Cherry valley duck PLV virus and detection and application thereof

By isolating and identifying the PLV-20155 virus strain and developing relevant detection and treatment methods, the gap in PLV pathogenicity in Cherry Valley ducks was solved, and the causal relationship between the virus and the decrease in egg laying rate, follicle necrosis and fallopian tube atrophy was clarified, and the breeding benefits were improved and scientific basis was provided for disease prevention and control.

CN120098936APending Publication Date: 2025-06-06SHANDONG HEKANGYUAN GROUP +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510260955.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-06
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

There is a lack of research on the pathogenicity of Parry’s Lagoon virus (PLV) in cherry valley ducks, especially in the field of agriculture, and no reports on the pathogenicity of PLV in cherry valley ducks.

Method used

A new PLV virus strain PLV-20155 was isolated and identified, and through the design of gene fragments and specific primers, it provides methods for detection and diagnosis, while developing antibody preparations and inactivated vaccines for prevention and treatment.

Benefits of technology

The causal relationship between PLV-20155 and the decrease in egg laying rate, follicle necrosis and fallopian tube atrophy was clarified, and scientific basis is provided for disease prevention and control, improving breeding benefits, and effectively reducing the problem of decreased egg laying rate caused by viral infection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120098936A_ABST
    Figure CN120098936A_ABST
Patent Text Reader

Abstract

The invention relates to a cherry valley duck PLV virus strain and detection and application thereof, and belongs to the technical field of viruses. According to the invention, a Parry's Lagoon virus (PLV) strain PLV-20155 is separated and identified for the first time, the strain is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number is CGMCC NO.46296. The invention also discloses a preparation method of the parry's Lagoon virus PLV-20155. The PLV-20155 virus can significantly reduce the laying rate of the cherry valley ducks, and causes follicle necrosis and oviduct atrophy. In addition, the invention provides a VP5 gene segment of the PLV-20155 virus and a specific primer of the VP5 gene segment, and the VP5 gene segment and the specific primer can be used for rapidly and accurately detecting the virus. Therefore, the blank of the PLV virus in the field of agricultural economic animal pathogenicity research is filled, a scientific solution is provided for the problem of egg laying reduction of the cherry valley ducks, and important economic value and social significance are achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of viruses, and in particular relates to a Cherry Valley duck PLV virus and an application thereof. Background Art

[0002] Parry's Lagoon virus (PLV) is a virus belonging to the genus Orbivirus in the family Reoviridae. The virus was originally isolated from mosquito samples in Australia and is therefore considered an arthropod-transmitted arbovirus. Its name comes from the location where the virus was first discovered - a wetland area in northern Australia called Parry's Lagoon.

[0003] The genome of PLV consists of 10 double-stranded RNA segments, which is a typical feature of Orbivirus. These RNA segments encode a variety of structural and non-structural proteins, which play key roles in viral replication, assembly, and interaction with host cells. For example, structural proteins constitute the viral shell, while non-structural proteins are involved in regulating the viral life cycle, including suppressing host immune responses or promoting transcription and translation of the viral genome. In addition, PLV has a typical non-enveloped icosahedral symmetric structure with a diameter of approximately 70-80 nanometers. This structure gives the virus a high environmental stability, allowing it to tolerate certain temperature changes and pH fluctuations. Therefore, PLV may have a strong ability to survive in the natural environment, which provides favorable conditions for its transmission through arthropod vectors.

[0004] To date, studies on the pathogenicity of PLV are very limited. Especially in the agricultural field, there have been no reports on the pathogenicity of PLV in certain economic animals (such as Cherry Valley ducks). Summary of the invention

[0005] The purpose of the present invention is to provide a PLV virus in Cherry Valley ducks that can significantly reduce the egg-laying rate of breeding ducks, as well as its detection and application.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] First, the present invention provides a Cherry Valley duck PLV virus strain, which is Parry's Lagoon virus virus strain PLV-20155, deposited in the General Microbiology Center of China National Committee for the Preservation of Microorganisms, address: No. 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101, the preservation number is CGMCCNO.46296, and the preservation date is November 26, 2024.

[0008] Preferably, the virus strain PLV-20155 includes the gene fragment shown in SEQ ID NO.1.

[0009] Secondly, the present invention provides the use of the Cherry Valley duck PLV virus strain in the preparation of a drug, wherein the drug is a drug for preventing and / or treating the decreased egg laying rate of Cherry Valley duck caused by the virus strain PLV-20155.

