Monooxygenase as well as coding gene and application thereof

Abstract

The invention discloses monooxygenase as well as a coding gene and application thereof. The amino acid sequence of the monooxygenase is as shown in SEQ ID NO. 1, and the coding gene is as shown in SEQ ID NO. 2. The monooxygenase provided by the invention has excellent catalytic performance on degradation of steroid compounds, can be used for treating fermentation waste residues containing steroid hormones, has a removal effect on androstenedione, and also can be used for degrading steroid hormones in wastewater and environments.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a monooxygenase and a coding gene thereof and an application thereof in the restoration / treatment of steroid hormone pollution. Background Art

[0002] Steroid hormones play an important role in the healthy development and aging of organisms and are the second largest drug class after antibiotics. Steroids are steroid hormones that are widely distributed in the biological world and have many clinical applications, such as anti-tumor drugs, antibacterial agents, and anti-allergic agents.

[0003] Androstenedione is a representative member of the C-19 androgens that are endocrine disruptors in the environment. It is an important intermediate of many steroid drugs and is often used to treat ovarian dysfunction, breast cancer and male developmental delay. Androstenedione in the environment comes from agriculture, industry and medicine, etc. It can have serious effects on humans and animals at extremely low concentrations, including interfering with the reproductive development of aquatic organisms, inducing hermaphroditism, and increasing the risk of human breast cancer and testicular cancer through enrichment and transmission.

[0004] As the scale of steroidal drug production in my country expands, the wastewater and waste residue generated in the production process are increasing. At present, the treatment methods for waste residue containing steroidal hormone androstenedione include landfill incineration, hydrothermal treatment, alkaline heat treatment and advanced oxidation, and the wastewater treatment methods include adsorption and photocatalysis. These treatment methods are often accompanied by high energy consumption, high cost, incomplete removal, secondary pollution and difficulty in large-scale application. In contrast, bioenzymatic treatment has the advantages of high efficiency, low cost, low energy consumption and low equipment requirements, but no one in China has applied enzymatic treatment to the treatment of steroidal waste residue and wastewater.

[0005] In addition, the incineration method is a treatment process that evaporates the water in the waste residue and then incinerates it. The wastewater is treated by the treatment plant, but androstenedione residues are still detected in the surrounding environment. Therefore, in order to efficiently and scientifically repair androstenedione pollution in the environment, it is necessary to use enzymatic methods to convert androstenedione to solve it from the source. Enzymatic methods are of great significance for reducing ecological risks and maintaining human health, and can also provide a reference for enzymatic treatment of waste residues and wastewater. Summary of the invention

[0006] In view of the deficiencies of the prior art, the present invention provides a monooxygenase and a gene encoding the same and applications thereof in the remediation / treatment of steroid hormone pollution.

[0007] To achieve the above object, the present invention adopts the following technical solution:

[0008] In one aspect, the present invention provides a monooxygenase, wherein the amino acid sequence of the monooxygenase is shown in SEQ ID NO.1.

[0009] In another aspect, the present invention provides a gene encoding the above monooxygenase, and the sequence of the gene encoding is shown as SEQ ID NO.2.

[0010] In yet another aspect, the present invention provides a recombinant vector comprising the above encoding gene.

[0011] Preferably, the recombinant vector is pET-28a comprising the above encoding gene.

[0012] In yet another aspect, the present invention provides a recombinant strain comprising the above encoding gene or recombinant vector.

[0013] Preferably, the host bacteria of the recombinant strain is E. coli BL21 (DE3).

[0014] In yet another aspect, the present invention provides use of the above monooxygenase, the above encoding gene, the above recombinant vector or the above recombinant strain in catalyzing the degradation of steroid compounds.

[0015] Preferably, the steroid compound is an androgen, preferably androstenedione.

[0016] In the technical solution of the present invention, the pH at which the monooxygenase catalyzes the degradation of steroid compounds is 7.0-8.0.

[0017] In the technical solution of the present invention, the temperature at which the monooxygenase catalyzes the degradation of steroid compounds is 30-35°C.

[0018] In yet another aspect, the present invention provides use of the above-mentioned monooxygenase, the above-mentioned encoding gene, the above-mentioned recombinant vector or the above-mentioned recombinant strain in the remediation / treatment of steroid hormone pollution.

[0019] Preferably, the method is used in catalyzing the degradation of steroid compounds contained in water or soil, or in treating waste residues containing steroid hormones.

