Echinococcus lactis lactic dehydrogenase gene in-vitro RNA interference method, related reagent, preparation method and application

Abstract

The invention discloses an echinococcus lactate dehydrogenase gene in-vitro RNA (Ribonucleic Acid) interference method, a related reagent, a preparation method and application. The reagent for reducing the expression of the lactate dehydrogenase gene of the echinococcus can specifically interfere with the EmLDH-B gene, and a new thought is provided for in-depth study of an echinococcus infection mechanism and development of potential therapeutic targets.

Description

Technical Field

[0002] The invention belongs to the field of genetic engineering, and specifically relates to an in vitro RNA interference method for lactate dehydrogenase gene of Echinococcus, related reagents, a preparation method and use. Background Art

[0003] Hydatid disease (also known as echinococcosis) is a serious zoonosis worldwide caused by the middle tapeworm larvae (echinococcosis) of Echinococcus parasitizing humans or animals. The most serious harm to humans is caused by cystic echinococcosis (CE) and alveolar echinococcosis (AE) caused by Echinococcus granulosus and Echinococcus multilocularis. If patients with alveolar echinococcosis are not treated, the 10-year mortality rate can be as high as more than 90%. It is known as "worm cancer" and "second cancer". Hydatid disease is one of the 17 neglected tropical diseases recognized by the World Health Organization.

[0004] At present, the treatments for echinococcosis include surgical resection, liver transplantation and drug chemotherapy, but these treatments have many shortcomings. Surgical resection has a high risk of complications and recurrence rate, and patients still need to take anti-echinococcosis drugs for a long time after surgery. The main drugs currently used in clinical practice are benzimidazole drugs represented by albendazole, but these drugs have problems such as low oral absorption rate, poor efficacy, obvious toxic side effects caused by long-term use and poor patient compliance, which seriously limit their clinical application. Therefore, the development of new and effective vaccines and reliable therapeutic drugs is an urgent need to reduce the risk of infection and treat echinococcosis. With the progress of molecular biology and the accumulation of parasite genome data, it has become increasingly feasible to use computational screening for potential new vaccines, diagnostic antigens and antiparasitic drugs. The use of RNA interference (RNAi, RNAinterference) technology for gene silencing and functional research of Echinococcus tapeworm proteins is not only more efficient and convenient, but also can shorten research time, reduce experimental errors, and reduce economic costs. It is an effective means to verify potential anti-echinococcosis drugs or vaccine targets.

[0005] RNA interference (RNAi) is a biological process that specifically degrades the mRNA of the target gene and prevents its translation through double-stranded RNA (dsRNA) molecules, thereby silencing the target gene, which is usually called "knockdown" of gene expression. dsRNA is cut into short siRNA or miRNA precursors by the Dicer enzyme, which initiates the RNA interference process, specifically inhibits the activity of the target gene, and selectively silences the expression of the mRNA transcript of the target gene. The use of dsRNA as an interference molecule is mainly because it can effectively initiate the RNAi pathway and specifically target the target gene, thereby avoiding nonspecific interference. At the same time, as an exogenous molecule, dsRNA can silence the target gene efficiently and accurately, reduce off-target effects in the experiment, and ensure the stability and reliability of the results. Compared with other RNA interference molecules (such as siRNA and miRNA), the high efficiency and controllability of dsRNA in initiating RNAi make it an ideal choice. Studies have shown that dsRNA can significantly reduce the expression of target genes (up to 55% to 75%) and induce obvious phenotypic changes, and its effect can last for more than 7 days. In contrast, siRNA can only produce about 45% silencing effect on the target gene in a short period of time (2 to 4 days) and fails to induce any phenotypic changes. Since the effect of siRNA is temporary and usually cannot cause significant phenotypic changes, dsRNA is more superior in studies that require continuous gene silencing and observation of phenotypic changes. In addition, as an endogenous transcription product, miRNA mainly regulates gene expression by inhibiting the translation of mRNA or inducing its degradation, but its mechanism of action and scope of application are limited compared to dsRNA.

