Porcine reproductive and respiratory syndrome virus labeled attenuated vaccine strain and application thereof

By constructing and passage-labeling the attenuated vaccine strain rSX-HD2M1-F120, the problem that existing vaccines cannot distinguish between natural infection and vaccine immunity is solved, and the protection efficiency of PRRSV-2 is significantly improved, achieving purification and protection of pig herds.

CN120098937APending Publication Date: 2025-06-06NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510270040.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-07
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The existing PRRSV-2 attenuated vaccine cannot effectively distinguish between natural infection and vaccine immunity, resulting in huge challenges in purifying pig herds, and the protection efficiency is low when facing heterologous strains, and there is a risk of virulence returning to strength.

Method used

A labeled attenuated vaccine strain rSX-HD2M1-F120 was developed. By constructing the nucleocapsid protein (N) gene of PRRSV-2, the PRRSV-1N protein gene was replaced, and chimeric viruses were constructed using reverse genetic technology, and the 120 consecutive passages were passed on MARC-145 cells to prepare a labeled attenuated vaccine candidate strain.

Benefits of technology

This labeled attenuated vaccine strain can induce antibody production against PRRSV-1N protein in pigs and distinguish natural infection from vaccine immunity through competitive ELISA detection, providing a new strategy to purify the pig herd and significantly improve the protective efficiency of PRRSV-2.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120098937A_ABST
    Figure CN120098937A_ABST
Patent Text Reader

Abstract

The invention discloses a porcine reproductive and respiratory syndrome virus labeled attenuated vaccine strain and application thereof, and belongs to the technical field of veterinary biological products. The attenuated vaccine strain is named as a PRRSV rSX-HD2M1-F120 strain, and is preserved in the China General Microbiological Culture Collection Center on February 21, 2025, the preservation address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the preservation number is CGMCC NO.46402. The invention further discloses a preparation method of the PRRSV rSX-HD2M1-F120 strain. The candidate attenuated strain obtained by the invention is matched with a pre-established specific detection method for the gene type 2 PRRSV antibody, and a technical support can be provided for prevention, control and purification of gene type 2 PRRSV infection in swinery.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the technical field of veterinary biological products, in particular to a porcine reproductive and respiratory syndrome virus marker attenuated vaccine strain and application thereof. Background Art

[0002] Porcine reproductive and respiratory syndrome (PRRS) is an infectious disease of pig reproductive disorder and respiratory system caused by infection with porcine reproductive and respiratory syndrome virus (PRRSV). It is one of the important epidemic diseases that seriously endanger the healthy development of the pig industry and cause huge economic losses to the global pig industry. According to the differences in genome sequence and antigenic characteristics, PRRSV is divided into two different serotypes: PRRSV-1 (European type) and PRRSV-2 (American type). In my country, PRRSV-2 infection is the main prevalence in pig populations, and PRRSV-1 infection is occasionally reported. Since 2006, highly pathogenic PRRSV strains of genotype 2 have broken out and spread in my country, causing very serious economic losses to my country's pig industry. At present, the prevalent strains in my country's pig populations have gradually evolved into genotype 2 PRRSV-like NADC30 and NADC34 strains.

[0003] Vaccine immunization is currently the most important measure for the prevention and control of PRRSV infection. At present, there are two main types of PRRS vaccines on the market, namely inactivated vaccines and attenuated vaccines. Among them, the inactivated PRRSV vaccine has the advantages of high safety, easy transportation and storage, but the immune response induced by the body is weak, and it can only stimulate the body to produce humoral immunity. Moreover, its immune production cycle is relatively long, and whether it has an immune protection effect is still controversial. In addition, due to the ADE effect of PRRSV, the protective effect of the inactivated vaccine is poor. Compared with the inactivated vaccine, the attenuated vaccine has the advantages of good and lasting immune effect, high protection rate and small immune dose. It is superior to the inactivated vaccine in clinical use. Attenuated vaccine vaccination is currently one of the most effective measures for clinical PRRS prevention and control. However, in the face of the attack of heterologous strains, the protection efficiency of the attenuated vaccine is also low, and it cannot achieve clearing immunity, leading to the evolution or recombination of the virus. In addition, there is a risk of virulence reversal in pigs with attenuated vaccines, and even the spread of PRRSV can be caused, resulting in persistent infection. In recent years, the infection of highly pathogenic PRRSV-2 is still sporadic in my country, resulting in huge economic losses. With the large-scale vaccination in my country, the disease has gradually become one of the pig diseases that need to be purified in my country's pig farms. However, the existing commercial PRRSV-2 attenuated vaccine cannot distinguish between natural infection and vaccine immunity, resulting in huge challenges in purifying PRRS in my country. Therefore, it is urgent to develop a labeled PRRSV-2 attenuated vaccine that can be used in conjunction with the established serological differential diagnosis method to effectively distinguish between vaccine-immunized and naturally infected pigs, and ultimately achieve the goal of purifying the disease.

[0004] PRRSV contains 8 structural proteins, including membrane proteins (GP2a, E, GP3, GP4, GP5, ORF5 and M) and nucleocapsid protein (N). N protein is a multifunctional protein. It not only forms the nucleocapsid of the virus as a structural protein and participates in the assembly of the virus, but also interacts with host factors and participates in the regulation of the immune response induced by the virus after infecting pigs. N protein has good antigenicity and immunogenicity, and anti-PRRSV N protein antibodies can be detected 7 days after the virus infects pigs. Therefore, N protein is an ideal target for designing PRRS marker vaccines. Summary of the invention

[0005] The purpose of the present invention is to provide a porcine reproductive and respiratory syndrome virus marker attenuated vaccine strain and its application to solve the problems existing in the above-mentioned prior art.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] One of the technical solutions of the present invention is a porcine reproductive and respiratory syndrome virus marker attenuated vaccine strain (Arterivirus betaarterivirus) rSX-HD 2M1-F120, the attenuated vaccine strain was deposited in the General Microbiology Center of China Culture Collection Administration on February 21, 2025. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.46402.

