SgRNA for knocking out AREG gene, NK cell with AREG gene knocked out and application of sgRNA and NK cell

Abstract

The invention discloses sgRNA for knocking out an AREG gene, an NK cell with the AREG gene knocked out and application of the sgRNA and the NK cell. By utilizing a CRISPR / Cas gene editing system, a sgRNA and Cas protein compound containing a sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 is introduced into amplified NK cells. The sgRNA designed by the invention can realize efficient cutting at an AREG gene target spot, so that an AREG open reading frame in a genome is effectively damaged, and the RNA and protein levels of AREG are remarkably reduced. By adopting the method disclosed by the invention, the efficient knockout of the AREG gene in the NK cell can be realized, and the obtained NK cell which does not express the AREG shows stronger anti-tumor activity compared with a control group in an in-vivo experiment, so that the killing capability of the NK cell on tumor cells is obviously improved. The method is expected to be developed into a safe and effective anti-tumor biological preparation.

Description

Technical Field

[0001] The present invention belongs to the technical field of NK cells, and specifically relates to an sgRNA for knocking out the AREG gene, an AREG gene-knocked-out NK cell and applications thereof. Background Art

[0002] Natural killer cells (NK) are an important component of innate immunity. They play a key role in killing tumor cells, virus-infected cells, and mediating inflammation by releasing perforins, granzymes, and cytokines (such as IFN-γ, TNF-α). Compared with T cells, NK cell-based immunotherapy has no host-versus-graft response and is not restricted by HLA matching. A variety of NK cell-based immunotherapy has entered clinical trials. On the other hand, the tumor microenvironment can inhibit the anti-tumor effect of NK cells, resulting in limited clinical application. Developing NK cells that are not inhibited by the tumor microenvironment or reversing the inhibitory effect of the tumor microenvironment on NK cells is the key to enhancing its clinical therapeutic effect.

[0003] Amphiregulin (AREG) is a ligand for the transmembrane tyrosine kinase epidermal growth factor receptor (EGFR). AREG is an autocrine growth factor. The expression and release of the AREG gene are caused by a variety of stimuli, including inflammatory lipids, cytokines, hormones, growth factors, and exogenous drugs. AREG plays an important role in promoting tumor cell proliferation and mediating immune tolerance by binding to the EGFR. The tumor microenvironment can promote the expression of AREG in NK cells and inhibit their anti-tumor function. It is a potential target for tumor treatment. Currently, clinical trials of various AREG / EGFR-based treatments are underway.

[0004] Gene editing technology is a technology that inserts, deletes, replaces, and modifies gene sequences containing genetic information. New gene editing technologies focus on the field of artificial nuclease cleavage technology, mainly ZFN technology, TALEN technology, CRISPR technology, and single-base editing technology. The CRISPR / Cas system is the most widely used gene editing technology, consisting of a Cas protein with endonuclease function and a single-stranded guide RNA (sgRNA) of an artificially recombined target gene. The sgRNA can guide the Cas protein to knock out, insert, and mutate the target gene. Among them, the CRISPR / Cas9 system is the most intensively studied and most maturely applied efficient gene editing tool, mainly consisting of Cas9 and sgRNA formed by tracrRNA and crRNA. Under the guidance of sgRNA, the Cas9 protein can achieve directional cutting of the target gene, causing double-strand breaks (DSBs) in DNA, which are repaired through cell-autonomous non-homologous end joining (NHEJ) or homologous recombination (HR), and the target gene is knocked out, inserted, and mutated. CRISPR-Cas9 technology has the advantages of high efficiency, short cycle, broad spectrum, multiple editing capabilities and rich functions. CRISPR-Cas9 technology is widely used and has broad application prospects in gene function research, model animal construction, gene therapy, including cancer, liver disease and cardiovascular disease.

