β-1,4-Endo-xylanase XlyAE10, encoding gene thereof and applications thereof

Abstract

The present invention relates to the field of biotechnology, and specifically relates to β-1,4-endoxylanase XlyAE10, its encoding gene and applications thereof. The xylanase XlyAE10 provided by the present invention is a β-1,4-endoxylanase XlyAE10 with excellent properties, good pH stability and heat resistance. The optimal temperature of this enzyme is 60.0 °C, and the optimal pH value is 5.5. It still maintains 50% of its activity within the range of pH 4.0 - 9.0, and has 93.26% of its enzyme activity at 65.0 °C. It can be applied to high-temperature biotechnology fields such as food, feed, textile, pulp bleaching and energy development, and has broad application prospects.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to beta-1,4-endo-xylanase XlyAE10, a coding gene and an application thereof. Background Art

[0002] Xylan, a key component of hemicellulose in plant cell walls, is an abundant biomass resource. However, it is difficult to degrade and utilize in nature, resulting in a significant waste of biological resources. Xylanase (EC. 3.2.1.8) is a general term for a class of multifunctional enzymes that degrade xylan, hydrolyzing it into reducing sugars such as oligoxylose and xylose. The action site of β-1,4-endoxylanase is located within the xylan backbone. It can release xylo-oligosaccharides by degrading the glycosidic bonds within the xylan. The hydrolysis products are mostly xylobiose, with smaller amounts of arabinose and xylose. In fact, β-1,4-endoxylanase is a xylanase in the narrow sense.

[0003] Xylanases are abundant in nature and can be produced by many fungi, plant tissues, and bacteria. They have garnered significant attention in recent years. Xylanases derived from different microorganisms exhibit significant differences in their enzymatic properties. Most thermostable xylanases are derived from actinomycetes, while most bacterial and fungal xylanases lack good heat resistance and have low optimal reaction temperatures. Most β-1,4-xylanases have an optimum pH between 4.0 and 7.0, with peak stability between 3.0 and 10.0. Their optimum temperatures generally lie between 40.0°C and 75.0°C. Xylanases with an optimum pH of 5.0 to 8.0 are generally derived from Bacillus species, while those derived from fungi such as Aspergillus niger have relatively low optimum pHs. Xylanases are also important industrial enzymes, widely used in food processing, textiles, pulp bleaching, brewing, feed processing, and other fields. However, different fields require different xylanases with different properties. For example, pulp bleaching and feed processing require high-temperature treatment. Food processing, brewing, and feed industries require acidic xylanases, while textiles and pulp bleaching require alkaline xylanases. Therefore, the development of xylanases with different properties is conducive to expanding the application of xylanases in different industries and has become a hot topic of widespread concern. Summary of the Invention

[0004] In response to the shortcomings of the existing technology, the present invention provides β-1,4-endo-xylanase XlyAE10, encoding genes and applications thereof, and proves that it can tolerate pH 20-10.0 and high temperature environments of 65.0°C and can be applied to food, feed, textiles, pulp bleaching and energy development and other fields, providing more options for expanding the application of xylanase in different industries.

[0005] To achieve the above object, the present invention provides a β-1,4-endo-xylanase XlyAE10, characterized in that it is a protein shown in (a) or (b):

[0006] (a) a protein consisting of the amino acids shown in SEQ ID NO. 1;

[0007] (b) a derivative protein having the same function as the amino acid sequence shown in SEQ ID NO. 1, wherein one or more amino acid residues are substituted and / or deleted and / or added;

[0008] The protein of one of the above (a) or (b) has an optimum temperature of 60.0°C and an optimum pH of 5.5. It can withstand high temperature environments of pH 20-10.0 and 55-70°C, and can be used in high-temperature biotechnology fields such as food, feed, textiles, pulp bleaching and energy development.

[0009] In some specific embodiments, the present invention provides a protein having an amino acid sequence with enhanced heat resistance and having an amino acid sequence with 80% identity to the sequence shown in SEQ ID NO. 1; preferably 85% identity, more preferably 90% identity, more preferably 95% identity, and most preferably 99% identity.

[0010] The present invention also provides a gene encoding beta-1,4-endo-xylanase XlyAE10.