[0008] The second technical solution of the present invention is that the porcine reproductive and respiratory syndrome virus marker attenuated vaccine strain rSX-HD 2M1 -Application of F120 in the preparation of porcine reproductive and respiratory syndrome virus vaccine.

[0009] The third technical solution of the present invention is that the porcine reproductive and respiratory syndrome virus marker attenuated vaccine strain rSX-HD 2M1 - Use of F120 in the preparation of a medicament for preventing and / or treating diseases caused by porcine reproductive and respiratory syndrome virus.

[0010] The fourth technical solution of the present invention is a vaccine, wherein the vaccine contains the porcine reproductive and respiratory syndrome virus marker attenuated vaccine strain rSX-HD 2M1 -F120.

[0011] A fifth technical solution of the present invention is the use of the vaccine in the preparation of medicines, wherein the medicines are used to prevent diseases caused by porcine reproductive and respiratory syndrome virus.

[0012] Based on the above technical solution, the present invention has the following technical effects:

[0013] The present invention provides a candidate strain of a porcine reproductive and respiratory syndrome marker attenuated vaccine, a preparation method and an application thereof, and at the same time evaluates the application of the marker attenuated vaccine in preventing pigs from being infected with PRRSV-2. The present invention selects the conservative nucleocapsid protein (N) of PRRSV-2 as the target protein, and uses reverse genetic technology to construct and successfully rescue a PRRSV chimeric virus in which the protein is replaced by the PRRSV-1N protein; then the chimeric virus is continuously propagated on MARC-145 cells for 120 generations to attenuate, and a PRRS marker vaccine candidate strain is prepared; after the candidate strain is immunized with pigs, it is used together with a matching competitive ELISA, which can be used for the differential diagnosis of natural infection and immunity of the marker vaccine candidate strain, providing a solid material basis for the development of PRRSV-2 marker vaccines, and at the same time providing a new strategy for the prevention, control and purification of PRRS in pigs. The PRRSV-2 marker vaccine of the present invention has broad application prospects in animal husbandry production. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1For PCR amplification of PRRSV genome fragment genes. Wherein, M is the standard molecular weight of DNA; 1 is fragment A (4106 bp); 2 is fragment B (4000 bp); 3 is fragment C (4001 bp); 4 is fragment D (3215 bp).

[0015] Figure 2 Overlapping PCR amplification of PRRSV-2SX-HD and PRRSV-1 N gene. M is the standard DNA molecular weight; 1 is the result of AscⅠ-1 amplification; 2 is the result of GZ11-G1 N-2 amplification; 3 is the result of AscⅠ-3 amplification.

[0016] Figure 3 The figure shows the construction of rSX-HD infectious clone. M is the standard molecular weight of DNA; 1 and 2 are the results of double restriction digestion of pBAC-SD16 vector; 3 is the result of double restriction digestion of PRRSV-1N gene obtained by amplification; 4 is the result of amplification of PRRSV-2N primer; 5 is the result of amplification of PRRSV-1N primer.

[0017] Figure 4 For rSX-HD 2M1 Chimeric virus rescue. The empty vector was used as the transfection control group; rSX-HD 2M1 For the construction of recombinant SX-HD 2M1 Plasmid transfection group.

[0018] Figure 5 Characterization of rSX-HD for PCR and sequencing 2M1 Chimeric virus. M is the molecular weight of DNA standard; A is the PCR identification of rSX-HD 2M1 Chimeric virus; B is sequencing identification of rSX-HD 2M1 Chimeric viruses.

[0019] Figure 6 Identification of rSX-HD for Western blot 2M1 Chimeric virus, in which α-tubulin is the internal reference protein.

[0020] Figure 7 For rSX-HD 2M1 Growth kinetics of chimeric viruses.

[0021] Figure 8 To pass TCID 50 Detect rSX-HD 2M1 Virus titers of different generations.

[0022] Fig. 9 The N gene of the progeny virus was amplified by PCR using genotype 1 primers and genotype 2 primers.

[0023] Fig.10 For rSX-HD 2M1 -F120 labeled attenuated vaccine candidate strain safety assessment. Among them, A is the temperature change of each group; B is the survival rate of each group; C is the antibody level of each group detected by IDEXX; D is the antibody level of each group detected by competitive ELISA.

[0024] Fig.11 For rSX-HD 2M1 -F120 infection of piglets after viremia and detoxification. A is the viremia of each group; B is the detoxification of the respiratory tract of each group; C is the detoxification of the intestine of each group.

[0025] Fig.12 For rSX-HD 2M1 -F120 infected piglets lung tissue dissection and HE staining. A is the lung observation of each group of piglets; B is the lung HE staining of each group of piglets.

[0026] Fig.13 For rSX-HD 2M1 -F120 labeled attenuated vaccine candidate strain immune protection evaluation. Among them, A is the temperature change of each group; B is the survival rate of each group; C is the antibody level of each group detected by IDEXX; D is the antibody level of each group detected by competitive ELISA.

[0027] Fig.14 For rSX-HD 2M1 -F120 immunized piglets were challenged with HP-PRRSV JX-A1 and the viremia and detoxification were observed. A is the viremia of each group; B is the detoxification of the respiratory tract of each group; C is the detoxification of the intestine of each group.

[0028] Fig.15 For rSX-HD 2M1 -F120 immunized piglets challenged with HP-PRRSV JX-A1 and lung tissue dissection and HE staining. A is the lung observation of piglets in each group; B is the lung HE staining of piglets in each group. DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or have been disclosed.