[0005] By knocking out the expression of AREG in NK cells, the inhibitory effect of the tumor microenvironment on NK cells can be relieved, which provides a potential new treatment method. However, the gene knockout technology of NK cells is still imperfect, so the development of efficient NK cell gene editing methods is a key issue to improve the clinical treatment effect of NK cells and needs to be solved urgently. Summary of the invention

[0006] Purpose of the invention: In view of the problems existing in the prior art, the present invention provides an sgRNA for knocking out the AREG gene, an AREG gene-knocked-out NK cell and its application. Specifically, the present invention provides an sgRNA for knocking out the AREG gene, and a technology for effectively knocking out AREG in NK cells, thereby obtaining NK cells that do not express AREG, so as to improve the killing activity of NK cells against tumor cells, and provides the application of the NK cells for preparing drugs for treating malignant tumors.

[0007] Technical solution: To achieve the above purpose, the present invention adopts the following technical solution:

[0008] In a first aspect, the present invention provides an sgRNA for knocking out the AREG gene, the nucleotide sequence of the sgRNA being shown as SEQ ID NO: 1 or SEQ ID NO: 2.

[0009] In a second aspect, the present invention provides the use of the sgRNA in knocking out the AREG gene in NK cells.

[0010] In a third aspect, the present invention provides a method for knocking out the AREG gene in NK cells, comprising introducing the sgRNA into NK cells.

[0011] As a specific embodiment, the method includes complexing the sgRNA with the Cas protein, and introducing the resulting complex (Ribonucleoprotein Complex, RNP) into NK cells.

[0012] As a further embodiment, the Cas protein is Cas9 protein; and the introduction into NK cells is carried out by electroporation transfection.

[0013] As a further embodiment, the mass ratio of the sgRNA to the Cas9 protein is 1:(1.2-1.8).

[0014] As a further embodiment, the NK cells are human NK cells.

[0015] In a fourth aspect, the present invention provides an AREG gene knockout NK cell, wherein the AREG gene knockout NK cell is obtained by the above method.

[0016] In a fifth aspect, the present invention provides the use of the above-mentioned AREG gene knockout NK cells in the preparation of products for treating or assisting in the treatment of tumors.

[0017] As a specific embodiment, the tumor is melanoma, skin squamous cell carcinoma and liver cancer.

[0018] Beneficial effects: Compared with the prior art, the sgRNA designed by the present invention can achieve efficient cutting at the target position of the AREG gene, effectively destroy the open reading frame of AREG in the genome, and thus significantly reduce the RNA and protein levels of AREG. The method of the present invention can achieve knockout of the AREG gene in NK cells, with a knockout efficiency of up to 75%. Not only is the efficiency high, but the obtained NK cells that do not express AREG show stronger anti-tumor activity than the control group in in vivo experiments, and significantly improve the ability to kill tumor cells. This method is expected to be developed into a safe and efficient anti-tumor biological agent. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is a comparison of the live cell percentages of NK cells after electroporation of different sgRNA / Cas9 protein complexes using the CM137 program. The control group was NK cells that were only electroporated with Cas9 protein but not sgRNA.

[0020] Figure 2 is the knockout efficiency of the gene, where: A is the knockout efficiency comparison of sgRNA1 on the AREG gene, and the control group is the NK cells that were only electroporated with Cas9 protein but not electroporated with sgRNA; B is the knockout efficiency comparison of sgRNA1 on the AREG gene, and the control group is the NK cells that were only electroporated with Cas9 protein but not electroporated with sgRNA.

[0021] Figure 3 The control of tumor weight in A375 tumor-bearing mice, where: A is a comparison of the control of tumor growth in A375 tumor-bearing mice by adoptive immunotherapy of NK cells after AREG gene knockout and wild-type NK cells; B is a comparison of the control of tumor weight in A375 tumor-bearing mice by adoptive immunotherapy of NK cells after AREG gene knockout and wild-type NK cells.