[0011] Furthermore, the nucleotide sequence of the gene is (a), (b) or (c);

[0012] (a) the nucleotide sequence shown in SEQ ID NO. 2;

[0013] (b) a nucleotide sequence that hybridizes with and encodes the nucleotide sequence shown in SEQ ID NO. 2 under stringent conditions;

[0014] (c) a nucleotide sequence encoding a gene that has 80% or more homology to the nucleotide sequence shown in SEQ ID NO. 2.

[0015] It is well understood by those skilled in the art that since the same amino acid may be determined by multiple different codons, the nucleotide sequence encoding the above-mentioned protein is not limited to just one. It can be a nucleotide sequence encoding the mutant amino acid sequence of the present invention by mutating one or more nucleotides of the mutant nucleotide sequence shown in SEQ ID NO. 2 to form a synonymous mutation. Alternatively, a nucleotide sequence encoding the mutant amino acid sequence of the present invention can be designed based on codon optimization.

[0016] In some specific embodiments, the present invention provides a protein whose gene nucleotide sequence has 80% identity with the sequence shown in SEQ ID NO. 2; preferably, it has 85% identity, more preferably, it has 90% identity, more preferably, it has 95% identity, and most preferably, it has 99% identity.

[0017] Recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the above genes also fall within the scope of protection of the present invention.

[0018] A method for preparing xylanase XlyAE10 also falls within the protection scope of the present invention, comprising the following steps: cloning the coding gene of β-1,4-endo-xylanase XlyAE10 into a recombinant expression vector, introducing the vector into a host cell, and obtaining recombinantly expressed xylanase XlyAE10.

[0019] Furthermore, the nucleotide sequence of the encoding gene is (a), (b) or (c);

[0020] (a) the nucleotide sequence shown in SEQ ID NO. 2;

[0021] (b) a nucleotide sequence that hybridizes with and encodes the nucleotide sequence shown in SEQ ID NO. 2;

[0022] (c) a nucleotide sequence encoding a gene that has 80% or more homology to the nucleotide sequence shown in SEQ ID NO. 2.

[0023] Furthermore, the recombinant expression vector is selected from one or more of an Escherichia coli expression vector, a yeast expression vector, a Bacillus subtilis expression vector, a lactic acid bacteria expression vector, a Streptomyces expression vector, a phage vector, a filamentous fungus expression vector, a plant expression vector, an insect expression vector, or a mammalian cell expression vector; preferably, it is selected from pET-28a(+).

[0024] Furthermore, the recombinant bacteria or transgenic line used for recombinant expression of xylanase XlyAE10 is selected from one of Escherichia coli host cells, yeast host cells, Bacillus subtilis host cells, lactic acid bacteria host cells, actinomycete host cells, filamentous fungal host cells, insect cells, and mammalian cells; preferably, it is selected from BL21 (DE3).

[0025] The application of xylanase XlyAE10 in xylan degradation also falls within the protection scope of the present invention.

[0026] Furthermore, the present invention provides the use of xylanase XlyAE10 in the preparation of food, medicine, feed, textiles, detergents or paper products.

[0027] Beneficial effects: The present invention provides a β-1,4-endo-xylanase XlyAE10 with excellent properties, good pH stability and heat resistance, with an optimum temperature of 60.0°C and an optimum pH of 5.5. It still maintains 50% activity in the pH range of 4.0-9.0 and has 93.26% enzyme activity at 65.0°C. It can be applied to high-temperature biotechnology fields such as food, feed, textile, pulp bleaching and energy development that require good thermal stability and long catalytic reaction time, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is an electrophoresis diagram for PCR amplification verification of the gene encoding β-1,4-endoxylanase XlyAE10 of the present invention;

[0029] Figure 2 This is the pH activity diagram of the β-1,4-endo-xylanase XlyAE10 of the present invention;

[0030] Figure 3 This is a pH stability diagram of the β-1,4-endoxylanase XlyAE10 of the present invention;

[0031] Figure 4 This is a thermal activity diagram of the β-1,4-endo-xylanase XlyAE10 of the present invention;

[0032] Figure 5 This is a graph showing the thermal stability of the β-1,4-endo-xylanase XlyAE10 of the present invention. DETAILED DESCRIPTION

[0033] In order to make those skilled in the art better understand the technical scheme of the present invention, the present invention is described in detail below in conjunction with specific embodiments. The experimental methods for which specific conditions are not specified in the following examples are usually based on conventional conditions or the conditions recommended by the manufacturer. The test materials used in the following examples, unless otherwise specified, are purchased from conventional biochemical reagent stores. Unless otherwise specified, percentages and parts are calculated by weight. Unless otherwise defined, all professional and scientific terms used in the text have the same meaning as those familiar to those skilled in the art. In addition, any method and material similar to or equivalent to the described content can be applied to the present invention. The preferred implementation methods and materials described in the text are only for demonstration purposes.