[0031] The present invention provides a porcine reproductive and respiratory syndrome virus marker attenuated vaccine strain (Arterivirus beta arterivirus) rSX-HD 2M1 -F120, the attenuated vaccine strain was deposited in the General Microbiology Center of China Culture Collection Administration on February 21, 2025. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.46402.

[0032] It should be noted that the rSX-HD 2M1 The full genome sequence of -F120 is shown in SEQ ID NO. 1. The highly pathogenic PRRSV-2 Shaanxi isolate (HP-PRRSV SX-HD) was used as the gene skeleton, and its gene sequence encoding the nucleocapsid protein (N) was replaced with the gene sequence of the PRRSV-1 N protein, named HP-PRRSV SX-HD 2M1 The original HP-PRRSV SX-HD N protein gene sequence is shown in SEQ ID NO.2, and the replaced PRRSV-1 N protein gene sequence is shown in SEQ ID NO.3.

[0033] rSX-HD 2M1 The method for constructing the whole genome sequence of -F120 includes the following steps:

[0034] (1) Using the gene of HP-PRRSV SX-HD strain as a template, the full-length gene was amplified in four segments, and the four gene fragments were sequentially connected to the pBAC low-copy vector to construct the full-length cDNA gene sequence of the SX-HD strain, which was named SX-HD;

[0035] (2) Using the full-length cDNA of the SX-HD gene constructed above as the gene skeleton, the gene sequence encoding the N protein on it was completely replaced with the gene sequence of the PRRSV-1 N protein using basic molecular biological techniques to construct a recombinant chimeric PRRSV genome sequence, namely HP-PRRSV SX-HD 2M1 .

[0036] Attenuated vaccine strain rSX-HD 2M1 -The preparation method of F120 comprises the following steps:

[0037] (1) Successfully constructed recombinant chimeric HP-PRRSV SX-HD 2M1 The full-length cDNA gene was transfected into MARC-145 cells, and a recombinant chimeric virus was successfully rescued and named rSX-HD 2M1 .

[0038] (2) Chimeric virus rSX-HD2M1 The candidate vaccine strain rSX-HD was obtained by continuous passage 120 times on MARC-145 cells. 2M1 -F120. After immunizing pigs with this candidate strain, it can protect pigs from PRRSV-2 infection and produce antibodies against PRRSV-1N protein. After immunizing pigs with it, the competitive ELISA established to specifically detect PRRSV-2N protein antibodies can distinguish pigs immunized with the marker vaccine candidate strain and pigs naturally infected with PRRSV-2.

[0039] The embodiment of the present invention also provides the porcine reproductive and respiratory syndrome virus marker attenuated vaccine strain rSX-HD 2M1 -Application of F120 in the preparation of porcine reproductive and respiratory syndrome virus vaccine.

[0040] In some specific embodiments, the vaccine is a live attenuated vaccine or an inactivated vaccine of porcine reproductive and respiratory syndrome virus.

[0041] In some specific embodiments, the vaccine is a porcine reproductive and respiratory syndrome virus marker attenuated vaccine strain rSX-HD 2M1 -F120 is the only active ingredient or one of the active ingredients.

[0042] The embodiment of the present invention also provides the porcine reproductive and respiratory syndrome virus marker attenuated vaccine strain rSX-HD 2M1 - Use of F120 in the preparation of a medicament for preventing and / or treating diseases caused by porcine reproductive and respiratory syndrome virus.

[0043] The embodiment of the present invention also provides a vaccine, wherein the vaccine contains the porcine reproductive and respiratory syndrome virus marker attenuated vaccine strain rSX-HD 2M1 -F120.

[0044] In some specific embodiments, the vaccine further contains a pharmaceutically acceptable excipient.

[0045] The embodiment of the present invention also provides the use of the vaccine in preparing medicines, and the medicines are used to prevent diseases caused by porcine reproductive and respiratory syndrome virus.

[0046] The present invention uses N protein as the coating antigen, and establishes a competitive ELISA for specific detection of PRRSV-2 antibodies based on nano antibodies and horseradish peroxidase (HRP) fusion protein as sensitive probes, and identifies the antigenic epitope of the nano antibody. Based on the above research foundation, the infectious clone of the PRRSV-2SX-HD strain was constructed using reverse genetic technology, and the N gene of PRRSV-2SX-HD was replaced with the PRRSV-1N gene. When used in conjunction with the established competitive ELISA detection method, it can distinguish between natural infection and immunity of the candidate strain of the marker vaccine, providing a material basis for the development of PRRSV marker vaccines.

[0047] The present invention utilizes the reverse genetics operation platform of PRRS virus (PRRSV) and uses the genotype 2 highly pathogenic PRRSV (HP-PRRSV) isolate SX-HD as the gene skeleton to successfully construct a recombinant virus (PRRSV SX-HD) in which the amino acid sequence of the nucleocapsid (N) protein of genotype 1 PRRSV is substituted for the N protein in the SX-HD strain. 2M1 ) full genome sequence. The present invention constructs a recombinant chimeric PRRSV SX-HD 2M1 The infectious clone was transfected into MARC145 cells and the recombinant chimeric virus rSX-HD was successfully obtained. 2M1 , and then the recombinant chimeric virus rSX-HD 2M1 After continuous passage on MARC145 for 120 generations, the attenuated chimeric strain rSX-HD was obtained. 2M1 -F120. rSX-HD 2M1 -28 days after F120 immunization, pigs were challenged with HP-PRRSV JX-A1 strain. Clinical symptoms and immune protection results were analyzed and found that rSX-HD 2M1 -F120 attenuated strain has good safety and has good immune protection effect against HP-PRRSV JXA1 strain. The candidate attenuated strain obtained by the present invention, combined with the specific detection method of genotype 2 PRRSV antibody established in the early stage, can provide technical support for the prevention, control and purification of genotype 2 PRRSV infection in pigs.