[0022] Figure 4 The control of tumor growth in A431 tumor-bearing mice, wherein: A is a comparison of the control of tumor growth in A431 tumor-bearing mice by adoptive immunotherapy of NK cells after AREG gene knockout and wild-type NK cells; B is a comparison of the control of tumor weight in A431 tumor-bearing mice by adoptive immunotherapy of NK cells after AREG gene knockout and wild-type NK cells.

[0023] Figure 5 The control of tumor weight in A2058 tumor-bearing mice, where: A is a comparison of the control of tumor growth in A2058 tumor-bearing mice by adoptive immunotherapy of NK cells after AREG gene knockout and wild-type NK cells; B is a comparison of the control of tumor weight in A2058 tumor-bearing mice by adoptive immunotherapy of NK cells after AREG gene knockout and wild-type NK cells.

[0024] Figure 6 The control of tumor weight in Huh-7 tumor-bearing mice, where: A is a comparison of the control of tumor growth in Huh-7 tumor-bearing mice by adoptive immunotherapy of NK cells after AREG gene knockout and wild-type NK cells; B is a comparison of the control of tumor weight in Huh-7 tumor-bearing mice by adoptive immunotherapy of NK cells after AREG gene knockout and wild-type NK cells. DETAILED DESCRIPTION

[0025] Below in conjunction with specific embodiment, the present invention is further elaborated in detail.It should be understood by those skilled in the art that the following examples are only used to illustrate the present invention and should not be used to limit the scope of the present invention.Unspecified specific conditions in the following examples are usually carried out according to normal conditions or according to the conditions recommended by the manufacturer.Reagents used or instruments that do not specify the manufacturer can all be purchased on the market.

[0026] Example 1 Preparation of AREG gene knockout NK cells

[0027] 1. Enrichment, expansion and culture of NK cells

[0028] 1) Take out the frozen human peripheral blood mononuclear cells (PBMC) from the liquid nitrogen tank, quickly put the cryotube into a preheated water bath to thaw quickly, and shake it continuously to melt the liquid in the tube quickly;

[0029] 2) Prepare 5 ml of RPMI-1640 medium containing 10% FBS and add it to a 15 ml centrifuge tube. Gently pipette the PBMC suspension and transfer it to the 15 ml centrifuge tube.

[0030] 3) Centrifuge at 1500 rpm for 5 min at room temperature;

[0031] 4) Discard the supernatant, resuspend the cells with 1 ml of MACS Buffer, count, and adjust the cell density to 5*10^7 / ml;

[0032] 5) Add 50 μl of antibody (Isolation Cocktail) to each sample, mix well, and incubate at room temperature for 5 min;

[0033] 6) Vortex the magnetic beads for 30 seconds and add 50 μl of magnetic beads to each sample. No incubation is required.

[0034] 7) Add MACS Buffer up to 2.5 ml and gently pipette 2-3 times to mix;

[0035] 8) Open the lid and place on a magnetic rack, and let stand at room temperature for 5 minutes;

[0036] 9) Carefully transfer the supernatant to a new centrifuge tube and discard the magnetic beads;

[0037] 10) Repeat step 8) for a total of 2 enrichments;

[0038] 11) Carefully transfer the supernatant to a new centrifuge tube and centrifuge at 1500 rpm for 5 min at room temperature;

[0039] 12) Discard the supernatant, resuspend the cells in 200 μl NK cell culture medium (5% AB serum + 1% supplement + IL-2), and transfer the cell suspension to a 96-well plate;

[0040] The cells were cultured in a 37°C, 5% CO2 incubator and expanded every three days. IL-2 was added according to the volume of the culture medium to a final concentration of 50 ng / ml;

[0041] Around the 10th day of culture, the purity of NK cells in the culture flask can reach over 95%.