[0006] RNAi technology is widely used in gene and protein function research and provides support for the development of drug targets and vaccine molecules. It has shown great potential in the genomics research of helminth parasites such as Schistosoma japonicum. For example, the use of dsRNA successfully silenced the Schistosoma japonicum cathepsin B gene, resulting in the inhibition of the corresponding mRNA transcripts. The corresponding mRNA and protein were not detected in the post-RNAi evaluation ( S, J, Horn M, et al. RNA interference in Schistosoma mansoni schistosomula: selectivity, sensitivity and operation for larger-scale screening. PLoS Negl Trop Dis. 2010, 4 (10): e850). In addition, RNAi technology has also been used to study glucose transporter and leucine aminopeptidase genes, further proving their importance in the hatching and survival of Schistosoma eggs. In Fasciola hepatica, RNAi technology was used to reveal the role of cathepsin-L cysteine ​​protease in the process of newly hatched larvae penetrating the rat intestinal epithelium, especially in the process of their invasion of the liver (McGonigle L, Mousley A, Marks NJ, et al. The silencing of cysteine ​​proteases in Fasciola hepatica newly excysted juveniles using RNA interference reduces gut penetration. Int J Parasitol. 2008, 38 (2): 149-55). In the study of Echinococcus tapeworms, although RNAi technology is less used, it has also made positive progress. It is mainly used for gene function research, especially key genes related to parasite growth, development and immune escape. For example, by targeting siRNA to interfere with the calmodulin gene of Echinococcus granulosus, the expression of this gene was successfully inhibited, thus verifying its importance in parasite biology (Mousavi SM, Afgar A, Mohammadi MA, et al. Calmodulin-specific small interfering RNA induces consistent expression suppression and morphological changes in Echinococcus granulosus. Sci Rep. 2019, 9(1): 3894).Through siRNA targeted silencing interference with Echinococcus multilocularis 14-3-3 protein and elp and other related genes, it was found that the transcription and translation processes were significantly affected (Mizukami C, Spiliotis M, Gottstein B, et al. Gene silencing in Echinococcus multilocularis protoscoleces using RNA interference. Parasitol Int. 2010, 59 (4): 647-52).

[0007] Lactate dehydrogenase (LDH) is an important metabolic enzyme and a key enzyme in anaerobic glycolysis. It plays a core role in energy metabolism, catalyzing the reversible conversion between pyruvate and lactate, and providing energy for cells under hypoxic conditions. For parasites in an anaerobic or hypoxic environment, their energy mainly comes from anaerobic glycolysis. Therefore, LDH is a hot molecule in parasitic disease research. Designing drug targets, diagnostic tools, and vaccine candidate molecules around LDH has always been a focus of research in the prevention and control of parasitic diseases. So far, studies have explored the molecular structure and function of LDH in parasites such as Plasmodium, Toxoplasma, Trichomonas, Schistosoma, and Clonorchis sinensis, and found that LDH is a potential candidate target for diagnosis and treatment. For example, in Toxoplasma gondii, knocking down LDH expression can lead to slower growth of parasites in vitro, reduced virulence, and reduced cyst load in mice (Abdelbaset AE, Fox BA, Karram MH, et al. Lactatedehydrogenase in Toxoplasma gondii controls virulence, bradyzoite differentiation, and chronic infection. PLoS One. 2017, 12(3): e0173745). LDH-based anti-Toxoplasma vaccines and new drugs have also made rapid progress. However, there are few studies on Echinococcus. The full-length cDNA sequence of LDH in Echinococcus granulosus was identified by bioinformatics methods, and it was speculated that the protein is a protein that may have transmembrane function and may become an ideal target for vaccine and drug development (Gnag Lu, Yajun Lu, Lihua Li, et al. Identification and bioinformatics analysis of lactate dehydrogenase genes from Echinococcus granulosus. Asian Pacific Journal of Tropical Medicine. 2010, 757-761). Therefore, it is essential to establish a relatively stable in vitro RNA interference system for the LDH gene for the study of gene function in Echinococcus. There is currently no report on the use of RNAi technology to study the lactate dehydrogenase gene of Echinococcus, and it is also unclear what effect knocking down the gene will have. The lactate dehydrogenase gene of Echinococcus multilocularis includes two subtypes, EmLDH-A and EmLDH-B. Summary of the invention

[0008] In the first aspect, in order to study the function of the lactate dehydrogenase B (EmLDH-B) gene of Echinococcus multilocularis, it is necessary to reduce the expression of the gene in Echinococcus multilocularis. The present invention discloses a reagent for reducing the expression of the lactate dehydrogenase gene of Echinococcus multilocularis, which comprises dsRNA of EmLDH-B; the dsRNA of EmLDH-B is a dsRNA of the full length of the EmLDH-B protein encoding gene or a dsRNA of a fragment greater than 400 bp in the EmLDH-B protein encoding gene.

[0009] Furthermore, the nucleic acid sequence of the dsRNA of EmLDH-B is shown in SEQ ID NO:1.

