfate was purchased from Beijing Siliang Pharmaceutical Co., Ltd.

[0925] 5.2. Preparation of Lipid-Polymeric Complexes (LPPs) of mRNA

[0926] Preparation of the nucleic acid aqueous solution: Each mRNA prepared as in Example 3 was diluted with 10 mM citric acid-sodium citrate buffer (pH 4.0) to an mRNA solution of 0.2 mg / mL.

[0927] Preparation of the lipid solution: SW-II-140-2:DOPE:cholesterol:mPEG2000-DMG was dissolved in an ethanol solution at a molar ratio of 40:15:43.5:1.5 to prepare a lipid solution of 10 mg / mL.

[0928] Preparation of the protamine sulfate solution: Protamine sulfate was dissolved in nuclease-free water to prepare a protamine sulfate solution with a working concentration of 0.25 mg / mL.

[0929] Preparation of the core nanoparticle solution: Using microfluidic technology (Shanghai Myan Technology Co., Ltd., model: Inano D), the protamine sulfate solution was mixed with the nucleic acid solution under the following conditions to obtain a core nanoparticle solution formed by protamine and artificial nucleic acid molecules: volume = 4.0 mL; flow rate ratio = 5 (mRNA):1 (protamine sulfate solution), total flow rate = 12 mL / min, start waste = 0.35 mL, end waste = 0.1 mL, room temperature.

[0930] Preparation of LPP: The core nanoparticle solution was secondarily mixed with the lipid solution under the following conditions: volume = 4.0 mL, flow rate ratio = 3 (lipid solution):1 (core nanoparticle solution), total flow rate = 12 mL / min, start waste = 0.35 mL, end waste = 0.1 mL, room temperature, to obtain an LPP solution.

[0931] Centrifugal ultrafiltration: The LPP solution was ultrafiltered by centrifugation to remove ethanol (centrifugal force 3000 g, centrifugation time 60 min, temperature 4°C) to obtain an LPP preparation containing different artificial nucleic acid molecules at 0.1 mg / ml.

[0932] Those skilled in the art will appreciate that many modifications and variations of the present invention can be made without departing from its spirit and scope. The specific embodiments described herein are provided by way of example only and are not meant to limit in any way. The true scope and spirit of the present invention are shown by the appended claims, and the specification and examples are merely exemplary.

[0933] SEQUENCE LISTING

[0934]

[0935]

[0936]

[0937]

[0938]

[0939]

[0940]

[0941]

[0942]

[0943]

[0944]

[0945]

Claims

An artificial nucleic acid molecule comprising: a. at least one open reading frame (ORF); and b. at least one 3'-untranslated region element (3'-UTR element), said 3'-UTR element comprising a nucleic acid sequence selected from the following: (i) wherein the 3'-UTR element comprises a variant of the nucleic acid sequence shown in SEQ ID NO: 44, which variant, compared to the nucleic acid sequence shown in SEQ ID NO: 44, comprises truncation, terminal extension and / or 1, 2, 3 or more mutations, additions or deletions; or (ii) wherein the 3'-UTR element comprises the nucleic acid sequence of the 3'-UTR of a transcript derived from the following genes: HCV, CoV2, CVB3, AES and AAT, or a variant thereof, which variant, compared to the nucleic acid sequence from which it is derived, comprises truncation, terminal extension and / or 1, 2, 3 or more mutations, additions or deletions; or (iii) wherein the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 16; or the corresponding RNA sequence of the above nucleic acid sequences. The artificial nucleic acid molecule of claim 1, wherein the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:

3. The artificial nucleic acid molecule of claim 2, wherein the 3'-UTR element further comprises the nucleic acid sequence of SEQ ID NO:

92. The artificial nucleic acid molecule of claim 3, wherein the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:

4. The artificial nucleic acid molecule of claim 1, wherein the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 44 and further comprises the nucleic acid sequence of SEQ ID NO: 90, 91 or 93. The artificial nucleic acid molecule of claim 5, wherein the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 1, 2 or 5. The artificial nucleic acid molecule of claim 1, wherein the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of a transcript of the following viral genes: HCV, CoV2 and CVB3; or the nucleic acid sequence of the 3'-UTR of a transcript derived from the mouse gene AES; or the nucleic acid sequence of the 3'-UTR of a transcript derived from the human gene AAT; or the nucleic acid sequence of the 3'-UTR of a transcript derived from the bovine gene AES, wherein the variant, compared to the nucleic acid sequence from which it is derived, comprises truncation, terminal extension and / or 1, 2, 3 or more mutations, additions or deletions. The artificial nucleic acid molecule of claim 7, wherein the 3'-UTR element has a length of 3 - 500 nucleotides, preferably 5 - 250 nucleotides, more preferably 90 - 215 nucleotides. The artificial nucleic acid molecule of claim 8, wherein the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 6, 7, 8, 9 or 12. The artificial nucleic acid molecule of claim 9, wherein the 3'-UTR element further comprises the nucleic acid sequence of SEQ ID NO:

92. The artificial nucleic acid molecule of claim 10, wherein the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 10, 14 or 15. The artificial nucleic acid molecule of claim 9, wherein the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 12 and further comprises the nucleic acid sequence of SEQ ID NO: 9 or 94. The artificial nucleic acid molecule of claim 12, wherein the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 11 or 13. The artificial nucleic acid molecule of any one of claims 1-13, which further comprises at least one 5'-untranslated region element (5'-UTR element). The artificial nucleic acid molecule of claim 14, wherein the 5'-UTR element comprises the nucleic acid sequence of SEQ ID NO:

45. The artificial nucleic acid molecule of any one of claims 1-15, which further comprises a 5' cap structure, a polycytidylic acid sequence, a polyadenylic acid sequence and / or a histone stem-loop; preferably, the artificial nucleic acid molecule comprises a polyadenylic acid sequence; preferably, the polyadenylic acid sequence comprises the nucleic acid sequence of SEQ ID NO:

46. The artificial nucleic acid molecule of any one of claims 1-16, wherein the ORF is codon-optimized. The artificial nucleic acid molecule of any one of claims 1-17, which is RNA, preferably mRNA. The artificial nucleic acid molecule of claim 18, wherein the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO: 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 or 62. A vector comprising the artificial nucleic acid molecule of any one of claims 1-19. The vector of claim 20, which is a DNA vector. The vector of claim 20 or 21, which is a plasmid vector or a viral vector, preferably a plasmid vector. The vector of any one of claims 20-22, which is a circular molecule. A cell comprising the artificial nucleic acid molecule of any one of claims 1-19 or the vector of any one of claims 20-23. The cell of claim 24, which is a mammalian cell; preferably a cell isolated from a human subject. A lipid composition comprising the artificial nucleic acid molecule of any one of claims 1-19 and a lipid encapsulating the artificial nucleic acid molecule, wherein the lipid encapsulating the artificial nucleic acid molecule comprises a cationic lipid, a phospholipid, a steroid and a polyethylene glycol-modified lipid; the lipid composition further comprises a cationic polymer, wherein the cationic polymer associates with the artificial nucleic acid molecule to form a complex and is co-encapsulated in the lipid to form a lipid-polymer complex. The lipid composition of claim 26, wherein the cationic lipid comprises a compound of formula (I) or a pharmaceutically acceptable salt thereof wherein, R 1 and R 2 Each independently selected from a bond, C 1 -C 12 Alkyl and C 2 -C 12 Alkenyl; R 3 and R 4 Each independently selected from C 1 -C 12 Alkyl, C 2 -C 12 Alkenyl, C 6 -C 10 aryl and 5-10 membered heteroaryl; and R 3 and R 4 Each independently selected by t R 6 substituted, t is an integer selected from 1-5; R 6 Each independently selected from C 1 -C 12 Alkyl and C 2 -C 12 Alkenyl; M 1 and M 2 Each is independently selected from a bond, H, -O-, -S-, -C(O)-, -OC(O)-, -C(O)O-, -OC(O)O-, -SC(S)-, -C(S)S-, a 3-10 membered heterocycle, -NR 7 -, or R 5 With M 1 and M 2 One of them together with the nitrogen atom to which it is connected forms a 3-10 membered heterocyclic ring, and the corresponding R 1 / R 3 or R 2 / R 4 is not present, the heterocyclic ring is optionally replaced by R 7 Replacement; R 5 Selected from C 3-8 Carbon ring, -C 1-12 Alkylene-Q, Q is selected from H, -OR 7 、-SR 7 、-OC(O)R 7 、-C(O)OR 7 、 -N(R 7 )C(O)R 7 、-N(R 7 )S(O) 2 R 7 、-N(R 7 )C(S)R 7 、-N(R 7 ) 2 , cyano, C 3-8 Carbocyclic ring, 3-10 membered heterocyclic ring, C 6 -C 10 aryl, each of the above groups is optionally substituted by one or more C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, C 6 -C 10 aryl, 5-10 membered heteroaryl, 3-10 membered heterocycle, halogen, hydroxy, oxo(=O); m and n are each independently an integer selected from 0-12; each of said alkyl, alkenyl and alkylene is optionally and independently interrupted by one or more groups selected from: -O-, -S-, -NR 7 -, -C(O)-, -OC(O)-, -C(O)O-, -SC(S)-, -C(S)S-, C 3-8 carbocycle, and each of said alkyl, alkenyl and alkylene is optionally substituted by one or more R 7 ; R 7 are each independently selected from H, C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C 6 -C 10 aryl, 5-10 membered heteroaryl, 3-10 membered heterocycle, halogen, C 3-8 carbocycle, each of the above groups is optionally substituted by one or more C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, C 6 -C 10 aryl, 5-10 membered heteroaryl, 3-10 membered heterocycle, halogen, hydroxy, oxo(=O). The lipid composition of claim 27, wherein, R 1 and R 2 