[0042] 2. Preparation and purification of Cas9

[0043] 1) Inoculate the strain into 400 ml LB medium and culture at 37°C and 220 rpm until the bacterial OD reaches 600 0.2, 18°C, 1.0 mM IPTG induction for 16 h, and high-speed centrifugation to collect the cells;

[0044] 2) Resuspend the cells with equilibrium buffer, add PMSF enzyme inhibitor, disrupt the cells with ice bath ultrasound, distinguish the supernatant protein and inclusion body protein by high-speed refrigerated centrifugation, and select the supernatant protein for affinity purification;

[0045] 3) Purification of supernatant protein by His-Tag affinity chromatography;

[0046] Table 1 Buffer preparation method

[0047] Equilibration buffer 20mM Tris, 500mM Nacl, 1mM TCEP, pH7.5 Wash buffer 20mM Tris, 500mM Nacl, 20mM Imidazole, 1mM TCEP, pH7.5 Elution buffer 20mM Tris, 500mM Nacl, 100mM Imidazole, 10% glycerol

[0048] 4) Purify the sample and prepare it for SDS-PAGE analysis;

[0049] 5) Select qualified eluent for dialysis at 4°C, dialysis buffer A (20mM HEPES, 500mM NaCl, 1mM EDTA, 10% glycerol, pH7.5), and then dialyze at 4°C with dialysis buffer B (20mM HEPES, 200mM NaCl, 1mM EDTA, 10% glycerol, pH 7.5);

[0050] 6) Use ultrafiltration tube to concentrate the target protein to an appropriate volume, take a sample for SDS-PAGE analysis, and determine the final protein concentration.

[0051] 3. Electroporation of NK cells

[0052] 1) Mix sgRNA (200 pmol) and Cas9 (100 pmol) (3 ul in total), gently pipette to mix, and incubate at room temperature for 20 min to assemble the RNP complex of sgRNA and Cas9;

[0053] Two types of sgRNAs were used, and their nucleotide sequences are as follows:

[0054] GAGGACGGTTCACTACTAGA(SEQ ID NO:1);

[0055] GTAGTCATAGTCGGCTCCCG(SEQ ID NO:2);

[0056] 2) Resuspend 1*10^6 amplified NK cells in 20ul Electroporation Buffer (15mM HEPES, 5mM KCl, 15mM MgCl 2 ,150mM Na 2 HPO 4 / NaH 2 PO 4 , 50 mM mannitol, pH = 7.2);

[0057] 3) The cell suspension in the above step was mixed with the incubated RNP complex, added to an electroporation cup (Lonza, V4XP-3032), and the NK cells were electroporated using the 4D nucleofector (Lonza) CM137 program;

[0058] 4) After electroporation, use a pipette to aspirate the liquid and place it in preheated culture medium for culture and testing according to subsequent needs.

[0059] The results are as follows Figure 1 As shown: Electroporation of NK cells has no effect on cell activity.

[0060] Example 2 Detection of gene knockout efficiency

[0061] 1) Collect NK cells from the control group or after AREG gene knockout and wash them twice with PBS;

[0062] 2) The genome was extracted according to the procedure of the kit (Karroten, K2302) and the concentration was determined;

[0063] 3) Target gene amplification, the sequence of the forward primer used is: AAGGCACCCTACTTTACCTTT, the sequence of the reverse primer used is: GCTATCCAACAGATATACAATTGT;

[0064] 4) Table 2 PCR reaction system

[0065] name Dosage 2×phusion Master Mix 12.5μl 10μM Forward Primer 1.25 μl 10μM Reverse Primer 1.25μl Genomic DNA 1μl Nuclease-free water Up to 25 μl

[0066] 5) DNA purification and recovery: Extract according to the procedure of the kit (Tian Gen, DP214) and determine the concentration;

[0067] 6) The PCR purified product was subjected to Sanger sequencing using Reverse Primer to analyze the gene knockout efficiency.

[0068] The results are as follows Figure 2As shown: the knockout efficiency of the sgRNA selected from the sequence shown in SEQ ID NO: 1 on the AREG gene in NK cells is 75%, and the knockout efficiency of the sgRNA selected from the sequence shown in SEQ ID NO: 2 on the AREG gene in NK cells is 35%.