[0010] In a second aspect, the present invention also discloses the use of an agent for reducing the expression of the lactate dehydrogenase gene of Echinococcus in the preparation of a drug for treating echinococcosis, wherein the agent for reducing the expression of the lactate dehydrogenase gene of Echinococcus comprises dsRNA of EmLDH-B; the dsRNA of EmLDH-B is a dsRNA of the full length of the EmLDH-B protein encoding gene or a dsRNA of a fragment greater than 400 bp in the EmLDH-B protein encoding gene.

[0011] In some embodiments, the nucleic acid sequence of the dsRNA of EmLDH-B in this application is shown as SEQ ID NO:1.

[0012] In the third aspect, the present invention also discloses an in vitro RNA interference method for the lactate dehydrogenase gene of Echinococcus, which uses the reagent for reducing the expression of the lactate dehydrogenase gene of Echinococcus described in the first aspect and transfects it into the protoscolex of Echinococcus multilocularis to interfere with the expression of the EmLDH-B gene.

[0013] In some embodiments, the RNA interference method uses the soaking method to transfect the dsRNA of EmLDH-B into the protoscolex of Echinococcus multilocularis, thereby interfering with the expression of LDH-B in the protoscolex of Echinococcus multilocularis. The soaking method is to add a solution containing a specific RNA sequence (such as dsRNA or siRNA) to the cell or tissue culture medium, allowing these RNA molecules to enter the cell through natural absorption of the cell membrane or penetration of the external medium, and then the RNA interference mechanism is activated, and the expression of the targeted gene is inhibited, thereby exerting a gene silencing effect.

[0014] In some embodiments, the interference concentration of the dsRNA of EmLDH-B is 60 μg / mL, and the transfection time is 3 days. The interference concentration here refers to the final concentration of the dsRNA of EmLDH-B in the transfection system. The transfection system includes a transfection buffer, dsRNA of EmLDH-B, and a culture medium containing protoscolex of Echinococcus multilocularis.

[0015] In some embodiments, the RNA interference method uses electroporation to transfect EmLDH-B dsRNA into protoscolex of Echinococcus multilocularis, thereby interfering with the expression of LDH-B in protoscolex of Echinococcus multilocularis. Electroporation is to use an electroporator to apply short-term, high-intensity electric pulses to induce a short-term reversible hole in the cell membrane, allowing RNA molecules to enter the cell through these holes, thereby achieving the RNA interference effect.

[0016] In some embodiments, the agent for reducing the expression of the lactate dehydrogenase gene of Echinococcus is prepared by the following method: using the protoscole cDNA of Echinococcus multilocularis as a template, LDH-B-ds-F and LDH-B-ds-R as a primer pair, whose sequences are shown in SEQ ID NO: 2 and 3, respectively, to perform PCR amplification to obtain dsDNA; and transcribing the obtained dsDNA into the dsRNA of EmLDH-B by the T7 transcription system.

[0017] In some embodiments, the PCR amplification conditions are: annealing temperature 55°C, 30s; extension temperature 72°C, 50s; 38 cycles; final extension temperature 72°C, 10min.

[0018] In a fourth aspect, the present invention also discloses a method for preparing an agent for reducing the expression of the lactate dehydrogenase gene of Echinococcus, which comprises using the protoscole cDNA of Echinococcus multilocularis as a template, LDH-B-ds-F and LDH-B-ds-R as a primer pair, whose sequences are shown in SEQ ID NO: 2 and 3, respectively, performing PCR amplification to obtain dsDNA; transcribing the obtained dsDNA into the dsRNA of EmLDH-B through a T7 transcription system; wherein the agent for reducing the expression of the lactate dehydrogenase gene of Echinococcus comprises the dsRNA of EmLDH-B; and the nucleic acid sequence of the dsRNA of EmLDH-B is shown in SEQ ID NO: 1.

[0019] In a fifth aspect, the present invention also discloses a kit for preparing a reagent for reducing the expression of the lactate dehydrogenase gene of Echinococcus, which comprises a primer pair LDH-B-ds-F and LDH-B-ds-R, whose sequences are shown in SEQ ID NOs: 2 and 3, respectively; it also comprises the protoscolex cDNA of Echinococcus multilocularis and a T7 transcription kit; wherein the reagent for reducing the expression of the lactate dehydrogenase gene of Echinococcus comprises the dsRNA of EmLDH-B; the nucleic acid sequence of the dsRNA of EmLDH-B is shown in SEQ ID NO: 1.

[0020] In some embodiments, an RT-qPCR primer pair LDH-BqF and LDH-BqR, whose sequences are shown in SEQ ID NOs: 4 and 5, respectively, is further included to verify the effect of the prepared reagent for reducing the expression of the Echinococcus lactate dehydrogenase gene.