[0020] The above technical solution has the following advantages or beneficial effects:

[0021] The present invention provides a monooxygenase and its encoding gene and its application in the restoration / management of steroid hormone pollution. The monooxygenase encoding gene in the present invention is derived from the Burkholderia metallica strain, encoding a total of 364 amino acids, with a protein molecular weight of 40.81 kDa, the encoding gene sequence is shown in SEQ ID NO.2, and the amino acid sequence is shown in SEQ ID NO.1. The monooxygenase provided by the present invention has excellent catalytic performance for the degradation of steroidal compounds, especially androstenedione, and can be used to treat fermentation waste residues containing steroid hormones, and can also be used to degrade steroid hormones in wastewater and the environment. The optimal pH for the degradation of steroidal compounds catalyzed by the monooxygenation provided by the present invention is 7.0-8.0, and the optimal temperature is 30-35°C. It has a high degradation activity for common androgens, especially androstenedione, and its degradation efficiency reaches 100%. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 is a three-dimensional structure diagram of the monooxygenase in Example 1;

[0023] Figure 2 This is a protein gel image of the monooxygenase in Example 3;

[0024] Figure 3 This is a diagram showing the degradation effect of the monooxygenase in Example 4 at different pH values;

[0025] Figure 4 This is a diagram showing the degradation effect of the monooxygenase in Example 5 at different temperatures;

[0026] Figure 5 This is a diagram showing the degradation effect of the monooxygenase in Example 6 in treating waste residue containing steroid hormones.

[0027] Figure 6 The coding gene sequence and amino acid sequence in Example 1. DETAILED DESCRIPTION

[0028] The following embodiments are only some embodiments of the present invention, rather than all embodiments. Therefore, the detailed description in the embodiments of the present invention provided below is not intended to limit the scope of the present invention claimed for protection, but merely represents selected embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without making creative work belong to the protection scope of the present invention.

[0029] In the present invention, unless otherwise specified, all equipment and raw materials can be purchased from the market or are commonly used in the industry. The methods in the following embodiments are all conventional methods in the art unless otherwise specified.

[0030] The sources of materials in the following examples are:

[0031] Burkholderia metallica Q1 was isolated from soil contaminated with steroid hormones and preserved in the laboratory.

[0032] Max DNA Polymerase, Takara T4DNA Ligase, and restriction enzymes NdeI and BamHI were all from Takara;

[0033] The expression plasmid pET-28a and E. coli BL21 (DE3) competent cells were from Anhui General Biotechnology;

[0034] Agarose gel DNA recovery kit and PCR product purification kit were purchased from Shanghai Bioengineering.

[0035] Example 1 Cloning of monooxygenase genes

[0036] The total DNA of Burkholderia metallica Q1 was extracted using a kit, and upstream and downstream primers were designed:

[0037] EC1095AF: 5'-GGAATTC CATATG ATGTCCGCACGCCCTTACAAGA(SEQ ID NO.3)

[0038] EC1095AR: 5'-CGC GGATCC TCAGTCGGGAAACACCACGC(SEQ ID NO.4)

[0039] Among them, the underlined part of the upstream primer is the restriction endonuclease NdeI cleavage site, and the underlined part of the downstream primer is the restriction endonuclease BamHI cleavage site.

[0040] The target gene was obtained by PCR amplification using the extracted genome of strain Q1 as a template. The PCR system is: 60 μL of Max DNA Polymerase, 4 μL each of upstream primer and downstream primer (10 μM), 1 μL of metal Burkholderia genomic DNA, and 52.8 μL of ddHO 2O. The PCR amplification program is: 95℃ pre-denaturation for 3min followed by 30 cycles of: 95℃ denaturation for 15s, 55℃ annealing for 15s, 72℃ extension for 90s; after the cycle is completed, the final extension is 72℃ for 5min. After the PCR amplification product is purified by gel electrophoresis, the target fragment is recovered using a gel recovery kit. After DNA sequencing, its base sequence is as shown in SEQ ID NO.2 ( Figure 6 ), the target gene is 1095 bp in length and the encoded amino acid sequence is shown in SEQ ID NO.1 ( Figure 6 ), encoding 364 amino acids in total, and the molecular weight of the encoded protein is predicted to be 40.81 kDa, which is named PA8. The three-dimensional structure is shown in Figure 1 shown.

