African swine fever virus antigen fragment and application thereof as target in subunit vaccine and diagnostic antigen
By truncating the expression of the P30 protein of African swine fever virus in segments and screening out the fifth peptide segment as an antigen fragment, solving the problem of difficult to obtain the dominant epitope of the humoral immune response of P30 protein in the prior art, and achieving efficient immunity and diagnosis of African swine fever virus.
Patent Information
- Application Number
- CN202510326765.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-19
- Publication Date
- 2025-06-06
AI Technical Summary
The prior art is difficult to accurately and comprehensively obtain the dominant epitope of the humoral immune response of the African swine fever virus P30 protein, resulting in inefficiency and insufficient specificity of vaccines and diagnostic methods for the disease.
By performing segmented truncation of P30 protein expression, the 5th peptide (101-130aa) was screened as an antigen fragment with significant immune advantages and applied to subunit vaccines and diagnostic antigens.
The successful screening of P30 protein truncated peptides with significant immune advantages significantly improved the immune response and diagnostic accuracy to the African swine fever virus, and provided an important basis for the development of a new generation of ASFV subunit vaccine.
Smart Images
Figure CN120098091A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of African swine fever virus prevention and treatment, and specifically relates to an African swine fever virus antigen fragment and its application as a target in subunit vaccines and diagnostic antigens. Background Art
[0002] African swine fever (ASF) was first discovered in Africa in 1921 and is currently prevalent in many countries and regions in Asia and Europe. The disease is caused by infection with the African swine fever virus (ASFV), which mainly infects domestic pigs and wild boars. The mortality rate of strong strains is close to 100%, and it is known as the "Ebola" of pigs, causing great impact and losses to the world's pig industry. In 2007, ASFV genotype II was introduced into the Caucasus region of Europe and spread widely. my country has classified this disease as a Class I animal disease, and the World Organisation for Animal Health (WOAH) has listed it as a reportable animal disease. There is currently no commercial vaccine or specific treatment for African swine fever.
[0003] The P30 protein encoded by the ASFV CP204L gene is located in the viral inner envelope, can persist throughout the infection cycle, and has high antigenicity. Studies have found that antibodies against the P30 protein can be detected on the eighth day after pigs are infected with ASFV. Therefore, the P30 protein has become an important target protein for diagnosis and subunit vaccine research.
[0004] However, the current research on the immunological characteristics of P30 protein is not comprehensive. The published literature uses in vitro expression of P30 full-length protein to immunize mice or rabbits to prepare monoclonal antibodies; then the humoral immune response antigen epitopes of the protein are obtained by identifying the monoclonal antibody binding sites. However, the epitopes identified by this method are often very different from the antibodies produced by pigs naturally infected with the virus, and the acquisition of monoclonal antibodies is accidental, so it is impossible to accurately and comprehensively obtain the dominant epitopes of the humoral immune response of the protein. Summary of the invention
[0005] The purpose of the present invention is to provide an African swine fever virus antigen fragment and its use as a target in subunit vaccines and diagnostic antigens, thereby making up for the deficiencies of the prior art.
[0006] The present invention first provides an African swine fever virus antigen polypeptide, whose amino acid sequence is as follows:
[0007] SENIHEKNDNETNECTSSFETLFEQEPSSE(SEQ ID NO:9);
[0008] The sequence of the nucleotide fragment of the coding gene corresponding to the African swine fever virus antigen polypeptide provided by the present invention is as follows:
[0009] AGCGAAAACATCCATGAAAAGAACGACAATGAGACTAACGAATGCACCAGC AGCTTTGAAACCCTGTTCGAGCAGGAACCAAGCAGCGAG (SEQ ID NO: 10).
[0010] The present invention also provides a use of the African swine fever virus antigen polypeptide, which is to use it as an antigen to prepare a vaccine;
[0011] Furthermore, the vaccine is a subunit vaccine;
[0012] The present invention also provides another use of the African swine fever virus antigen polypeptide, which is use as a diagnostic antigen.