[0021] The reagent for reducing the expression of lactate dehydrogenase gene of Echinococcus provided by the present invention can specifically interfere with EmLDH-B gene, providing a new idea for the in-depth study of the infection mechanism of Echinococcus and the development of potential therapeutic targets. The homology between the amino acid sequence of EmLDH-A and EmLDH-B and human LDH is 50-53%, and the homology with mouse LDH protein is 35-38%. The dsRNA shown in SEQ ID NO:1 in the present invention is significantly different from the mRNA of human LDH, mouse LDH, and even EmLDH-A, and there is no 21-23nt completely identical sequence, so it has high interference specificity and will not knock down human LDH, mouse LDH and EmLDH-A.

[0022] The concept, specific structure and technical effects of the present invention will be further described below in conjunction with the accompanying drawings to fully understand the purpose, characteristics and effects of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0024] Figure 1 The fluorescence image and BF (Bright Field) bright field microscope image of the protoscolex of Echinococcus multilocularis transfected with Cy3-labeled dsRNA. The scales of the left and right images are the same.

[0025] Figure 2 The changes of gene expression after interference by EmLDH-B-dsRNA immersion method with different concentrations. A: 3 days of interference with different concentrations; B: 24 hours of interference with different concentrations.

[0026] Figure 3 The changes in gene expression after 24 hours of interference by electroporation of different concentrations of EmLDH-B-dsRNA.

[0027] Figure 4 The changes in the transcription level of EmLDH-B gene after interference with 60 μg / mL dsRNA from Echinococcus multilocularis protoscolex by the immersion method (**P<0.01, ***P<0.001).

[0028] Figure 5 The changes in the transcription level of EmLDH-B gene after electroporation of 60 μg / mL dsRNA from Echinococcus multilocularis protoscolex (***P<0.001).

[0029] Figure 6 is the LDH-B gene expression after gene interference (***P<0.001).

[0030] Figure 7 The effect of EmLDH-B gene interference on the survival of Echinococcus multilocularis protoscolex.

[0031] Figure 8 is the number of multilocular Echinococcus cysts on the liver surface of each group (*P<0.05, **P<0.01).

[0032] Fig. 9 HE staining of mouse liver (arrows indicate cystic tissue formed on the liver). A: un-infected; B: PBS-PSC; C: dsGFP-PSC; D: dsLDH-B-PSC; and the scales are the same. DETAILED DESCRIPTION

[0033] In order to facilitate understanding by those skilled in the art, some terms appearing in this document are explained and illustrated.

[0034] As used herein, the singular forms "a", "an", and "the" include plural forms unless the context indicates otherwise. Thus, for example, "an agent" may be understood to include a plurality of agent components.

[0035] Herein, unless otherwise stated, the terms “comprises”, “includes” or “comprising” mean that the listed values, steps or components are included, but other values, steps or components are not excluded.

[0036] In this document, "subject" or "patient" are used interchangeably herein and refer to a vertebrate, preferably a mammal. The mammal can be a human, non-human primate, mouse, rat, dog, cat, horse or cow, but is not limited to these examples.

[0037] The terms "treat" or "treat" or "alleviate" or "improve" are used interchangeably herein and refer to methods of obtaining beneficial or desired results, including but not limited to therapeutic benefit and / or preventive benefit. As used herein, therapeutic benefit generally refers to eradication or reduction of the severity of the underlying condition being treated. In addition, therapeutic benefit is achieved by eradicating, reducing the severity, or reducing the incidence of one or more physiological symptoms associated with the underlying condition so that an improvement is observed in the animal (although the animal may still be afflicted with the underlying condition). For preventive benefit, the risk of disease in animals at risk of developing a particular disease can be reduced. As used herein, the term "therapeutic effect" generally includes therapeutic benefit and / or preventive benefit as described above. Preventive effects include delaying or eliminating the appearance of a disease or condition, delaying or eliminating the onset of symptoms of a disease or condition, slowing, stopping or reversing the progression of a disease or condition, or any combination thereof.

[0038] As used herein, the term "in vivo" generally refers to events that occur within an animal's body.

[0039] As used herein, the term "in vitro" generally refers to an event that occurs outside an animal. For example, an in vitro cell function test or any animal in vitro assay. In vitro assays include cell-based assays in which dead or live cells are used. In vitro assays also include cell-free assays in which intact cells are not used.

[0040] The scheme of the present invention will be explained below in conjunction with the embodiments. It will be appreciated by those skilled in the art that the following embodiments are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. The reagents or instruments used are not indicated by the manufacturer and are all conventional products that can be obtained commercially.