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl; wherein R 3 and R 4 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl; and R 3 and R 4 are each independently optionally substituted with t R 6 , where t is an integer selected from 1 - 5; R 6 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl. M 1 and M 2 are each independently selected from -OC(O)-, -C(O)O-, -OC(O)O-, -SC(S)- and -C(S)S-; R 5 is selected from -C 1-12 alkylene-Q, where Q is selected from -OR 7 and -SR 7 , and R 7 is independently selected from H, C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C 6 -C 10 aryl and 5 - 10 membered heteroaryl; m and n are each independently an integer selected from 1 - 12. The lipid composition of claim 27, wherein the cationic lipid comprises a lipid compound having the structure shown below or a pharmaceutically acceptable salt thereof: The lipid composition of claim 27, wherein the cationic lipid comprises a lipid compound having the structure shown below or a pharmaceutically acceptable salt thereof: The lipid composition of claim 27, wherein the cationic lipid comprises a lipid compound having the structure shown below or a pharmaceutically acceptable salt thereof The lipid composition of claim 27, wherein, R 1 and R 2 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl; R 3 and R 4 are each independently selected from C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 6 -C 10 aryl and 5- to 10-membered heteroaryl; provided that at least one of R 3 and R 4 is C 6 -C 10 aryl or 5- to 10-membered heteroaryl, and R 3 and R 4 are each independently optionally substituted with t R 6 groups, where t is an integer selected from 1-5; R 6 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl; M 1 and M 2 are each independently selected from -OC(O)-, -C(O)O-, -OC(O)O-, -SC(S)- and -C(S)S-; R 5 is selected from -C 1-12 alkylene-Q, where Q is selected from -OR 7 and -SR 7 groups, and R 7 is independently selected from H, C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C 6 -C 10 aryl and 5- to 10-membered heteroaryl; m and n are each independently an integer selected from 1-12. The lipid composition of claim 32, wherein, R 1 and R 2 each independently selected from C 1 -C 12 alkyl groups. The lipid composition of claim 32 or 33, wherein, R 3 and R 4 each independently selected from C 1 -C 12 alkyl and C 6 -C 10 aryl; provided that one of R 3 and R 4 is C 6 -C 10 aryl and the other is C 1 -C 12 alkyl; R 3 and R 4 are each independently substituted with t R 6 where t is an integer selected from 1 - 3; R 6 are each independently selected from C 1 -C 12 alkyl. The lipid composition according to any one of claims 32-34, wherein, M 1 and M 2 each independently selected from: -OC(O)-, -C(O)O-, and -OC(O)O-. The lipid composition according to any one of claims 32-35, wherein, R 5 selected from -C 1-5 alkylene - Q, where Q is -OH. The lipid composition according to any one of claims 32-36, wherein, m and n are each independently an integer selected from 2-7. The lipid composition according to any one of claims 32-37, wherein, R 4 at the 1-position or the terminal position of R 2 ; and / or R 3 at the 1-position or the terminal position of R 1 . The lipid composition according to any one of claims 32-38, wherein, t is 1 or 2, R 6 is substituted on the benzene ring relative to R 1 or R 2 at the meta and / or para positions. The lipid composition according to any one of claims 32-39, wherein, t is 1 or 2, R 6 each independently selected from C 1 -C 10 alkyl group. The lipid composition according to any one of claims 32-40, wherein the cationic lipid comprises a compound of formula (II), or a pharmaceutically acceptable salt thereof: wherein R 1 , R 2 , R 4 , R 5 , R 6 , M 1 , M 2 , t, m and n are as defined in any one of claims 32 - 40; preferably, in formula (II), R 1 is selected from C 1 -C 6 alkyl; R 2 is selected from C 1 -C 10 alkyl; R 4 is selected from C 1 -C 10 alkyl; M 1 and M 2 are each independently selected from: -OC(O)-, -C(O)O- and -OC(O)O-; R 5 is selected from -C 1-5 alkylene-Q, Q is selected from -OR 7 and -SR 7 , R 7 is independently selected from H, C 1 -C 12 alkyl and C 2 -C 12 alkenyl; m and n are each independently an integer selected from 2 - 9; t is an integer selected from 1 - 3; R 6 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl. The lipid composition according to any one of claims 32-40, wherein the cationic lipid comprises a compound of formula (III), or a pharmaceutically acceptable salt thereof: wherein R 1 , R 2 , R 4 , R 5 , R 6 , t, m and n are as defined in any one of claims 32 - 40; preferably, in formula (III), R 1 is selected from C 1 -C 6 alkyl; R 2 is selected from C 1 -C 10 alkyl; R 4 is selected from C 1 -C 10 alkyl; R 5 is selected from -C 1-3 alkylene-Q, Q is selected from -OH and -SH; t is 1 or 2; R 6 is selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl; m and n are each independently an integer selected from 2 - 7. The lipid composition according to any one of claims 32-40, wherein the cationic lipid comprises a compound of formula (IV), or a pharmaceutically acceptable salt thereof: wherein R 1 , R 2 , R 4 , R 6 , t, m and n are as defined in any one of claims 32 - 40; preferably, in formula (IV), R 1 is selected from C 1 -C 6 alkyl; R 2 is selected from C 1 -C 10 alkyl; R 4 is selected from C 1 -C 10 alkyl; t is 1 or 2; R 6 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl; m and n are each independently an integer selected from 2 - 7. The lipid composition of claim 32, wherein the cationic lipid comprises a lipid compound having the structure shown below or a pharmaceutically acceptable salt thereof: Preferably, the cationic lipid is SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2. A lipid composition according to any one of claims 27-44, wherein the phospholipid comprises 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-doundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesteryl succinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), palmitoyl oleoyl phosphatidylethanolamine (POPE), distearoyl-phosphatidylethanolamine (DSPE), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoyl phosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-stearoylethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyl oleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE) or a combination thereof; preferably DSPC, DOPE or a combination thereof. The lipid composition of claim 45, wherein the steroid comprises cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, α-tocopherol and derivatives thereof; preferably, the steroid is cholesterol. The lipid composition of claim 46, wherein the polyethylene glycol-modified lipid comprises 1,2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol (DMG-PEG), 1,2-dioleoyl-rac-glycerol, methoxy-polyethylene glycol (DOGPEG), and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-poly(ethylene glycol) (DSPE-PEG); preferably DSPE-PEG, DMG-PEG, or a combination thereof. The lipid composition of claim 47, which comprises 10-70 mol% of a cationic lipid, 10-70 mol% of a phospholipid, 10-70 mol% of a steroid, and 0.05-20 mol% of a polyethylene glycol-modified lipid; preferably comprises 35-50 mol% of a cationic lipid, 10-30 mol% of a phospholipid, 24-44 mol% of a steroid, and 1-1.5 mol% of a polyethylene glycol-modified lipid; and / or a cationic lipid, DOPE, cholesterol, and DMG-PEG; preferably comprises 50 mol% of a cationic lipid, 10 mol% of DOPE, 38.5 mol% of cholesterol, and 1.5 mol% of DMG-PEG or 40 mol% of a cationic lipid, 15 mol% of DOPE, 43.5 mol% of cholesterol, and 1.5 mol% of DMG-PEG. The lipid composition of claim 48, wherein the cationic polymer comprises poly-L-lysine, protamine, polyethyleneimine (PEI), or a combination thereof; preferably, the cationic polymer is protamine. A pharmaceutical composition comprising an artificial nucleic acid molecule according to any one of claims 1-19, a carrier according to any one of claims 20-23, a cell according to claim 24 or 25, or a lipid composition according to any one of claims 26-49, and a pharmaceutically acceptable carrier. Use of an artificial nucleic acid molecule according to any one of claims 1-19, a carrier according to any one of claims 20-23, a cell according to claim 24 or 25, or a lipid composition according to any one of claims 26-49, or a pharmaceutical composition according to claim 50, in the preparation of a vaccine or a medicament for gene therapy. Use of an artificial nucleic acid molecule according to any one of claims 1-19, a carrier according to any one of claims 20-23, a cell according to claim 24 or 25, or a lipid composition according to any one of claims 26-49, or a pharmaceutical composition according to claim 50, in the preparation of a medicament for the treatment or prevention of a disease. A method for increasing the translation efficiency of an artificial nucleic acid molecule, preferably an mRNA molecule, or a carrier, the method comprising ligating an open reading frame to a 3'-UTR element as defined in any one of claims 1-19. A kit comprising an artificial nucleic acid molecule according to any one of claims 1-19, a carrier according to any one of claims 20-23, a cell according to claim 24 or 25, or a lipid composition according to any one of claims 26-49, or a pharmaceutical composition according to claim 50. A method for producing an artificial nucleic acid molecule, the method comprises: a) Synthesize the artificial nucleic acid molecule according to any one of claims 1-19; or b) Synthesize the artificial nucleic acid molecule by means of the vector according to any one of claims 20-23.

Images