[0013] The present invention also provides a product for detecting African swine fever virus, wherein the antigen polypeptide is used as a diagnostic antigen.
[0014] The present invention has carried out immunogenicity system identification and truncated expression of P30 protein. After the protein is truncated and expressed, by comparing the antigen-antibody reaction of clinical ASFV-positive pig serum with P30 protein immune mouse serum and monoclonal antibody, the humoral immune response efficacy of each peptide segment is comprehensively analyzed, and a truncated peptide segment with significant immune advantage is successfully screened out. The 5th peptide segment (101-130aa) showed strong immunoreactivity in clinical ASFV-positive pig serum, and also showed excellent antigen binding properties in mouse immune serum and monoclonal antibody. The present invention not only provides a new experimental basis for analyzing the mechanism of action of P30 protein in ASFV immunity, but also lays an important foundation for the development of a new generation of ASFV subunit vaccines. The research results of the present invention have deepened the understanding of the immunobiological function of ASFV P30 protein, and provided an important theoretical basis and practical guidance for the development of safe and effective African swine fever prevention and control strategies. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 : Schematic diagram of P30 protein segmentation;
[0016] Figure 2: PCR amplification diagram of target fragment; M stands for DL Maker 500; numbers 1-8 are: 1: ASFV P301-30aa; 2: ASFV P30 26-55aa; 3: ASFV P30 51-80aa; 4: ASFV P30 76-105aa; 5: ASFV P30101-130aa; 6: ASFV P30126-155aa; 7: ASFV P30151-180aa; 8: ASFV P30 176-195aa;
[0017] Figure 3 : Linearization diagram of pGEX-6P-1 expression vector; M represents DL Maker5000; 1 represents pGEX-6P-1 vector;
[0018] Figure 4 : Expression diagram of truncated peptide segments pGEX-P30-1-pGEX-P30-8; M stands for protein Maker; numbers 1-9 are 1: pGEX-P30-1; 2: pGEX-P30-2; 3: pGEX-P30-3; 4: pGEX-P30-4; 5: pGEX-P30-5; 6: pGEX-P30-6; 7: pGEX-P30-7; 8: pGEX-P30-8; 9: uninduced.
[0019] Figure 5 : Solubility analysis of truncated peptides; wherein, the letter M and the numbers 1-8 in Figure A represent: M: Protein Maker; 1: pGEX-P30-1 ultrasonic supernatant; 2: pGEX-P30-1 ultrasonic precipitate; 3: pGEX-P30-2 ultrasonic supernatant; 4: pGEX-P30-2 ultrasonic precipitate; 5: pGEX-P30-3 ultrasonic supernatant; 6: pGEX-P30-3 ultrasonic precipitate; 7: pGEX-P30-4 ultrasonic supernatant; 8: pGEX-P30- 4 ultrasonic crushing precipitate; In Figure B, the letter M and the numbers 1-8 mean: M; Protein Maker; 1; pGEX-P30-5 ultrasonic crushing supernatant; 2; pGEX-P30-5 ultrasonic crushing precipitate; 3: pGEX-P30-6 ultrasonic crushing supernatant; 4: pGEX-P30-6 ultrasonic crushing precipitate; 5: pGEX-P30-7 ultrasonic crushing supernatant; 6: pGEX-P30-7 ultrasonic crushing precipitate; 7: pGEX-P30-8 ultrasonic crushing supernatant; 8: pGEX-P30-8 ultrasonic crushing precipitate;
[0020] Figure 6 : Purification diagram of 8 peptides;
[0021] Figure 7: Western Blot of mouse serum;
[0022] Figure 8 : Western Blot image of ASFV positive pig serum;
[0023] Figure 6-Figure 8 In the table, the letter M and the numbers 1-8 represent M: Protein Maker; 1: pGEX-P30-1; 2: pGEX-P30-2; 3: pGEX-P30-3; 4: pGEX-P30-4; 5: pGEX-P30-5; 6: pGEX-P30-6; 7: pGEX-P30-7; 8: pGEX-P30-8;
[0024] Fig. 9 : Mouse serum Elisa results;
[0025] Fig.10 :ELISA results of 10 ASFV clinically positive pig sera. DETAILED DESCRIPTION
[0026] The present invention ensures that the P30 protein can be expressed soluble in the Escherichia coli prokaryotic expression system by dividing the P30 protein into fragments of different sizes. The recombinantly expressed P30 protein fragment polypeptides are used as antigenic polypeptides to react with ASFV clinical infection serum and P30 whole protein immunized mouse serum, thereby accurately determining the target peptide segment, providing a reference for the research of ASFV vaccines and detection methods.