[0041] In order to solve the problem of high difficulty in verifying the gene function of Echinococcus, the present invention proposes a solution based on RNA interference (RNAi) technology to verify the function of the lactate dehydrogenase B gene (EmLDH-B) of Echinococcus multilocularis. This technical solution uses a series of precise molecular biological methods to interfere with the gene expression of Echinococcus multilocularis protoscolex by targeting the dsRNA of the EmLDH-B gene, thereby effectively inhibiting the transcription of EmLDH-B. For the first time, it is proved that the knockdown of the EmLDH-B gene using dsRNA has a significant and stable inhibitory effect on the infectivity of Echinococcus. The specific technical solution includes the following steps:

[0042] 1. Primer design: Primer Premier 6.0 software was used to design dsDNA and RT-PCR primers. The primer sequence was designed at the 5' end of the EmLDH-B gene transcript, and the T7 promoter sequence ("TAATACGACTCACTATAGGGAGAA", SEQ ID NO:6) was added to the 5' end of the primer to facilitate subsequent T7 transcription. The RT-qPCR primers were designed in the 3' end region of the EmLDH-B gene to ensure the specific amplification of the target gene and the accurate detection of the interference effect. The DNA and RNA sequences shown in the article are arranged from the 5' end to the 3' end.

[0043] 2. Protoscolex (PSC) collection and processing: Protoscolex (PSC) were collected from the multilocular Echinococcus cysts infecting long-clawed gerbils, and the host tissue residues were removed by repeated washing with sterile PBS buffer, and the high-purity protoscolex were collected by filtering through 100-micron and 40-micron filters. Subsequently, some of the washed protoscolex were quickly frozen in liquid nitrogen and stored at -80°C for the extraction of total RNA from protoscolex in subsequent experiments; the remaining protoscolex were cultured in DMEM complete medium for subsequent in vitro RNA interference experiments.

[0044] 3. RNA extraction and cDNA synthesis: Total RNA was extracted from protoscolex using the TRIzol method, and cDNA was synthesized using a reverse transcription kit for subsequent dsRNA synthesis and RT-PCR detection.

[0045] 4. dsRNA synthesis: PCR was used to amplify the LDH-B-dsDNA target gene fragment (EmLDH-B-dsDNA) in the cDNA of the protoscolex of Echinococcus multilocularis, and the dsRNA of EmLDH-B-dsDNA was synthesized by in vitro transcription using a T7 transcription kit. The obtained dsRNA was verified by electrophoresis to verify its fragment size and determine its concentration to ensure that it was greater than the concentration standard (60 μg / mL) of the interference test. 60 μg / mL is the preferred final concentration for the interference test.

[0046] 5. dsRNA transfection and activity detection: Cy3 red fluorescence was used to label dsRNA to observe the transfection efficiency. The labeled dsRNA was added to the protoscolecus culture system to be transfected, and the fluorescence expression distribution was monitored using a laser confocal microscope to evaluate the effective introduction of dsRNA. The protoscolecus activity was detected using trypan blue staining, and the morphological structure of the transfected group and the control group was observed by scanning electron microscopy to evaluate the effect of transfection on the protoscolecus morphology.

[0047] 6. RT-PCR detection and animal infection verification: The transfected samples were collected and RNA was extracted. The mRNA expression level of the EmLDH-B gene was detected by RT-PCR to verify the inhibitory effect of dsRNA transfection on the expression of the target gene. In the mouse model of alveolar echinococcosis, the transfected protoscoleci were implanted into C57BL / 6 mice, the number of liver cysts in each group of mice was counted, and the pathological changes of the liver tissue structure were observed by hematoxylin-eosin staining. The results showed that the interference of the EmLDH-B gene significantly reduced the infectivity of Echinococcus multilocularis to the liver of host mice.

[0048] Through the above technical scheme, the present invention successfully established an in vitro RNA interference method for the lactate dehydrogenase gene of Echinococcus, achieved specific gene interference, and provided new ideas for in-depth research on the infection mechanism of Echinococcus and the development of potential therapeutic targets.

[0049] Example 1. Design of dsDNA and RT-qPCR primer fragment sequences

[0050] ① Design of dsDNA primers for target gene interference using Primer Premier 6.0 : dsDNA length ranges from 450 to 500 bp. The dsDNA 479 bp with the highest score in the evaluation results was selected, and the site was designed to be close to the 5' end of the lactate dehydrogenase B gene transcript of Echinococcus multilocularis. The upstream and downstream primers of the dsDNA amplification fragment added the T7 promoter sequence (SEQ ID NO: 6) "TAATACGACTCACTATAGGGAGA" at the 5' end.