[0034] Some experimental materials and reagents used in this invention:

[0035] Strains and vectors: Escherichia coli BL21 (DE3) was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; pET-28a (+) expression vector was from Wuhan Miaoling Biotechnology Co., Ltd.

[0036] Enzymes and other biochemical reagents: Beech xylan was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; ClonExpress II One Step Cloning Kit was purchased from Nanjing Novozymes Biotechnology Co., Ltd.; Nickel-NTA protein purification resin was purchased from QIAGEN; Pfu-Mix high-fidelity enzyme was purchased from Takara Biotechnology Co., Ltd.; all other reagents were domestically produced (all available from general biochemical reagent companies).

[0037] Culture medium: LB medium: Peptone 10 g, Yeast extract 5 g, NaCl 10 g, distilled water to 1000 mL, pH natural (about 7.0). Solid medium: add 2.0% (w / v) agar to this medium.

[0038] Example 1 Cloning of the gene encoding β-1,4-endoxylanase XlyAE10

[0039] 1.1 Fresh feces of wild Asian elephants collected in the Wild Elephant Valley were collected using EZNA ® Total DNA was extracted using a soil DNA extraction kit according to the instructions to obtain metagenomic DNA from fresh feces of wild Asian elephants, which was then stored at -20°C for future use.

[0040] 1.2 Using the binning assembly function of the metagenomic analysis software Metawrap, the metagenomic DNA of the fresh feces of wild Asian elephants obtained above was analyzed, and an unisolated and cultured Bacteroides bacterium ( Bacteroidales bacterium ) genome, annotated with xylanase genes using the InterPro and Pfam databases, and then aligned with the NR database (non-redundant protein database) using the blastp tool. The results showed that a novel β-1,4-endo-xylanase XlyAE10 amino acid sequence was obtained, as shown in SEQ ID NO. 1. The highest amino acid sequence identity with the xylanase in the NCBI database was approximately 67.63%. Analysis of the nucleic acid sequence of the novel β-1,4-endo-xylanase XlyAE10, as shown in SEQ ID NO. 2, showed a length of 2673 bp. PCR amplification primers for the β-1,4-endo-xylanase gene were designed as follows:

[0041] (5→3):

[0042] Upstream primer XlyAE10-F (sequence shown in SEQ ID NO.3):

[0043] TGGTGCCGCGCGGCAGCCATATGATGAATAATATCAGTAAGATAATTG

[0044] Downstream primer XlyAE10-R ((sequence shown in SEQ ID NO.4):

[0045] TGGTGGTGGTGGTGGTGCTCGAGCTCAGCCTTTGGTTGCGCTGTGAAT

[0046] Among them, the upstream and downstream primers XlyAE10-F and XlyAE10-R contain the recombinant linker fragment and are used for the construction of the recombinant vector;

[0047] 1.3 Total DNA from the intestinal metagenomics of wild Asian elephants was extracted and used as a template for PCR amplification. The amplification reaction system consisted of 25 μL of Pfu-Mix, 2.5 μL each of primers XlyAE10-F and XlyAE10-R, and 5 μL of DNA, which was made up to 50 μL with ddH2O. The amplification reaction conditions were: 94°C for 5 min; 28 cycles of 94°C for 30 s, 63°C–49°C for 30 s, and 72°C for 3 min, with the annealing temperature decreasing by 0.5°C each cycle; 7 cycles of 94°C for 30 s, 49°C for 30 s, and 72°C for 3 min; and finally, 72°C for 10 min and 4°C for 10 min.

[0048] 1.4 The PCR products were verified by 1% agarose gel electrophoresis. The electrophoresis diagram of the PCR amplification verification of the β-1,4-endo-xylanase XlyAE10 encoding gene (e.g. Figure 1 ), where lane M is the DL15,000 bp DNA marker, and lane EA10 is the amplified product. The PCR product was gel-recovered, purified, and sequenced to confirm the presence of a 2,673 bp band, representing the β-1,4-endo-xylanase-encoding gene, XlyAE10.