[0027] The BALB / C mice used in the specific embodiments of the present invention were purchased from Jinan Pengyue Experimental Animal Breeding Co., Ltd. The positive and negative serum of mice immunized with P30 protein, the culture supernatant of positive well cells in the preparation of P30 monoclonal antibody, and the ASFV positive and negative pig serum were stored by the laboratory of China Animal Health and Epidemiology Center. The prokaryotic expression plasmid pGEX-6p-P30 was constructed and preserved by China Animal Health and Epidemiology Center, and the Escherichia coli competent cells DH5α and BL21 (DE3) were purchased from Kangwei Century Biotechnology Co., Ltd.
[0028] The reagent information used in the examples of the present invention is as follows:
[0029] DMEM high-glucose medium and FBS fetal bovine serum were purchased from HyClone; ampicillin and IPTG were purchased from Solebol; penicillin-streptomycin (100×) was purchased from China Sangon Biotechnology Co., Ltd.; GST-tag protein purification kit was purchased from Bio-Technology Co., Ltd.; HT and HRP-labeled goat anti-swine IgG secondary antibodies were purchased from Sigma; HRP-labeled goat anti-mouse IgG secondary antibodies were purchased from abcam; 0.45 mm PVDF membrane was purchased from Millipore, USA; protein marker and 96-well ELISA plate were purchased from Thermo Fisher Scientific; TMB substrate colorimetric solution was purchased from Nanjing Jiancheng Bioengineering Institute; SurePageTM protein precast gel was purchased from GenScript Biotechnology Co., Ltd.; enhanced ECL chemiluminescence detection kit was purchased from Shanghai Yisheng Biotechnology Co., Ltd.; DNA marker was purchased from TaKaRa Bio; restriction endonuclease (BamH1), TksGflex DNA Polymerase, In-Fusion HD Cloning All kits were purchased from Bao Biotechnology (Dalian) Co., Ltd.; the gel recovery kit was purchased from MACHEREY-NAGEL (MNG) Company; and the QIAprep Spin plasmid extraction kit was purchased from Nanjing Novozymes Company.
[0030] The primer synthesis and sequencing in the examples were completed by Qingdao Ruibo Biotechnology Co., Ltd.
[0031] The present invention is described in detail below in conjunction with embodiments and drawings.
[0032] Example 1: Screening, expression and purification of synthetic antigen fragments
[0033] According to the strain sequences in NCBI (NC_044946.1, NC_001659.2), the ASFV P30 protein sequence was repeated in the order of 5 amino acids in every 30 amino acids, and upstream and downstream primers were designed respectively. The Bam HI recognition site and the homology arm of the vector pGEX-6P-1 were inserted at the ends of the primers, and the target fragment was recovered after PCR amplification. The target fragment was linked to the prokaryotic expression vector pGEX-6P-1 to construct a prokaryotic expression vector. The primer information of the synthetic peptide gene fragment of the P30 protein truncated body is shown in Table 1.