[0048] The experimental methods in the following examples where specific conditions are not specified were generally performed under conventional conditions, such as those described in Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) or conditions provided by the manufacturer.

[0049] Example 1

[0050] Construction of chimeric PRRSV infectious clone

[0051] 1.1 Construction of infectious clone of HP-PRRSV SX-HD strain

[0052] According to the whole genome sequence of genotype 2 HP-PRRSV SX-HD strain (GenBank ID: KP793736), 4 pairs of specific primers for amplifying the whole genome were designed. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. and their sequences are shown in Table 1.

[0053] Table 1 Primer sequences for HP-PRRSV SX-HD whole genome amplification

[0054]

[0055] HP-PRRSV SX-HD strain was inoculated into MARC-145 cells, and the virus culture fluid was harvested after 72 hours when the cell lesion reached 80%. Repeated freezing and thawing 3 times, centrifuged at 2000×g for 10 minutes, and the supernatant was taken. Viral RNA was extracted according to the instructions of the viral RNA extraction kit (Beijing Quanshijin Biology), and the extracted RNA was reverse transcribed into cDNA according to the instructions of the reverse transcription kit (Beijing Quanshijin Biology). Using this as a template, Q5 high-fidelity enzyme (NEB) was used to amplify each segment of the genome. The amplification system is shown in Table 2.

[0056] Table 2 PCR amplification system for amplifying HP-PRRSV SX-HD genome sequence

[0057]

[0058]

[0059] The amplification conditions were pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, and extension at 72°C for 4 min, for a total of 34 cycles; and extension at 72°C for 7 min.

[0060] The PCR products were subjected to 1% agarose gel electrophoresis, and four gene fragments with expected sizes of 4106 bp, 4000 bp, 4001 bp and 3215 bp were successfully amplified ( Figure 1 ), named fragments A, B, C and D. Then, gel recovery was performed according to the instructions of the DNA gel recovery kit (Genstar), and the recovered products of the four fragments were connected to the pEASY-Blunt Simple vector (Beijing Quanshijin Biotechnology), and after sequencing verification, the obtained recombinant positive plasmids were named pEASY-SX-HD-A, pEASY-SX-HD-B, pEASY-SX-HD-C and pEASY-SX-HD-D.

[0061] The pBAC vector was double-digested and then homologously recombined with the 4-segment recovery product to finally obtain a plasmid containing the full-length cDNA of the SX-HD genome. The reaction system is shown in the following table (Table 3).

[0062] Table 3 Double restriction enzyme digestion system of vector pBCA and amplified PCR products

[0063]

[0064] The fragments cut by enzymes were subjected to homologous recombination using a homologous recombination kit (Nanjing Novizan Biotechnology Co., Ltd.). The recombination system is shown in Table 4 below.

[0065] Table 4 Homologous recombination system of commercial vectors and PCR amplification products

[0066]

[0067]

[0068] Take 10 μL of the above homologous recombination ligation product and add 50 μL DH10B competent cells, let it stand on ice for 30 min, heat shock at 42°C for 90 s, let it stand on ice for 2 min, add 800 μL SOC (2 g tryptone, 0.5 g yeast extract, 0.058 g sodium chloride, 0.0186 g potassium chloride, dissolved in 96 mL ultrapure water, autoclave, add 2 ml 20% glucose, 1 ml 1 M MgCl 2 and 1 ml 1 M MgSO 4 ), cultured at 37℃ and 200rpm for 2h, then spread on LB plate containing chloramphenicol (tryptone 10g, yeast extract 5g, sodium chloride 10g, agar 15g, deionized water supplemented to 1000mL), and cultured at 37℃ overnight. Pick a single colony and inoculate it into 10mL LB liquid medium (tryptone 10g, yeast extract 5g, sodium chloride 10g, deionized water supplemented to 1000mL), cultured at 37℃ with shaking for 12h, and after identification by bacterial liquid PCR, the positive bacterial liquid was sent for sequencing, and the positive plasmid was named pBAC-rSX-HD.

[0069] 1.2 Construction of infectious clones by replacing the pBAC-SX-HD N protein gene sequence with the PRRSV-1 N protein gene sequence

[0070] 1.2.1 Amplification of pBAC-SX-HD and PRRSV-1 N protein gene sequences

[0071] The gene sequence encoding N protein of the constructed recombinant plasmid pBAC-rSX-HD was replaced with the N gene of the PRRSV-1GZ11-G1 strain. The cDNA of pBAC-rSX-HD and PRRSV-1GZ11-G1 were used as templates and primers AscⅠ-F, GZ11-G1 NR and GZ11-G1 NF, RsrⅡ-R (Table 5) were used for amplification, and the two fragments were named AscⅠ-1 and GZ11-G1 N-2, respectively.

[0072] Table 5 Primers for amplifying pBAC-rSX-HD and PRRSV-1 N protein gene sequences

[0073]

[0074] The products recovered from AscⅠ-1 and GZ11-G1 N-2 gel were used as templates in a volume ratio of 1:3, and primers AscⅠ-F and RsrⅡ-R were used for overlapping PCR amplification. The amplified fragment was named AscⅠ-3. The PCR amplification system is shown in Table 6.

[0075] Table 6 Overlapping PCR amplification system

[0076]

[0077]

[0078] The amplification conditions were 98°C for 30 s, 98°C for 10 s, 55°C for 30 s, 72°C for 3 min, and 72°C for 7 min, for 34 cycles.