[0049] Experimental Example 2 Construction and transformation of recombinant β-1,4-endoxylanase XlyAE10 expression vector

[0050] 2.1 The expression vector pET-28a(+) was digested with restriction endonucleases (NdeI and XhoI). The gel-purified XlyAE10 and the digestion products of pET-28a(+) were ligated using the ClonExpress II One Step Cloning Kit recombinase to obtain the recombinant plasmid XlyAE10-pET-28a(+). The nucleotide sequence of the recombinant XlyAE10 is shown in SEQ ID NO. 5.

[0051] 2.2 The recombinant plasmid XlyAE10-pET-28a(+) was transformed into Escherichia coli BL21(DE3) by heat shock to obtain the recombinant strain BL21(DE3) / XlyAE10 containing XlyAE10.

[0052] Experimental Example 3 Preparation of recombinant β-1,4-endo-xylanase XlyAE10

[0053] 3.1 The recombinant strain BL21(DE3) / XlyAE10 obtained in Example 2 was inoculated into LB (containing 50 μg / mL kanamycin) culture medium at a 0.5% inoculum size and activated in a shaker at 37°C and 200 rpm / min for 12-16 h.

[0054] 3.2 Inoculate the activated bacterial suspension from step 1) into fresh LB (containing 50 μg / mL kanamycin) at a 2% inoculum size. Incubate the culture in a shaker at 37°C and 200 rpm / min for approximately 4 h (OD = approximately 0.8). Induce the culture by adding IPTG at a final concentration of 0.5 mM. Continue incubating the culture in a shaker at 16°C and 150 rpm / min for approximately 18 h to induce recombinant protein production.

[0055] 3.3 Collect the cells by centrifugation at 8000 rpm / min for 10 min at 4°C. Resuspend the cells in an appropriate amount of pH 7.0 citric acid-phosphate buffer and disrupt them by ultrasonication in a cold water bath. Centrifuge the concentrated intracellular crude enzyme solution at 13000 rpm / min for 15 min. Aspirate the supernatant and affinity purify the target protein using Nickel-NTA Agarose and 0-500 mM imidazole.

[0056] The SDS-PAGE results of the purified protein showed that the recombinant novel β-1,4-endo-xylanase XlyAE10 was expressed and purified, and the product was a single band.

[0057] Example 3 Investigation of the activity of β-1,4-endo-xylanase XlyAE10

[0058] The activity of the purified recombinant enzyme XlyAE10 was determined using the DNS method using beechwood xylan as the substrate. Beechwood xylan was dissolved in buffer to a final concentration of 0.5%. The reaction system contained 100 μL of enzyme solution and 900 μL of substrate-containing buffer. The substrate was preheated at the reaction temperature for 5 minutes before the enzyme solution was added and the reaction continued for 10 minutes. The reaction was then terminated with 1.5 mL of DNS, mixed, and boiled in boiling water for 5 minutes. A control group was prepared by adding the stop solution first and then the enzyme solution. After cooling, the absorbance was measured at 540 nm. Each experiment consisted of three replicates with one control group. Enzyme activity definition: One unit (U) is defined as the amount of enzyme required to degrade xylan to produce 1 μmol of xylose per minute.

[0059] The purified enzyme solution was placed in buffer solutions of different pH values ​​(citrate-phosphate buffer solution pH 2.0-7.0; Tris-HCl buffer solution pH 7.0-9.0; glycine-NaOH buffer solution pH 9.0-12.0) and the enzymatic reaction was carried out at 37°C to determine the enzymatic activity of the purified recombinant β-1,4-endo-xylanase XlyAE10 (see Figure 2 ).

[0060] like Figure 2 As shown in the figure, the results showed that the optimum pH of the purified recombinant β-1,4-endo-xylanase XlyAE10 was 6.0, and it still maintained 50% activity in the pH range of 4.0-9.0.

[0061] Example 4 Investigation of the stability of β-1,4-endo-xylanase XlyAE10 in different pH environments

[0062] The purified enzyme was placed in a pH 2.0-12.0 buffer (citrate-phosphate buffer for pH = 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, and 8.0; glycine-NaOH buffer for pH = 9.0, 10.0, 11.0, and 12.0) and treated at 37°C for 60 min. The relative enzyme activity of the purified recombinant β-1,4-endo-xylanase XlyAE10 was determined by the enzyme activity assay method at pH 5.0 and 37°C using beechwood xylan as the substrate for 10 min (see Figure 3 ).