[0034] Table 1: Primer information of P30 truncated synthetic peptide gene fragment
[0035]
[0036] See the peptide schematic diagram for Figure 1, wherein the amino acid sequence of the first peptide segment is SEQ ID NO: 1, and the sequence of the nucleotide fragment encoding the gene is SEQ ID NO: 2.
[0037] The amino acid sequence of the second peptide segment is SEQ ID NO:3, and the sequence of the nucleotide fragment of the gene encoded by the second peptide segment is SEQ ID NO:4.
[0038] The amino acid sequence of the third peptide segment is SEQ ID NO:5, and the sequence of the nucleotide fragment encoding the gene is SEQ ID NO:6.
[0039] The amino acid sequence of the fourth peptide segment is SEQ ID NO:7, and the sequence of the nucleotide fragment of the gene encoded by the fourth peptide segment is SEQ ID NO:8.
[0040] The amino acid sequence of the fifth peptide segment is SEQ ID NO:9, and the sequence of the nucleotide fragment of the gene encoded by the fifth peptide segment is SEQ ID NO:10.
[0041] The amino acid sequence of the sixth peptide segment is SEQ ID NO:11, and the sequence of the nucleotide fragment encoding the gene is SEQ ID NO:12.
[0042] The amino acid sequence of the seventh peptide segment is SEQ ID NO:13, and the sequence of the nucleotide fragment encoding the gene is SEQ ID NO:14.
[0043] The amino acid sequence of the eighth peptide segment is SEQ ID NO:15, and the sequence of the nucleotide fragment encoding the gene is SEQ ID NO:16.
[0044] The prokaryotic expression plasmid pGEX-6p-P30 was used as a template for PCR amplification, and gel recovery was performed after amplification. The vector pGEX 6P-1 was digested with Bam HI, and the vector and the target fragment were connected using seamless cloning technology. The recombinant plasmid was transformed and sequenced, and the bacterial solution with the correct sequence was used for plasmid extraction and stored at -20°C. The prepared 8 recombinant plasmids were named pGEX-P30-1-pGEX-P30-8.
[0045] The 8 designed primers were used to amplify the expected bands and sequenced to confirm the sequence was correct. The Bam HI recognition site of the pGEX-6P-1 expression vector was cut using seamless cloning technology ( Figure 3 ), and added GST protein tag to connect and transform with the target fragment. After sequencing comparison, the recombinant expression plasmids with correct sequences were named pGEX-P30-1 to pGEX-P30-8.
[0046] Transform the recombinant plasmids pGEX-P30-1 to pGEX-P30-8 into competent E. coli cells DH5α, and invert the plates in a constant temperature incubator at 37°C for overnight culture. After a single colony grows, pick the colony and add it to 5mL of liquid LB medium containing ampicillin resistance, and culture it on a bacterial culture shaker at 37°C for 12-16 hours. After the culture is completed, sequence the culture, and extract DNA from the bacterial solution with the correct sequencing results.
[0047] The extracted DNA was transformed into E. coli competent cells BL21 (DE3) and cultured at 37°C until OD 600 When the value reaches 0.6-0.8, add IPTG at a ratio of 1:1000 to a final concentration of 1mM. Take another tube without induction as a control, put it in a shaker, and culture it at 37°C and 200rpm for 4h. Take 1mL of the bacterial solution after IPTG induction and 1mL of the uninduced bacterial solution in a centrifuge, centrifuge at 12000rpm for 1min, and collect the supernatant and precipitate after centrifugation. Collect 100μL of the supernatant, resuspend the precipitate with 100μL PBS, add an appropriate amount of protein loading buffer, boil it in boiling water for 10min, and then perform SDS-PAGE to identify the expression.
[0048] The successfully induced bacterial solution was expanded to 400 ml of LB liquid medium containing ampicillin resistance at a ratio of 1:100 for induction expression. The induced bacterial solution was centrifuged, bacterial lysis solution and lysozyme were added, and the bacteria were lysed by ultrasound in an ice bath. The protein was purified using a GST-tag protein purification kit. Take an appropriate amount of purified protein sample, add an appropriate amount of protein loading buffer, boil in boiling water for 10 minutes, and then perform SDS-PAGE to identify the protein purification status.