[0010] Preferably, the drug is an antibody preparation prepared using the viral strain PLV-20155 as an antigen.

[0011] Then, the present invention provides the use of primers for detecting the Cherry Valley duck PLV virus strain in preparing a diagnostic preparation for a viral disease caused by the virus strain PLV-20155.

[0012] Preferably, the viral disease caused by the viral strain PLV-20155 is a decrease in egg laying rate, follicular necrosis and oviduct atrophy in Cherry Valley ducks caused by the viral strain PLV-20155.

[0013] Preferably, the sequences of the primers are shown as SEQ ID NO.2 and SEQ ID NO.3.

[0014] Finally, the present invention provides a PCR kit for detecting Cherry Valley duck PLV virus strains, characterized in that the kit includes primers for detecting Cherry Valley duck PLV virus strains.

[0015] Preferably, the sequences of the primers are shown as SEQ ID NO.2 and SEQ ID NO.3.

[0016] The beneficial effects of the present invention are:

[0017] The present invention isolated a new Parry's Lagoon virus (PLV) strain (PLV-20155) from Cherry Valley ducks for the first time, and clarified the causal relationship between it and the decreased egg production rate, follicular necrosis and oviduct atrophy of Cherry Valley ducks. This discovery fills the gap in the research on the pathogenicity of PLV virus in agricultural economic animals (such as Cherry Valley ducks), and provides an important scientific basis for the prevention and control of related diseases.

[0018] In addition, the virus detection method provided by the present invention can quickly diagnose the infection of the virus, thereby providing technical support for the farm to take prevention and control measures in a timely manner.

[0019] In general, the technical achievements of the present invention can be widely used in the Cherry Valley duck farming industry, especially in the health management of breeder ducks during the egg-laying period. By promoting the detection method of the PLV-20155 virus and related drug products, the problem of decreased egg production rate caused by virus infection can be effectively reduced, and the farming efficiency can be improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The results of RT-PCR tests for 21 common viruses;

[0021] Figure 2 The mortality rate of PLV-20155 virus was changed during serial passage in 7-day-old SPF chicken embryos.

[0022] Figure 3 The results of autopsy observation of dead chicken embryos infected with PLV-20155 virus;

[0023] Among them, (a) shows the bleeding condition of embryo body, (b) shows the myocardial bleeding condition of embryo body, and (c) shows the liver necrosis condition of embryo body;

[0024] Figure 4 The morphology of the PLV-20155 virus observed by electron microscopy;

[0025] Among them, (a) is the virus morphology in the liver, and (b) is the virus morphology in the heart;

[0026] Figure 5 It is the comparison result of the VP5 gene fragment of PLV-20155 virus and the known virus sequences in the NCBI database;

[0027] Figure 6 The changes in egg production rate of Cherry Valley breeder ducks in each group before and after the virus challenge experiment;

[0028] Figure 7 The anatomical observation results of follicles and oviducts at 3 days (a) and 10 days (b) after infection;

[0029] Figure 8 This is the pathological section result of the fallopian tube at 10 days after the virus attack;

[0030] Fig. 9 This is the pathological section result of the liver at 10 days after the virus attack;

[0031] Fig.10 This is the pathological section result of spleen at 10 days after the virus attack;

[0032] Fig.11 The changes in egg production rate of different treatment groups before and after the virus challenge experiment. DETAILED DESCRIPTION

[0033] In order to enable those skilled in the art to better understand the technical solutions in the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0034] In recent years, the egg production rate of Cherry Valley breeder ducks has generally decreased due to various reasons. In response to this problem, our company began to collect and summarize cases of egg production decline in 2021, combined with the basic clinical situation on site, to conduct a pathogen census, isolate the virus, and establish case files to provide a basis for the diagnosis, treatment and later prevention and control of cases of egg production decline in breeder ducks. Through research, our company isolated a pathogen from the egg production disease material of Cherry Valley ducks in a duck farm in Tai'an, Shandong, and named the pathogen 20155. Cherry Valley ducks infected with the virus began to experience continuous egg production decline, reaching 40% within two weeks.

[0035] Example 1: Isolation of viruses

[0036] (1) Take the diseased materials of Cherry Valley duck breeder ducks with decreased egg production, dilute the follicles, oviducts and other organs with sterile saline in a ratio of 1:3, shake and mix, grind and freeze-thaw three times.