[0041] Example 2 Construction of recombinant plasmid pET-28a-PA8

[0042] (1) Obtaining recombinant plasmid

[0043] The target gene purified and recovered in Example 1 and the cloning vector pET-28a were double-digested with NdeI and BamHI, and the digestion system is shown in Table 1. After digestion, the gel was recovered and the ends were connected. The connection reaction system is shown in Table 2. After configuration, centrifugation was performed for 3-5 seconds, and the reaction solution was placed in a PCR instrument with a 16°C program for reaction for 12 hours. After the reaction, the PCR tube was placed on ice for subsequent transformation experiments.

[0044] Table 1 Enzyme digestion system

[0045] Components volume B H 1μL N i 1μL Gene fragment (vector) 20μL 10×Buffer 3.5μL <![CDATA[ddH 2 The]]> 10.5μL

[0046] Table 2 Connection system

[0047] Components volume Target gene fragment 3.5μL pET-28a vector 1.5μL T4 Ligase 1μL 10×Buffer 1μL <![CDATA[ddH 2 The]]> 3μL

[0048] (2) Preparation of electroporation competent cells

[0049] Inoculate overnight cultured E.coli BL21 (DE3) into 100 mL LB liquid medium containing 50 mg / L kanamycin at 1% (v / v), and place in an ice-water bath for 30 min when OD600 reaches 0.4-0.6. Centrifuge at 4000 rpm for 4 min, discard the supernatant, and wash the cells by repeated centrifugation 3 times with the same volume of 10% glycerol. Finally, resuspend with 1 mL 10% glycerol and place in a -20℃ refrigerator for later use. Take 10 μL of the obtained recombinant plasmid and 100 μL of washed E. coli BL21 (DE3) and mix them in a 1 mm pre-cooled electric shock cup. The voltage is 1.8 kV, and the recombinant plasmid is transformed into E. coli BL21 (DE3). Spread it on a NA medium plate containing 100 mg / L kanamycin and culture it at 37°C for 8 h. Perform colony PCR verification on the grown colonies, pick the positive clones that successfully amplify the target band of about 1095 bp in length, and verify it by sequencing.

[0050] Example 3 Inducible expression and purification of monooxygenase

[0051] The recombinant E. coli BL21 (DE3) obtained in Example 2 was inoculated into LB liquid culture medium containing 50 mg / L kanamycin and cultured on a shaker at 37°C for 12 h; the inoculum was inoculated into a conical flask containing 100 mL of LB liquid culture medium containing 50 mg / L kanamycin at a rate of 1% (v / v), and cultured at 37°C and 180 rpm with shaking; when the OD600 of the culture reached 0.6-0.8, IPTG was added to a final concentration of 0.5 mM for induction, and the culture was induced at 16°C for 20 h; the culture was centrifuged at 8000 rpm for 10 min, and the cell precipitate was collected; the resting cells were resuspended in 50 mL of PBS buffer (20 mM, pH 7.4), ultrasonically disrupted in an ice-water bath, the supernatant and precipitate were collected by centrifugation, and resuspended in 20 mL of PBS buffer, and E. coli BL21 (DE3) without the target recombinant plasmid was treated in the same way as a control. The supernatant and precipitate were run on SDS-PAGE gel. Figure 2 As shown, there is a band with higher concentration between 35-50 kDa.

[0052] Example 4 Effect of pH on the catalytic activity of monooxygenase

[0053] The monooxygenase obtained in Example 3 was subjected to an experiment on the effect of pH on the catalytic activity of the monooxygenase in the range of pH 6.0, 7.0 and 8.0. The specific process was as follows:

[0054] 10 mL of LB liquid culture medium with pH values ​​of 6, 7, and 8, containing 50 mg / L of kanamycin, was added to a 50 mL cell bottle respectively; the monooxygenase recombinant strain BL21 in Example 3 cultured overnight was inoculated into the culture medium at 1% (v / v), and cultured at 35°C and 180 rpm until the OD was between 0.6 and 0.8, IPTG was added to make the final concentration 0.5 mM, and androstenedione was added to make the final concentration 40 mg / L. The transformation was carried out in a constant temperature shaker at 35°C and 180 rpm, and three parallels were made. Samples were taken within 0, 8, 16, 24, 32, and 40 hours, and the samples were centrifuged at 12000 rpm and filtered through a 0.22 μm organic filter. The absorption peak was detected at 254 nm by liquid phase, and the difference in the activity of monooxygenase to androstenedione in buffer solutions of different pH values ​​was determined. The results are as follows: Figure 3 As shown: when the pH is 6 and 8, the removal rate of androstenedione by the recombinant strain at 40 hours is 86.72% and 100% respectively, while at pH 7, the removal rate of androstenedione by the recombinant strain within 32 hours is 100%, so the optimal degradation pH range is 7-8.