[0049] The induction results were subjected to SDS-PAGE electrophoresis, and a 30 kDa fusion protein ( Figure 4 ), which contains a 26kDa GST protein tag and a 4kDa target fragment. The bacterial solution was ultrasonically disrupted, and the supernatant and precipitate were separated by centrifugation after ultrasonication. SDS-PAGE electrophoresis was performed to determine the protein expression mode. The results showed that the ultrasonic supernatant contained a large number of 30kDa bands, and the protein was soluble ( Figure 5 ). The protein size and expression pattern were consistent with expectations.
[0050] GST-tag protein purification kit was used to purify the 8 peptides induced by IPTG. An appropriate amount of purified peptides were taken for SDS-PAGE gel electrophoresis. The results showed that the purified peptides had a single band at 30 kDa, which was consistent with the expected results. The purification of the 8 peptides was successfully completed ( Figure 6 ).
[0051] Example 2: Detection of the immune effect of purified peptides
[0052] 1. Identification of immunodominant peptides by WB (Western Blot)
[0053] Take 8 purified peptides as samples, add appropriate amount of loading buffer, boil in boiling water for 10 minutes, perform electrophoresis and transfer to PVDF membrane. Prepare 5% BSA solution with PBST containing 1mL / L Tween 20, and block on a shaker at room temperature for 2h. Dilute ASFV positive pig serum at a ratio of 1:1000 and mouse immune serum of P30 protein at a ratio of 1:2000 as primary antibodies, incubate overnight at 4°C; wash 5 times with PBST (5min / time), dilute HRP-labeled goat anti-pig IgG at a ratio of 1:1000 and HRP-labeled goat anti-pig mouse IgG at a ratio of 1:10000 as secondary antibodies, incubate at room temperature for 1h, and wash 5 times with PBST (5min / time). Mix HRP chemiluminescent substrate A solution with B solution 1:1, add to PVDF membrane, use ECL luminescence imaging system to develop color and take pictures for preservation.
[0054] The purified 8 peptides were tested by WB, and the serum of mice immunized with P30 protein and the serum of ASFV-positive pigs were used for verification. The results showed that the antigenic reaction of the 5th, 6th and 8th peptides was relatively strong in the mouse serum ( Figure 7 ), the bands were obvious, among which the 5th peptide segment (101-130aa) had the darkest color, and the other peptide segments had almost no bands; in the ASFV-positive pig serum, only the 5th peptide segment (101-130aa) showed obvious bands, and the other peptide segments had no obvious bands ( Figure 8 ).
[0055] 2. Elisa Identification of Immunodominant Peptides
[0056] Indirect Elisa was used to determine the immune mouse serum and 10 ASFV positive sera to identify 8 P30 peptides. The purified 8 peptides were used as coating antigens, coated overnight at 4°C, washed twice with PBST, and blocked with 5% skim milk powder at room temperature for 1 hour. Add 1:10000 diluted immune mouse serum and negative mouse serum, 1:400 diluted ASFV positive pig serum and negative pig serum, react at 37°C for 1 hour, rinse 4 times with PBST, add 1:10000 diluted HRP-labeled goat anti-pig IgG, 1:10000 diluted HRP-labeled goat anti-mouse IgG, react at 37°C for 1 hour, rinse 4 times with PBST, add TMB colorimetric solution and react at room temperature in the dark for 20 minutes, add Elisa stop solution, and read OD with an enzyme reader. 450 The value of is used to determine the immunodominant peptide segment of ASFV P30 protein.
[0057] The 8 purified peptides were coated and indirect Elisa experiments were performed using sera from 2 mice immunized with P30 protein and 10 ASFV-positive pig sera. In the sera of mice immunized with P30 protein alone, the reactions of peptides 5, 6, and 8 were relatively strong, among which the value of peptide 8 (176-195aa) was the highest ( Fig. 9 ).