[0037] (2) Centrifuge at 8000 r / min for 10 min, collect the tissue supernatant, filter it with a 0.22 μm filter, and inoculate the filtrate into 7-day-old SPF chicken embryos via the yolk sac route. Incubate at 37°C and observe the death and pathology of the chicken embryos twice a day until 10 days after inoculation.

[0038] (3) Discard dead embryos within 24 hours, collect the allantoic fluid and embryo bodies of chicken embryos that died 24 hours later, grind them, freeze-thaw them three times, collect the supernatant by centrifugation, and store them at -80°C.

[0039] (4) The first isolated chicken embryo died 8 days after inoculation, with a mortality rate of 20% and the HA detected was 0.

[0040] (5) The present invention detects 17 common viruses including: Newcastle disease virus (NDV), infectious bronchitis virus (IBV), infectious laryngo tracheitis virus (ILTV), infectious bursal disease virus (IBDV), avian pneumo virus (APV), avian reo virus (ARV), Marek's disease virus (MDV), reticuloendotheliosis virus (REV), chicken infectious anemia virus (CIAV), avian infectious encephalomyelitis virus (AEV), Mycoplasma galliscepticum (MG), Mycoplasma synoviae (MG), synoviae, MS), Egg drop syndrome virus (EDS), Fowl avianadenovirus serotype (FAdV), Duck Hepatitis Virus I (DHV-I), Duck Hepatitis Virus III (DHV-III), Duck Tembusu virus (DTV), the test results are as follows Figure 1 shown.

[0041] from Figure 1 It can be seen from the results that the test results for 17 common viruses were all negative.

[0042] Example 2: Virus Passaging

[0043] (1) The ground liquid of the harvested dead chicken embryos was treated according to the method of Example 1, and then inoculated into 7-day-old SPF chicken embryos for continuous passage.

[0044] (2) The dead chicken embryos were dissected and their systemic bleeding, cardiac bleeding and liver necrosis were observed.

[0045] from Figure 2The results show that by the third generation, the mortality rate of the chicken embryos was 60%, and by the fifth generation, the mortality rate of the chicken embryos was 100%.

[0046] from Figure 3 The results showed that the dead chicken embryos showed systemic hemorrhage, cardiac hemorrhage and liver necrosis.

[0047] Example 3: Identification of viruses

[0048] (1) The 20155 pathogen was propagated to the 21st generation according to the above method, and the chicken embryos were taken 5 days after the virus inoculation for subsequent operations;

[0049] (2) observing the death of chicken embryos, selecting dead chicken embryos, and fixing the liver and heart of the dead chicken embryos as required;

[0050] (3) The fixed liver and heart were observed using an electron microscope. The results were as follows: Figure 4 shown.

[0051] Example 4: Identification of viruses

[0052] (1) After the 20155 pathogen caused the death of the chicken embryo, the allantoic fluid was taken for nucleic acid extraction, and the obtained nucleic acid was subjected to high-throughput sequencing to obtain the gene sequence fragment of the virus (PLV-VP5 fragment), as shown in SEQ ID NO.1.

[0053] (2) Design specific primers based on the gene sequence fragment of the virus. The primer sequences are as follows:

[0054] PLV-VP5-1F:GATCCATCATGTGTTGAATTGCC, SEQ ID NO.2;

[0055] PLV-VP5-1R:GCGT CACTTGAATAAGGCCGC, SEQ ID NO.3;

[0056] (3) Virus identification detection conditions are: 95°C pre-denaturation for 5 min; then 95°C denaturation for 30 s, 53.4°C annealing for 45 s, 72°C extension for 30 s, 35 cycles; the target fragment size is 337 bp;

[0057] (4) The amplified products were sequenced at NCBI, and the results were as follows: Figure 5 shown.

[0058] from Figure 5 It can be seen that the virus discovered in the present invention has a highest homology of 89.2% with Parry's Lagoon virus, thereby confirming that the virus of the present invention is PLV virus, named PLV-20155.

[0059] Example 5: Detection of the pathogenicity of the PLV-20155 virus discovered by the present invention

[0060] (1) 20 egg-laying Cherry Valley breeder ducks that passed the test were randomly divided into two groups, A and B, with 10 female ducks in each group;

[0061] (2) After the egg-laying conditions of Group A and Group B stabilized, Group A was selected as the challenge group and was inoculated with PLV-20155 via chest intramuscular injection at a titer of 10 3.0 ELD 50 / ml, 2ml / mouse, group B was the normal control group, inoculated with the same dose of sterile PBS;

[0062] (3) Each group of breeding ducks was isolated and raised in a closed, clean environment, provided with the required light intensity and lighting time, clean feed and drinking water for the breeding ducks during the laying period, and the bedding was changed and the feces was cleaned up daily;

[0063] (4) After the virus attack, the mental state, feeding habits, and mortality of the breeder ducks were continuously observed and recorded; the egg production rate, egg quality, and other related data were recorded;

[0064] (5) Three days and ten days after the infection, one duck was dissected and the condition of each organ of the duck was observed and recorded to analyze the pathogenicity of the virus to the ducks.