[0079] The PCR products were electrophoresed on 1% agarose gel. The results showed that the amplified AscⅠ-1 (2937 bp) and GZ11-G1N-2 (591 bp) were consistent with the expected size, and the size of the AscⅠ-3 gene was consistent with the expected size (3505 bp). Figure 2 ). Perform gel recovery according to the instructions of the DNA gel recovery kit.

[0080] 1.2.2 Enzyme digestion and ligation

[0081] pBAC-rSX-HD and AscⅠ-3 were double-digested with AscⅠ and RsrⅡ endonucleases at 37℃ for 4h. The digestion products were electrophoresed on 1% agarose gel to obtain fragments of pBAC-SX-HD (19953bp) and AscⅠ-3 (3505bp) after digestion ( Figure 3 ), which was consistent with the expected size, was ligated using T4 DNA ligase at 16°C overnight after gel recovery.

[0082] 1.2.3 Conversion

[0083] The ligation product was transformed into DH10B competent cells, cultured at 37°C overnight, and single clones were picked for bacterial solution PCR.

[0084] 1.2.4 Plasmid extraction

[0085] A single clone that was positive for PCR identification and sequenced correctly was selected for expansion culture. The plasmid was extracted using the Qiagen QIAfilter Plasmid Kits according to the instructions, and the extracted plasmid was used as a template and PCR amplified using the primers of PRRSV-1N. The PRRSV-1N gene was successfully amplified ( Figure 3 ). The plasmid and amplified product were sent to Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the infectious clone was successfully constructed and named pBAC-SX-HD 2M1 .

[0086] The nucleotide sequence of PRRSV rSX-HD F120 is:

[0087]

[0088] The nucleotide sequence of PRRSV2 SX-HD-N is as follows:

[0089] SEQ ID NO.2: ATGCCAAATAACAACGGCAAGCAGCAAAAGAAAAAGAAGG GGAATGGCCAGCCAGTCAATCAGCTGTGCCAAATGCTGGGTAAGATCATCGCCCAACAAAACCAGTCCAGAGGCAAGGGACCGGGGAAGAAAAATAGGAAGAAAAACCCGGAGAAGCCCCATTTCCCTCTAGCGACTGAAGATGACGTCAGGCATCACTTTACCCCTAGTGAGCGGCAATTGTGTCTGTCGTCGATCCAGACTGCCTTCAATCAGGGCGCTGGAACTTGTGCCCTGTCAGATTCAGGGAGGATAAGTTACACTGTGGAGTTTAGTTTGCCGACGCAACATACTGTGCGTCTGATCCGCGCCACAGCATCACCCTCAGCATGA。

[0090] The nucleotide sequence of PRRSV1 GZ11-N is as follows:

[0091] SEQ ID NO.3: ATGGCCGGTAAAAATCAGAGCCAGAAGAAAAAGAAGAATAC AGCTCCAATGGGGAATGGCCAGCCAGTCAATCAACTGTGCCAGTTGCTGGGTGCAATGATAAAGTCCCAGCGCCAGCAACCTAGGGGGGGACAGGCAAAAAAGAAACGTCCTGAGAAGCCACATTTTCCCCTAGCTGCTGAAGATGACATTCGGCACCATCTCACCCAGACCGAACGTTCCCTCTGCCTGCAATCGATCCAGACGGCTTTTAATCAAGGCGCAGGAACTGCGTCGCTTTCATCCAGCGGGAAGGTCAGTTTTCAGGTTGAGTTCATGCTGCCGGTTGCTCATACAGTGCGCCTGATTCGCGTGACTTCTACATCCGCCAGTCAGGGTGCGAATTAA。

[0092] Example 2

[0093] Preparation of candidate strains of PRRSV attenuated vaccine

[0094] 2.1 Rescue of chimeric PRRSV

[0095] MARC-145 cells with good growth status were plated in 6-well plates and incubated at 37°C with 5% CO 2 After culturing for 16-18 hours, the cells were transfected with plasmids after the confluence reached 80%. 200 μL Opti-MEM, 2 μg pBAC-rSX-HD 2M1 The plasmid and 6 μL transfection reagent (X-tremeGENE HP DNA Transfection Reagent, Roche) were mixed and allowed to stand at room temperature for 18 min. The old culture medium was discarded, 1.8 mL serum-free DMEM was added, and the above complex was evenly added to the 6-well cell plate, gently mixed, and incubated at 37°C with 5% CO 2 After 10 h of culture, the old medium was discarded and replaced with 3% FBSDMEM. After 3 days of culture, the cytopathic effect (CPE) was observed under an inverted microscope. The results showed that pBAC-SX-HD 2M1 Obvious CPE appeared 72h after transfection ( Figure 4 ), the control group had no CPE, indicating that rSX-HD 2M1 The chimeric virus was successfully rescued.

[0096] 2.2rSX-HD 2M1 Identification of chimeric viruses

[0097] 2.2.1 RT-PCR detection of SX-HD 2M1 Recombinant virus N gene

[0098] Take 500 μL chimeric virus rSX-HD 2M1 RNA was extracted from the supernatant of infected MARC-145 cells by TRIzol method and reverse transcribed into cDNA. PCR amplification was performed using specific primers N1-F, N1-R and N2-F, N2-R (Table 7) for the N protein gene of PRRSV-1 and -2, respectively. After completion, 10 μL of the product was subjected to 1% agarose gel electrophoresis.

[0099] The results showed that the gene of PRRSV-1N protein could be successfully amplified using primers N1-F and N1-R, while the PRRSV-2N gene could not be amplified using primers N2-F and N2-R. Figure 5 A), the amplified PCR product was sent to Bio-Tech for sequencing, and the results showed that rSX-HD 2M1 The chimeric virus successfully replaced the PRRSV-1N gene with the PRRSV-2N gene ( Figure 5 (middle B).