[0055] Example 5 Effect of temperature on the catalytic activity of monooxygenase

[0056] The monooxygenase obtained in Example 3 was subjected to the standard method to determine the effect of different temperatures on the catalytic activity of the monooxygenase in the range of 30°C to 40°C. The specific process is as follows:

[0057] 10 mL of LB liquid medium with a pH of 7.0 was added to a 50 mL cell bottle, wherein kanamycin was 50 mg / L, and the monooxygenase recombinant strain BL21 in Example 3 cultured overnight was inoculated into the medium at 1% (v / v), and cultured at 35°C and 180 rpm until the OD was between 0.6 and 0.8, and IPTG was added to make the final concentration 0.5 mM, and androstenedione was added to make the final concentration 40 mg / L. The transformation was carried out in a constant temperature shaker at different temperatures of 30°C, 35°C, and 40°C, and the rotation speed was 180 rpm. Three parallels were made, and samples were taken within 0, 8, 16, 24, 32, and 40 hours. After centrifugation at 12000 rpm, the samples were filtered through a 0.22 μm organic filter, and the absorption peak was detected at 254 nm by liquid phase. The difference in the activity of monooxygenase to androstenedione at different temperatures was determined. The results are as follows: Figure 4 As shown: when the degradation temperature is 30℃, the removal rate of androstenedione by the recombinant strain in 40 hours is 95.15%. When the temperature is 40℃, the removal rate of androstenedione by the recombinant strain in 40 hours is only 4.98%, and there is almost no removal. When the temperature is 35℃, the recombinant strain completely removes androstenedione within 32 hours. Therefore, the optimal degradation temperature range is 30-35℃.

[0058] Example 6 Application of monooxygenase in steroid hormones

[0059] Take 100mL of fresh waste residue from fermentation of soybean and corn flour to produce androstenedione, the initial pH of which is 5.4, and the initial content of androstenedione therein is determined to be 80.74mg / L by high performance liquid chromatography, and sterilize at 80°C for 30min. Use disodium hydrogen phosphate to adjust the pH to 7.0, add 1% (v / v) of the recombinant strain of monooxygenase recombinant strain BL21 in Example 3, and add IPTG to make the final concentration 1mM, and perform conversion at 35°C and 180rpm. Take samples within 0, 12, 24, 36, and 48h, centrifuge the samples at 12000rpm, and then filter them with a 0.22μm organic filter, use the liquid phase to detect the absorption peak at 254nm, and determine the conversion effect of monooxygenase in androstenedione fermentation waste residue, as shown in Figure 2. Figure 5 As shown: at 35°C and pH 7, the recombinant strain completely removed androstenedione from androstenedione fermentation waste within 72 hours.

[0060] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A monooxygenase, characterized in that The amino acid sequence of the monooxygenase is shown in SEQ ID NO.

1.

2. The monooxygenase encoding gene according to claim 1, characterized in that The sequence of the coding gene is shown as SEQ ID NO.

2.

3. A recombinant vector comprising the encoding gene according to claim 2.

4. A recombinant strain comprising the coding gene according to claim 2 or the recombinant vector according to claim 3.

5. Use of the monooxygenase according to claim 1, the encoding gene according to claim 2, the recombinant vector according to claim 3 or the recombinant strain according to claim 4 in catalyzing the degradation of steroid compounds.

6. The use according to claim 5, characterized in that: The steroid compound is an androgen, preferably androstenedione.

7. The use according to claim 5, characterized in that: The pH at which the monooxygenase catalyzes the degradation of steroid compounds is 7.0-8.

0.

8. The use according to claim 5, characterized in that: The temperature at which the monooxygenase catalyzes the degradation of steroidal compounds is 30-35°C.

9. Use of the monooxygenase according to claim 1, the encoding gene according to claim 2, the recombinant vector according to claim 3 or the recombinant strain according to claim 4 in the remediation / treatment of steroid hormone pollution.

10. The use according to claim 9, characterized in that: Application in catalyzing the degradation of steroid compounds contained in water or soil or in treating waste residues containing steroid hormones.

Images