[0065] (6) The liver, spleen, follicles, fallopian tubes and other organs were collected and placed in 4% paraformaldehyde fixative to prepare pathological sections for comparison of lesions.

[0066] The results of egg production were as follows: Figure 6 As shown in the figure, it can be clearly seen that the egg production rate of Cherry Valley breeder ducks in Group A showed a continuous downward trend, with a decrease of about 40%-50%, which is basically consistent with the clinical incidence. However, it is worth noting that there were no obvious abnormalities in the feed intake, mortality and appearance of the breeder eggs. This shows that the PLV-20155 virus strain isolated by the present invention can significantly reduce the egg production rate of Cherry Valley breeder ducks, but has no significant effect on the feed intake of the breeder ducks and the appearance characteristics of the breeder eggs.

[0067] On day 3 of the infection, the anatomical observation results of the follicles and fallopian tubes were as follows: Figure 7 As shown in (a), it can be seen from the figure that the follicles are well developed and ready to lay eggs.

[0068] At 10 days after infection, the anatomical observation results of follicles and fallopian tubes were as follows: Figure 7 As shown in (b), the follicles atrophy and necrosis, and the fallopian tubes atrophy at the same time.

[0069] At 10 days after infection, the pathological section of the fallopian tube showed Figure 8As shown (the left picture is HE×40, the right picture is HE×100), it can be seen that there is a large area of ​​necrosis of the alveoli in the lamina propria of the fallopian tube mucosa (shown in the red circle).

[0070] 10 days after the virus attack, the pathological section of the liver is as follows: Fig. 9 As shown, as can be seen from the left picture, there is obvious infiltration of inflammatory cells around the blood vessels of the liver (indicated by the red arrows), and as can be seen from the right picture, hepatocytes generally undergo vacuolar degeneration, and a small amount of lymphocytes infiltrate around the blood vessels (indicated by the red arrows).

[0071] Pathological sections of the spleen at 10 days after infection are shown in the figure below. Fig.10 As shown in the figure, it can be seen that there is a slight loss of lymphocytes in the white pulp of the spleen.

[0072] The above results verified that PLV-20155 can significantly inhibit egg-laying performance by damaging the ovarian follicles and oviducts of Cherry Valley breeder ducks. This discovery laid an important foundation for its application in disease prevention and control and vaccine development.

[0073] Example 6: Preparation of PLV-20155 inactivated virus vaccine

[0074] (1) Virus propagation: PLV-20155 virus was inoculated into 7-day-old SPF chicken embryos by yolk sac inoculation for passage propagation;

[0075] (2) Virus collection: The embryoid bodies of dead chicken embryos were harvested and mixed with the allantoic fluid, then ground and repeatedly frozen and thawed, and then centrifuged to obtain the supernatant. The virus titer was 10 3.0 ELD 50 / 0.1ml virus liquid, after testing negative for exogenous viruses and bacteria, it is ready for use;

[0076] (3) Virus inactivation: Transfer the collected virus solution to an inactivation bottle and add formaldehyde solution until the final formaldehyde concentration in the mixed solution is 0.1%;

[0077] (4) After inactivation at 37°C on a shaking table for 48 hours, an inactivated PLV-20155 virus solution was obtained;

[0078] The inactivated PLV-20155 virus solution was inoculated into SPF chicken embryos according to the passaging method for three consecutive generations. After ensuring that there was no death in the chicken embryos and the PLV-20155 virus PCR test was negative, the virus solution with safe detection was selected for vaccine preparation;

[0079] (4) Vaccine preparation: The inactivated PLV-20155 virus solution was mixed with white oil in a ratio of 1:3, and then treated with a high-speed shearing machine at 20,000 r / min for 5 min to obtain the PLV-20155 virus inactivated vaccine.

[0080] Example 7: Detection of the immune effect of PLV-20155 inactivated virus vaccine

[0081] Since no virus of the same genus as PLV has been found so far, the present invention selects the inactivated virus of duck reovirus HZDRV (isolated and identified by our company, reference: Isolation, identification and pathogenicity analysis of the new duck reovirus Shandong strain) of the same family as the control, and the inactivated vaccine preparation method is the same as that in Example 6.