[0100] Table 7PRRSV-1 and -2N gene amplification primers

[0101]

[0102] 2.2.2 Western blot detection of rSX-HD 2M1 Recombinant chimeric virus N protein

[0103] rSX-HD and chimeric virus rSX-HD were used at 0.1 MOI 2M1 Infect MARC-145 cells, collect cell samples 48 hours after infection, lyse infected cells with NP40, perform SDS-PAGE, and then transfer to membrane. Use 5% skim milk powder to block at room temperature for 2 hours; wash the membrane 3 times with 0.05% PBS'T, 5 minutes each time, incubate with monoclonal antibody 6D10 (monoclonal antibody against common epitopes of N protein of PRRSV-1 and -2, 1:2000) or Nb1 (specific anti-PRRSV-2 N protein nanoantibody) at room temperature for 2 hours, wash the membrane 3 times with 0.05% PBS'T, 5 minutes each time; use HRP G@M 1:5000 as secondary antibody to incubate at room temperature for 1 hour, wash the membrane 3 times with 0.05% PBS'T, 5 minutes each time; chemical ECL luminescence color development.

[0104] The results showed that monoclonal antibody 6D10 could detect both rSX-HD and chimeric virus rSX-HD 2M1 The N protein of rSX-HD was detected by the nanoantibody Nb1. Figure 6 ).

[0105] 2.2.3 Chimeric virus rSX-HD 2M1 Determination of growth curve

[0106] (1) MARC-145 cells with good growth status were digested with trypsin and counted at 1×10 5 125 μL per well of a 96-well plate was plated at 37°C with 5% CO 2 After 16 h of culture, the cell confluence reached 80%.

[0107] (2) SX-HD, rSX-HD and chimeric virus rSX-HD 2M1 Make 10-fold dilutions in sequence, make 8 replicate wells for each dilution, and take 10 -3 -10 -7 The dilutions were added to the corresponding 96-well plates and incubated at 37°C with 5% CO 2 Incubate for 1 hour under the same conditions, then change to 3% DMEM maintenance medium and continue culturing. Collect supernatants at 12, 24, 36, 48, 60, 72 and 84 hours, and measure the virus titer. Calculate TCID according to the Reed-Muench method 50 , draw the virus growth curve.

[0108] The results showed that the chimeric virus rSX-HD 2M1 The growth kinetics curve is consistent with that of the parental SX-HD and rSX-HD ( Figure 7 ).

[0109] 2.3 Preparation of PRRSV marker vaccine candidate strains

[0110] The chimeric virus rSX-HD was attenuated by continuous passage. 2M1 Serial passage on MARC-145 cells. Chimeric viruses were inoculated into monolayers of MARC-145 cells at 37°C with 5% CO 2 After 72 hours of culture, the cytopathic effect reached about 80%, and the virus was collected by repeated freezing and thawing for 3 times. Then the collected virus was inoculated into new MARC-145 cells in the same way, and the cells were continuously passaged to the 120th generation. The TCID titers of the progeny viruses at different generations were detected. 50 The specific steps are the same as 2.2.3. Evaluate the proliferation of chimeric viruses of different generations on MARC-145 cells during the passage process.

[0111] The results showed that the titer of the progeny chimeric virus increased with the increase of passage number. When it reached the 80th passage, the virus proliferation ability basically reached the highest value (7.8TCID 50 / mL) also tended to be stable ( Figure 8 ).

[0112] At the same time, the chimeric virus rSX-HD was tested every 10 generations. 2M1 RT-PCR detection was performed, and the PCR products were sent for sequencing to evaluate the stability of the PRRSV-1N protein gene of the chimeric virus. The PCR results showed that the use of PRRSV-1N upstream and downstream primers N1-F and N1-R could amplify the N gene of the P10-P120 progeny virus, and the sequence was correct without mutation. However, the use of PRRSV-2 upstream and downstream primers N2-F and N2-R did not amplify the P10-P120 progeny virus containing the PRRSV-2N gene ( Fig. 9 ). The above results show that the chimeric virus rSX-HD 2M1 The chimeric PRRSV-1N gene was stable after continuous passage in vitro without any loss or mutation.

[0113] Example 3

[0114] Preparation of PRRSV-2 marker attenuated vaccine and its safety and protection evaluation

[0115] 3.1 Preparation of chimeric virus at P120

[0116] There will be a P120 generation of CPE rSX-HD2M1 The inoculated MARC-145 cells were frozen and thawed three times, centrifuged at 8,000g for 10 min, and the supernatant was collected, aliquoted, and stored in a -80℃ refrigerator for later use. One tube of virus liquid was taken to infect MARC-145 cells for virus amplification and the TCID 50 1×10 7 TCID 50 / mL, aliquot and freeze.

[0117] 3.2 Vaccine purity test

[0118] Sterility test was carried out according to the current method in the Appendix of the Pharmacopoeia of Veterinary Medicine of the People's Republic of China, Volume III, 2020 Edition, China Agricultural Press, 2020, hereinafter referred to as the Chinese Pharmacopoeia of Veterinary Medicine, and no bacteria or mold growth was observed. Mycoplasma test and exogenous virus test were carried out according to the current method in the Appendix of the Chinese Pharmacopoeia of Veterinary Medicine, and no mycoplasma growth and exogenous virus contamination were observed.