[0051] ② Primer Premier 6.0 was used to design RT-qPCR primers for target gene interference : qPCR site is close to the 3' end of the lactate dehydrogenase B gene transcript of Echinococcus multilocularis.

[0052] EmLDH-B-dsDNA target gene sequence (SEQ ID NO: 7):

[0053] GATTATTCCTGAAGTGGTGAAGTACAGTCCGGACTGTATCATCGTGGTCGTTTCGAACCCAGTTGACATTCTTACCTATGTCACCTGGAAACTGAGTGGATTGCCAAGAAATCGGGTTATTGGCTCAGGAACCATCTTGGATTCGGCTAGGTTCAGACACATCCTTGGACAGAAGCTGGATCTAGCTGCCAGTTCAATTCATGGCTACATCATTGGCGAGCATGGTGATTCTAGTGTTGCTGTTTGGAGTCGTGTGTCTGTTGGTGGTGTCAACTTGAGTACCGTTTATCCCAAGTTTGGCGAAGATGGTGATCCCAATAACTTCAAGGCCGTGCACAAAGATGTCATTGATAGTGCGTACGAGATAATCCGTTTGAAGGGTTACACTTCATGGGCTATTGGGCTTTGTTGTGCTAATCTCTGCGCAGCACTTCTCAGTGATCGCAATGTCGTGATTCCCGTGACTACGAATGTTGCGG

[0054] Table 1. Primer sequences

[0055]

[0056] Example 2. Collection of protoscoleces (PSCs)

[0057] The long-clawed gerbils with multilocular Echinococcus from the Institute of Parasitic Diseases Prevention and Control (National Center for Tropical Diseases) of the Chinese Center for Disease Control and Prevention were killed, soaked in 75% alcohol for 3 minutes, placed in a biosafety cabinet, cut open the abdominal cavity, take out the cyst tissue and immerse it in sterile PBS buffer, remove the host connective tissue and blood vessels on the cyst wall, and rinse and remove the residual tissue 3-5 times with sterile PBS buffer (Sangon Biotech, catalog number: E607008), and finally placed in a mortar and immersed in sterile PBS buffer. Cut open the cyst and chop it as much as possible, filter the mixed liquid through a 40-mesh filter, collect the effluent in a 50ml centrifuge tube, and let it stand for 5 minutes; repeatedly immerse the cyst tissue on the filter in sterile PBS buffer, chop and filter 3-5 times, remove the upper layer of the 50ml Ep centrifuge tube, pour into sterile PBS buffer, wash the protoscolecere, and repeat the washing with sterile PBS buffer at least 5 times. The precipitate was resuspended with sterile PBS buffer, the mixed solution was passed through a 100 μm cell filter (Jing'an Biotechnology, Catalog No.: J00100), and the effluent was collected; the effluent was then passed through a 40 μm cell filter (Jing'an Biotechnology, Catalog No.: J00040), and the protoscolex on the filter was rinsed 3 times with sterile PBS buffer, and the protoscolex of Echinococcus multilocularis (Em-PSC) was collected in a 1.5 ml centrifuge tube, and washed 2 to 3 times with DEPC water. Some protoscolex were immediately quick-frozen in liquid nitrogen and transferred to -80°C for cryopreservation after 15 minutes; the remaining protoscolex were cultured in DMEM complete medium.

[0058] Example 3: RNA extraction

[0059] Take out the frozen protoscolex, add 500μL TRIzol (Invitrogen, catalog number: 15596026CN), and use a handheld electric tissue grinder (TIANGEN, OSE-Y30) to grind and homogenize. After grinding, put the centrifuge tube in an ice bath for 5 minutes; add 500μL TRIzol again to make the final volume in the tube 1ml, and let it stand at room temperature for 10 minutes; add 200μL chloroform, turn upside down 15 times; let it stand at room temperature for 5 minutes; centrifuge at 4℃, 12000g, 15min; carefully transfer 400μL of the upper aqueous phase liquid into a sterilized new 1.5ml centrifuge tube, taking care not to inhale the orange-red layer; add 400μL isopropanol and vortex, let it stand at 4℃ for 10min; centrifuge at 4℃, 12000g, 10min; carefully aspirate the supernatant and discard it; add 1ml Wash the precipitate at the bottom of the tube with 75% ethanol (prepared with DEPC water, precooled at -20°C); centrifuge at 4°C, 12000g, 10 min; carefully aspirate the supernatant and discard it; dry the precipitate at room temperature for 15 min; add 30 μL of enzyme-free water (RNase-free) to dissolve the precipitate, obtain the total RNA of Echinococcus protoscolex, and use NanoDrop 2000 spectrophotometer to identify the RNA purity and concentration.