[0069] Example 3 Anti-tumor effect of NK cells with AREG gene knockout

[0070] Severe combined immunodeficient mice (NCG) lacking T, B, NK and macrophage cells were selected as tumor-bearing mice. All the ordered mice were male, 5-6 weeks old, and were raised in SPF animal rooms. After one week of adaptive breeding, they were used in subsequent experiments.

[0071] A375 melanoma cells, A2058 melanoma cells, A431 skin squamous cell carcinoma cells, and Huh-7 human hepatoma cells were digested and collected;

[0072] Resuspend the cells with normal saline and adjust the cell suspension density to 2×10^7 cells / mL;

[0073] 2×10^6 cells were subcutaneously inoculated into the armpit of mice;

[0074] Four days after inoculation, mice were randomly divided into two groups according to body weight, with 5 mice in each group, and received wild-type NK cell and AREG gene knockout NK cell treatment respectively: NK cells were injected intratumorally, with 1×10^6 NK cells injected into each mouse, once every 7 days; the tumor volume of mice was measured every 2 days, and the volume was calculated using the formula: (long diameter × short diameter × short diameter) / 2;

[0075] like Figure 3 , Figure 4 , Figure 5 and Figure 6 As shown, after treatment with NK cells with AREG gene knockout (AREG KO NK), tumor growth in skin cancer-bearing mice was significantly inhibited, indicating that AREG knockout in NK cells significantly enhanced its anti-tumor function against A375, A2058, A431 and Huh-7 tumor growth.

[0076] From the above we can see that:

[0077] The research results of the present invention show that the knockout efficiency of the AREG gene in NK cells using the sgRNA corresponding to SEQ NO: 1 of the present invention can reach 75%, and the knockout efficiency of the AREG gene in NK cells using the sgRNA corresponding to SEQ NO: 2 of the present invention can reach 35%. After knocking out the AREG gene, the killing ability of NK cells against tumor cells is significantly enhanced. Compared with the control group, the knockout NK cells showed stronger anti-tumor activity in in vivo experiments and are expected to be developed as safe and efficient anti-tumor biological agents.

[0078] The AREG gene knockout NK cells obtained by the present invention exhibit stronger anti-tumor activity in vivo than ordinary NK cells, significantly improving the killing ability of NK cells against tumor cells. Therefore, NK cells after AREG gene knockout are expected to become safe and effective anti-tumor biological agents, with significant application prospects and clinical application value.

[0079] The above embodiments are the best implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A sgRNA for knocking out the AREG gene, characterized in that: The nucleotide sequence of the sgRNA is shown in SEQ ID NO: 1 or SEQ ID NO:

2.

2. Use of the sgRNA according to claim 1 in knocking out the AREG gene in NK cells.

3. A method for knocking out the AREG gene in NK cells, characterized in that: Comprising the introduction of the sgRNA of claim 1 into NK cells.

4. The method for knocking out the AREG gene in NK cells according to claim 3, characterized in that: The method comprises complexing the sgRNA of claim 1 with a Cas protein, and introducing the resulting complex into NK cells.

5. The method for knocking out the AREG gene in NK cells according to claim 4, characterized in that: The Cas protein is Cas9 protein; and the introduction into NK cells is carried out by electroporation transfection.

6. The method for knocking out the AREG gene in NK cells according to claim 4, characterized in that: The mass ratio of the sgRNA to the Cas9 protein is 1:(1.2-1.8).

7. The method for knocking out the AREG gene in NK cells according to claim 4, characterized in that: The NK cells are human NK cells.

8. An AREG gene knockout NK cell, characterized in that: The AREG gene knockout NK cells are obtained by the method according to any one of claims 3-7.

9. Use of the AREG gene knockout NK cells according to claim 8 in the preparation of products for treating or assisting in the treatment of tumors.

10. The use according to claim 9, characterized in that: The tumors are melanoma, skin squamous cell carcinoma and liver cancer.

Images