[0119] 3.3 Safety Inspection

[0120] Twenty 4-week-old PRRSV antibody and antigen negative pigs were randomly divided into 4 groups, 5 pigs in each group, and marked as groups A, B, C, and D. Group A was inoculated with SX-HD, and each pig was injected intramuscularly with 2 mL (1×10 5 TCID 50 / mL); Group B was inoculated with the same dose of rSX-HD 2M1 ; Group C was immunized with the same dose of rSX-HD 2M1 -F120 attenuated marker vaccine; 2 mL of DMEM culture medium was injected into the neck muscle of group D. The four groups were raised according to the conventional method, and serum, nasal swabs and anal swabs were collected from each pig in each group on days 1, 3, 5, 7, 10, 14 and 21 after vaccination for testing. After 21 days, the piglets were euthanized and autopsied to observe whether there were any pathological changes in the internal organs, and photos were taken for record. In addition, lung tissue samples were collected and pathological sections were made, and the tissue lesions were observed by HE staining.

[0121] The results showed that all rSX-HD 2M1 -F120 attenuated marker vaccine in pigs with body temperature rise of no more than 1°C, retention time of no more than 24h, in line with the current "People's Republic of China Veterinary Pharmacopoeia" safety inspection regulations. 2M1 During the 21-day period of the -F120 labeled vaccine, the five test pigs had no adverse reactions, no respiratory symptoms and other typical symptoms of PRRS, and no piglet deaths. 2M1 All piglets in the inoculated group showed typical symptoms of PRRS, including high fever ( Fig.10Middle A), red skin, cyanosis of the ear tips, more eye secretions, difficulty breathing, abdominal breathing, ataxia, etc. The mortality rate of piglets in the SX-HD vaccination group reached 80%, and the rSX-HD 2M1 The mortality rate of the inoculated piglets was 60% ( Fig.10 The control group did not show any clinical symptoms or death. The commercial IDEXX ELISA kit was used to detect N protein antibodies ( Fig.10 C), the result shows that SX-HD can be detected 2M1 The antibodies produced by cELISA did not detect SX-HD 2M1 Antibodies produced ( Fig.10 (middle D).

[0122] Serum, nasal swab, and anal swab samples were tested by RT-qPCR (Wuhan Greentech Biotechnology) at 0, 1, 3, 7, 10, 14, and 21 days after vaccination in each group to evaluate viremia and virus shedding. 2M1 In all groups, PRRSV RNA was detected in serum samples on the first day after vaccination, and the virus titer reached a peak on the 10th day after vaccination, and then the virus titer in the serum decreased slightly. 2M1 -PRRSV RNA was detected in the serum of the F120 group on the third day after inoculation, but the virus titer was much lower than that of the above two groups. No viremia was detected in the control group at any time point ( Fig.11 Middle A). SX-HD and rSX-HD 2M1 After the third day of vaccination, PRRSV RNA was detected in both nasal and anal swabs, and the peak of virus excretion was between the seventh and ninth days after vaccination. 2M1 - PRRSV RNA was detected in nasal swabs and anal swabs of the F120-vaccinated group on days 7 and 10, respectively. 2M1 The respiratory tract and fecal toxin excretion of the challenged piglets was significantly higher than that of the rSX-HD 2M1 -F120 Attack Group ( Fig.11 (B, C).

[0123] Autopsy revealed rSX-HD 2M1 -All piglets in the F120 vaccination group had no obvious lung lesions ( Fig.12 Middle A), HE staining of the lungs showed no obvious abnormalities in all piglets ( Fig.12 B). In SX-HD and rSX-HD 2M1 In the group, the lungs showed diffuse interstitial pneumonia, edema, and congestion ( Fig.12 Middle A), HE staining of the lungs showed that the alveolar septa of all piglets were widened ( Fig.12(middle B).

[0124] These results show that the rSX-HD constructed by the present invention 2M1 -F120-labeled attenuated vaccine strain has good safety, and the attenuated vaccine immunization combined with the previously established specific anti-PRRSV-2 antibody ELISA can achieve differential diagnosis from wild-type PRRSV-2 infection.

[0125] 3.4 Protective inspection

[0126] Twenty 4-week-old PRRSV antibody and antigen negative piglets were randomly divided into 4 groups, 5 pigs in each group, marked as Group A, B, C and D. 2M1 -F120 attenuated marker vaccine, 2 mL (1×10 5 TCID 50 / mL); the same dose of commercial PRRS attenuated vaccine (TJM-F92 strain) was immunized in group B; 2mL of DMEM culture medium was injected into the neck muscle of groups C and D. The four groups were raised according to the conventional method, and serum, nasal swabs, and anal swabs were collected on days 1, 3, 5, 7, 10, 14, and 21 after immunization to detect PRRSV RNA. 21 days after immunization, 2mL of HP-PRRSV JXA1 (10 5 TCID 50 / head), and 2 mL of sterile PBS was injected into the neck muscle of group D as the control group. The piglets were kept and observed for 21 days, and the body temperature was measured daily. The incidence and mortality of piglets in each group were recorded, and nasal swabs, anal swabs and serum were collected for PRRSV RNA detection on days 1, 3, 5, 7, 10, 14, and 21 after the challenge. After 21 days, the surviving pigs were euthanized and autopsied. The lungs were observed for lesions, and photos were taken for record. Lung tissue samples were collected and pathological sections were made, and the lesions of lung tissue were observed by HE staining.

[0127] After immunization, there were no adverse reactions in the piglets in each group before the virus challenge. After the virus challenge, the 5 piglets in groups A, B and D did not develop any disease 21 days after the virus challenge, and no piglet death occurred. The 5 pigs in group C developed disease 3 to 5 days after the virus inoculation, showing poor spirits, loss of appetite, salivation, and high fever. Among them, 4 pigs had a temperature rise to 41°C ( Fig.13 Middle A); breathing difficulties, abdominal breathing, cyanosis of the ear tips, dark purple, and obvious blue-purple patches on the skin. Finally, 3 piglets died, with a mortality rate of 60% ( Fig.13 (middle B).