[0058] In the test of 10 ASFV-positive pig sera, the value of the 5th peptide segment (101-155aa) was significantly outstanding, showing a strong immune response, while the other peptide segments had only a weaker reaction. This result further emphasizes the importance of the 5th peptide segment in the immune response. It is also consistent with the WB results.
[0059] In summary, the present invention uses the E. coli prokaryotic expression system to express and purify the ASFV P30 protein in segments of 30 amino acids with 5 amino acids repeated in the middle to obtain 8 P30 peptides. Subsequently, the 8 peptides were tested by WB and Elisa using the mouse serum immunized with the whole P30 protein and the ASFV-positive pig serum, respectively, to systematically analyze the humoral immunogenicity of the P30 protein. After two tests, it was found that there were significant differences in the results obtained by using mice immunized with a single protein and the positive serum of clinical pigs.
[0060] Both the WB and Elisa results of the serum samples of mice immunized with P30 protein alone showed strong immunogenicity for three peptides, namely, the 5th, 6th and 8th (101-130aa, 126-155aa, 176-195aa). The WB band of the 5th peptide (101-130aa) was the darkest, while the other two peptides were lighter in color. All other peptides had no bands, indicating that the remaining peptides had no immunogenicity. The Elisa test also showed that the values of the same three peptides were high and the immune response was strong, but unlike the WB results, the value of the 8th peptide (176-195aa) was the highest. The WB results of ASFV-positive pig sera showed that only the 5th peptide segment (101-130aa) had an obvious band, and the other peptide segments had no bands; the Elisa results were consistent with the WB results. All 10 ASFV-positive pig sera showed strong immunogenicity with the 5th peptide segment (101-130aa), and the detection value for the 5th peptide segment was also significantly higher than that of mice. The reaction values of the other peptide segments were very low and did not show immunogenicity in the experiment.
[0061] From the research results, it can be found that after mice were immunized with P30 protein alone, their serum and monoclonal antibody positive well cell culture supernatant showed strong immune responses to the 5th, 6th, and 8th peptide segments (101-130aa, 126-155aa, 176-195aa), while ASFV positive pig serum could only produce a single strong immune response to the 5th peptide segment (101-105aa), and there was a certain difference in the number and intensity of the immune response peptide segments. This result may be related to the fact that mice were only immunized with P30 protein while pigs were directly infected with ASFV. Studies have found that during the natural infection of African swine fever virus, the protective effect of P30-specific antibodies against the virus is unsatisfactory. This also confirms that in this experiment, pig serum showed strong immunogenicity against a single peptide, while mouse samples showed richer but non-specific immunogenicity; at the same time, more than half of the peptides could not produce an immune response to the two samples. Therefore, the specific antibodies produced by using only the full-length P30 protein for immunization are not enough to completely protect against the attack of the ASFV virus.
Claims
1. An African swine fever virus antigen polypeptide, characterized in that: The amino acid sequence of the antigen polypeptide is SEQ ID NO:
9.
2. A nucleotide fragment, characterized in that: The nucleotide fragment is used to encode the antigen polypeptide according to claim 1.
3. The nucleotide fragment according to claim 2, characterized in that The sequence of the nucleotide fragment is SEQ ID NO:
10.
4. Use of the antigen polypeptide according to claim 1 in preparing a vaccine.
5. The use according to claim 4, characterized in that The vaccine is a subunit vaccine.
6. Use of the antigen polypeptide according to claim 1 as a diagnostic antigen.
7. A subunit vaccine, characterized in that: The antigen polypeptide of the subunit vaccine uses the antigen polypeptide according to claim 1.
8. A product for detecting African swine fever virus, characterized in that: The preparation comprises the antigen polypeptide according to claim 1 as a diagnostic antigen.