[0082] (1) 92 qualified egg-laying Cherry Valley breeder ducks were randomly divided into 4 groups and the experiment was carried out according to the following groupings:

[0083] Group 1 was immunized with PLV-20155 inactivated vaccine, Group 2 and Group 3 were not immunized, and Group 4 was immunized with HZDRV inactivated vaccine. The experimental ducks in Group 1 and Group 4 were immunized twice, with the second immunization 21 days after the first immunization. 28 days after the second immunization, PLV-20155 was inoculated through the chest muscle injection route, 2 ml / bird.

[0084] Table 1 Immunization grouping in the experiment

[0085]

[0086]

[0087] (2) Before and after the challenge experiment, the egg production rate of each treatment group was systematically counted and analyzed to evaluate the immune effect of the PLV-20155 inactivated vaccine prepared by the present invention.

[0088] The experimental results are as follows Fig.11 As shown. Fig.11 It can be seen that compared with the blank control group, the egg laying rate of Cherry Valley breeder ducks in the non-immunized challenge group decreased significantly after the challenge. This phenomenon shows that the PLV-20155 virus is obviously pathogenic to Cherry Valley breeder ducks. The challenge experiment successfully simulated the pathological process of viral infection and verified the effectiveness of the experimental model.

[0089] Further observation of the results of the HZDRV inactivated vaccine immunization group revealed that although the Cherry Valley breeder ducks in this group were vaccinated with the duck reovirus (HZDRV) inactivated vaccine, their egg production rate still decreased significantly after the virus challenge. This result shows that vaccination with the inactivated duck reovirus vaccine of the same family cannot effectively prevent infection with the PLV-20155 virus, nor can it prevent the decrease in egg production caused by it. This shows that there are significant differences in antigenicity and immunogenicity between the PLV-20155 virus and the reovirus of the same family, and the existing reovirus vaccine cannot provide protection against the PLV-20155 virus.

[0090] In contrast, the egg production rate of Cherry Valley breeder ducks in the PLV-20155 inactivated vaccine immunization group did not show a significant decrease after the virus challenge, and was basically consistent with the egg production rate level of the blank control group. This result fully proves that the PLV-20155 inactivated vaccine prepared by the present invention can effectively stimulate the body to produce a specific immune response, thereby preventing infection with the PLV-20155 virus and significantly reducing its adverse effects on egg production performance.

[0091] In summary, this study verified the highly effective immune protection of the PLV-20155 inactivated vaccine through the change in egg production rate, and revealed the significant differences between the PLV-20155 virus and other viruses in the same family (such as reovirus). This discovery not only provides a scientific basis for the prevention and control of the PLV-20155 virus, but also lays an important foundation for the subsequent development and optimization of related vaccines.

Claims

1. A Cherry Valley duck PLV virus strain, characterized in that The Cherry Valley duck PLV virus strain is Parry's Lagoon virus strain PLV-20155, which is deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, address: No. 1 Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101, and the deposit number is CGMCC NO.46296.

2. The Cherry Valley duck PLV virus strain according to claim 1, characterized in that The virus strain PLV-20155 includes the gene fragment shown in SEQ ID NO.

1.

3. The use of the Cherry Valley duck PLV virus strain in the preparation of medicines according to claim 1, characterized in that: The drug is used for preventing and / or treating the decreased egg laying rate of Cherry Valley ducks caused by the viral strain PLV-20155.

4. The use according to claim 3, characterized in that: The drug is an antibody preparation prepared using the viral strain PLV-20155 as an antigen.

5. Use of primers for detecting the Cherry Valley duck PLV virus strain as claimed in claim 1 in the preparation of diagnostic preparations for viral diseases caused by the virus strain PLV-20155.

6. The use according to claim 5, characterized in that: The viral disease caused by the virus strain PLV-20155 is a decrease in egg laying rate, necrosis of ovarian follicles and atrophy of oviduct in Cherry Valley ducks caused by the virus strain PLV-20155.

7. The use according to claim 6, characterized in that: The sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.

3.

8. A PCR kit for detecting the Cherry Valley duck PLV virus strain as claimed in claim 1, characterized in that: The kit includes primers for detecting the Cherry Valley Duck PLV virus strain.

9. The PCR kit according to claim 8, characterized in that The sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3.