[0060] Example 4. Preparation of cDNA of the protoscolecus of Echinococcus multilocularis

[0061] 1 μg of total RNA was taken for reverse transcription according to the kit procedure (TaKaRa, PrimeScript TM cDNA was synthesized using RTreagent Kit with gDNA Eraser (Cat. No. RR047A).

[0062] Example 5. Preparation of dsRNA

[0063] ① Target gene (dsDNA) amplification :Use the conventional PCR amplification system, the template is the protoscole cDNA of Echinococcus multilocularis, the primers are the upstream and downstream primers of dsDNA amplification fragment (LDH-B-ds-F / R), the annealing temperature is 55℃, 30s; the extension temperature is 72℃, 50s; a total of 38 cycles; the final extension is 72℃, 10min. The amplified product was verified by 1.5% agarose gel electrophoresis, which was a single band and met the expected length. The gel was cut and purified using a gel recovery kit (Thermo, Gene JET GelExtraction Kit, Cat. No.: K0692), and the DNA concentration was determined by NanoDrop 2000 spectrophotometer, and stored at -20℃.

[0064] ② dsRNA synthesis :Use kit (Invitrogen, MEGAscriptTM T7 Transcription Kit, catalog number: AM1334) to synthesize RNA. Target gene dsDNA template 0.2μg; 10×T7 reaction buffer 2μL; ATP / CTP / GTP / UTP 2μL each; T7 Enzyme mix 2μL; Final volume is 20μL, if less than 20μL, use dd H 2 After vortexing, incubate in a 37°C water bath overnight.

[0065] ③ dsRNA purification :Terminate the reaction of overnight product in a 75℃ water bath for 5min. Add 1μL TURBO DNase, mix well, and incubate in a 37℃ water bath for 15min. Add 115μL Nuclease-free water, 15μL Ammonium Acetate StopSolution, and mix well. Add an equal volume of 150μL isopropanol, mix well, and precipitate at -20℃ for at least 1h. Centrifuge at 4℃, 13000rpm, 15min. Discard the supernatant and add 750μL 75% ethanol to wash the precipitate. Centrifuge at 4℃, 13000rpm, 5min, pour off the supernatant, and absorb as much ethanol as possible, open the lid and let stand at room temperature for 15min. Add 30μL Nuclease-free water to dissolve the precipitate, oscillate and mix well, and denature in a 65℃ water bath for 15min. The size of dsRNA fragments was verified by 1.2% agarose gel electrophoresis, and the dsRNA concentration was determined to be 3 μg / μL using NanoDropTM 2000 and stored at -20°C.

[0066] ④EmLDH-B dsRNA sequences (SEQ ID NO: 1):

[0067] GAUUAUUCCUGAAGUGGGAAGUACAGUCCGGACUGUAUCAUCGUGGUCGUUUCGAACCCAGUUGACAUUCUUACCUAUGUCACCUGGAAACUGAGUGGAUUGCCAAGAAAUCGGGUUA UUGGCUCAGGAACCAUCUUGGAUUCGGCUAGGUUCAGACACAUCCUUGGACAGAAGCUGGAUCUAGCUGCCAGUUCAAUUCAUGGCUACAUCAUUGGCGAGCAUGGUGAUUCUAGUGUUG CUGUUUGGAGUCGUGUGUCUGUUGGUGGUGUCAACUUGAGUACCGUUUAUCCCAAGUUUGGCGAAGAUGGUGAUCCCAAUAACUUCAAGGCCGUGCACAAAGAUGUCAUUGAUAGUGCGU ACGAGAUAAUCCGUUUGAAGGGUUACACUUCAUGGGCUAUUGGGCUUUGUUGUGCUAAUCUCUGCGCAGCACUUCUCAGUGAUCGCAAUGUCGUGAUUCCCGUGACUACGAAUGUUGCGG

[0068] Example 6, dsRNA transfection:

[0069] ① Protoscolecus to be transfected The protoscolex collected from gerbils were cultured in DMEM complete medium for 2 days, and their activity was detected by 1% trypan blue staining. If the PSC activity was greater than 98%, they were washed three times with sterile PBS buffer and used for subsequent transfection experiments.

[0070] ② Transfection efficiency :DsRNA labeled with red fluorescence (Cy3) was used for transfection, and the expression distribution of Cy3 transfection was observed using a laser confocal microscope to determine the transfection efficiency. The results showed that no fluorescence was found at 24h and 48h, and red fluorescence was observed to be effectively introduced into the protoscolex at 72h ( Figure 1 ).