[0063] like Figure 3 As shown in the figure, the results showed that the purified recombinant β-1,4-endo-xylanase XlyAE10 could maintain more than 50% of the enzyme activity at pH 2.0-10.0 for 60 min.

[0064] Example 5 Investigation of the thermal activity of β-1,4-endoxylanase XlyAE10

[0065] The enzymatic reaction was carried out in a pH 5.5 buffer at 10-90 °C. Beechwood xylan was used as substrate for 10 min and the activity of the purified recombinant β-1,4-endo-xylanase XlyAE10 was determined (see Figure 4 ).

[0066] like Figure 4 The results showed that the optimum temperature of the recombinant β-1,4-endo-xylanase XlyAE10 was 60.0℃.

[0067] The enzyme activities at 65.0℃, 70.0℃, 80.0℃ and 90.0℃ were 93.26%, 76.23%, 52.12% and 22.66%, respectively, indicating that the recombinant β-1,4-endo-xylanase XlyAE10 is a high-temperature enzyme.

[0068] Example 6 Investigation of the thermal stability of β-1,4-endoxylanase XlyAE10

[0069] The same amount of enzyme solution was placed at 55.0℃, 60.0℃ and 65.0℃ for 60 min, and the enzyme activity was measured once at 5 min, 10 min, 15 min, 20 min, 30 min, 40 min, 50 min and 60 min. The enzymatic reaction was carried out at pH = 5.5 and 37℃. The untreated enzyme solution was used as a control. The enzyme activity of the purified recombinant β-1,4-endo-xylanase XlyAE10 was determined using beech xylan as substrate for 10 min (see Figure 5 ).

[0070] like Figure 5 As shown, the results showed that the enzyme activity of recombinant β-1,4-endo-xylanase XlyAE10 decreased to 63.55% after treatment at 55.0℃ for 60 min, and had not yet reached the temperature half-life; the enzyme activity decreased to 42.96% after treatment at 60.0℃ for 60 min; the enzyme activity decreased to 48.57% after treatment at 65.0℃ for 30 min, and the temperature half-life was about 30 min; these results indicate that β-1,4-endo-xylanase XlyAE10 can tolerate a high temperature environment of 65℃ and is a heat-resistant endo-xylanase.

[0071] Finally, it should be noted that the above description is only a preferred embodiment of the present invention. Under the guidance of the present invention, those skilled in the art can make various similar expressions without violating the purpose and claims of the present invention. Such changes fall within the scope of protection of the present invention.

Claims

1. A β-1,4-endoxylanase XlyAE10, characterized in that, A protein composed of the amino acids shown in SEQ ID NO.

1.

2. The encoding gene of β-1,4-endoxylanase XlyAE10 according to claim 1, characterized in that, The nucleotide sequence of the encoding gene is (a) or (c); (a) The nucleotide sequence shown in SEQ ID NO. 2; (c) A nucleotide sequence having more than 80% homology with the nucleotide sequence shown in SEQ ID NO.

2.

3. A recombinant vector, expression cassette or recombinant bacterium containing the gene according to claim 2.

4. A method for preparing xylanase XlyAE10, characterized in that: The encoding gene according to claim 2 is cloned into a recombinant expression vector and introduced into a host cell to obtain the recombinantly expressed xylanase XlyAE10.

5. The preparation method according to claim 4, characterized in that, The recombinant expression vector is selected from one or more of an Escherichia coli expression vector, a yeast expression vector, a lactic acid bacterium expression vector, a Streptomyces expression vector, a phage vector, a filamentous fungus expression vector, a plant expression vector, an insect expression vector, or a mammalian cell expression vector.

6. The preparation method according to claim 4, characterized in that, The host cell is selected from one of an Escherichia coli host cell, a yeast host cell, a lactic acid bacterium host cell, an actinomycete host cell, a filamentous fungus host cell, an insect cell, or a mammalian cell.

7. The preparation method according to claim 4, wherein The recombinant expression vector is selected from pET-28a(+), and / or, the host cell is selected from BL21(DE3).

8. Use of the β-1,4-endoxylanase XlyAE10 according to claim 1 in xylan degradation.

9. The application according to claim 8, wherein Use in the preparation of food, medicine, feed, textiles, detergents or paper products.

Images