[0128] The anti-PRRSV N protein antibodies in the serum were measured using a commercial IDEXX ELISA kit.

[0129] The results showed that similarly, no anti-N protein antibodies were detected in the negative control group D. Groups A and B produced anti-N protein antibodies from 14 days after immunization until 21 days after the challenge, and maintained high antibody levels. Group C detected antibodies from 10 days after the challenge, reaching a peak on the 21st day ( Fig.13 C); the antibodies in the serum were detected by using a competitive ELISA that specifically detects anti-PRRSV-2N protein antibodies. The results showed that after vaccination, anti-PRRSV-2N protein antibodies were only detected in group B; after challenge, anti-PRRSV-2N protein antibodies were detected in pigs in groups A, B, and C ( Fig.13 The above results suggest that the use of labeled attenuated vaccine immunization combined with the established competitive ELISA for detecting anti-PRRSV-2N protein antibodies can effectively distinguish pigs immunized with labeled vaccines and infected with wild viruses.

[0130] Piglet sera were collected on days 0, 7, 14, and 21 after immunization and on days 1, 3, 5, 7, 10, 14, and 21 after challenge, and viral load was detected by RT-PCR to evaluate viremia and shedding.

[0131] The results show that rSX-HD 2M1 -The PRRSV RNA copy number in the serum samples of the F120 and TJM-92 immunization groups reached the highest level on the 7th day after immunization and then gradually decreased ( Fig.14 After the virus attack, the number of PRRSV RNA copies in serum samples gradually increased, reaching a peak on the 10th day and then gradually decreasing. By the 21st day, rSX-HD 2M1 -PRRSV RNA was not detected in piglets vaccinated with F120 and TJM-92 ( Fig.14 In addition, the above results also showed that from the 5th to the 21st day after the virus attack, rSX-HD 2M1 The number of PRRSV RNA copies in the serum of piglets immunized with -F120 and TJM-92 was significantly lower than that in the HP-PRRSVJXA1 challenge group ( Fig.14 A).

[0132] For detox situations, rSX-HD 2M1 PRRSV RNA was detected in nasal and anal swabs of both the F120 and TJM-92 immunization groups on the 7th day after immunization, reaching a peak on the 14th day ( Fig.14 In B and C). After challenge, PRRSV RNA was detected in the HP-PRRSV JXA1 challenge group on the third day after challenge, and the virus titer reached a peak on the 10th day. In addition, the respiratory tract and fecal virus excretion of the HP-PRRSV JXA1 challenge group on the 7th and 21st days after challenge was significantly higher than that of the rSX-HD2M1 -F120 and TJM-92 immunization groups ( Fig.14 The above results show that rSX-HD 2M1 -F120 and TJM-F92 immunizations significantly reduced the number of PRRSV RNA copies in the serum, nasal swabs and anal swabs of challenged piglets.

[0133] No obvious lung damage and histopathological changes were found in the piglets of groups A, B and D after autopsy (Table 8). The results of lung HE staining showed that the alveoli and alveolar septa were normal, and no obvious pathological changes were found. The autopsy of piglets in group C showed thymic atrophy, pericardial effusion and pulmonary hemorrhage ( Fig.15 Middle A). HE staining of the lungs showed that pigs in group C developed exudative pneumonia and interstitial pneumonia, which were manifested by swelling and thickening of the alveolar walls. In severe cases, the alveolar walls were damaged, some capillaries were congested, and the alveoli were dilated ( Fig.15 The above results show that rSX-HD 2M1 -F120 provides complete immune protection against HP-PRRSV JXA1.

[0134] Table 8 Vaccine protection test results

[0135]

[0136]

[0137] In summary, the rSX-HD prepared by the present invention 2M1 -F120 marker attenuated vaccine candidate strain has good safety and can effectively prevent blue ear disease caused by genotype 2 PRRSV JXA1 strain. Moreover, the marker vaccine immunization combined with the competitive ELISA for detecting anti-PRRSV-2N protein antibodies established in the early stage can achieve differential diagnosis from natural infection of PRRSV-2.

[0138] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A porcine reproductive and respiratory syndrome virus marker attenuated vaccine strain (Arterivirus betaarterivirus) rSX-HD 2M1 -F120, characterized in that The attenuated vaccine strain was deposited in the General Microbiology Center of China Culture Collection Administration on February 21, 2025. The deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.46402.

2. The porcine reproductive and respiratory syndrome virus marker attenuated vaccine strain rSX-HD according to claim 1 2M1 -Application of F120 in the preparation of porcine reproductive and respiratory syndrome virus vaccine.

3. The use according to claim 2, characterized in that: The vaccine is a live attenuated vaccine or an inactivated vaccine of porcine reproductive and respiratory syndrome virus.

4. The use according to claim 2, characterized in that: The vaccine is the porcine reproductive and respiratory syndrome virus marker attenuated vaccine strain rSX-HD described in claim 1 2M1 -F120 is the only active ingredient or one of the active ingredients.

5. The porcine reproductive and respiratory syndrome virus marker attenuated vaccine strain rSX-HD according to claim 1 2M1 -The use of F120 in the preparation of medicines, characterized in that, The medicine is used for preventing and / or treating diseases caused by porcine reproductive and respiratory syndrome virus.

6. A vaccine, characterized in that The vaccine contains the porcine reproductive and respiratory syndrome virus marker attenuated vaccine strain rSX-HD described in claim 1 2M1 -F120.

7. The vaccine according to claim 6, characterized in that The vaccine also contains pharmaceutically acceptable excipients.

8. Use of the vaccine according to claim 6 or 7 in the preparation of medicines, characterized in that: The medicine is used for preventing diseases caused by porcine reproductive and respiratory syndrome virus.