[0071] ③ Transfection method :

[0072] Immersion method: Different concentrations of EmLDH-B-dsRNA (10 μg / mL, 30 μg / mL, 60 μg / mL and 120 μg / mL) were used to interfere with protoscolex, as follows: 580 μL of transfection buffer and 20 μL of dsRNA were added to each well of a 24-well culture plate, and the plate was left to stand for 25 min. 400 μL of 25% FBS complete medium containing 5,000 protoscolex to be transfected was added, so that the final concentration of dsRNA in the transfection system was 10 μg / mL, 30 μg / mL, 60 μg / mL or 120 μg / mL. The culture plate was placed in a CO 2 The cells were cultured in a cell culture incubator at 37°C. Figure 2 ), with the increase of concentration, the expression of EmLDH-B was gradually inhibited significantly, among which 60μg / mL and 120μg / mL had the most significant inhibitory effect, but there was no statistical difference between the two. Therefore, 60μg / mL was determined to be the optimal interference concentration.

[0073] Electroporation method: Different concentrations of EmLDH-B-dsRNA (10 μg / mL, 30 μg / mL and 60 μg / mL) were used to interfere with protoscoleci, as follows: EmLDH-B-dsRNA was diluted to a working concentration using electroporation solution (Bio-Rad, catalog number 1652676) and mixed with 5000 protoscoleci of Echinococcus multilocularis in a final volume of 100 μL. The final concentration of EmLDH-B-dsRNA was 10 μg / mL, 30 μg / mL or 60 μg / mL. Then the cells were transferred into a 0.4 cm pre-cooled electroporation cup (Bio-Rad, catalog number 1652088) and placed on ice. The treated samples were electroporated (125 V, 20 ms) using a cell electroporator (Gene Pulser Xcell Electroporation System, Bio-Rad). Add the treated samples to a 6-well culture plate, add 900 μL of DMEM complete medium, and place in a CO 2 The results showed that with the increase of concentration, the expression of EmLDH-B was gradually inhibited significantly, and the inhibitory effect of 60μg / mL was the most significant ( Figure 3 ).

[0074] The 60 μg / mL concentration of EmLDH-B-dsRNA was introduced into the protoscole of Echinococcus multilocularis by immersion method and electroporation method, and cultured continuously for 1 to 6 days. The results showed that the mRNA expression of EmLDH-B in the immersion method treatment group was compared with that in the PBS control group: 1 day (0.26±0.04), 2 days (0.24±0.02), 3 days (0.19±0.04), 4 days (0.36±0.08), 5 days (0.48±0.11) and 6 days (0.49±0.01). The mRNA expression of EmLDH-B in the electroporation treatment group was compared with that in the PBS control group at 1 day (0.39±0.05), 2 days (0.28±0.02), 3 days (0.53±0.07), 4 days (0.48±0.01), 5 days (0.42±0.08) and 6 days (0.43±0.13). The analysis results showed that the mRNA expression of EmLDH-B in the immersion treatment group was lower than that in the PBS control group at different time points, especially on the 2nd and 3rd days, the expression levels were 0.24±0.02 and 0.19±0.04, respectively, showing a more obvious gene silencing effect. The mRNA expression of EmLDH-B in the electroporation treatment group was relatively high on the 2nd and 3rd days, which were 0.28±0.02 and 0.53±0.07, respectively. In addition, the interference effect of the soaking method treatment group reached its best on the second to third day after treatment, and the mRNA expression level remained low in the following three days, showing the persistence of the interference effect. In contrast, the interference effect of the electroporation method treatment group rebounded on the third day and failed to remain stable at a low expression level. Therefore, compared with the electroporation method, the soaking method is more effective in interfering with the expression of EmLDH-B ( Figure 4 and 5 ).

[0075] ④ Transfection group :Three groups were set up, namely the EmLDH-B interference group (expressed by EmLDH-B-dsRNA-PSC or dsLDH-B-PSC), the negative control group (green fluorescent protein gene, GFP), expressed by GFP-dsRNA-PSC or dsGFP-PSC) and the PBS blank control group (expressed by PBS-PSC). Three samples were used in each group, and the EmLDH-B gene interference was performed by immersion transfection method, and the interference effect was verified, including the detection of protoscoleci activity by scanning electron microscopy and trypan blue staining; RT-PCR was used to detect the mRNA expression level of the LDH-B gene in each group (the primer pair was LDH-BqF and LDH-BqR); the effect of EmLDH-B gene interference on host pathogenicity was verified by the mouse model of alveolar echinococcosis.

[0076] dsDNA sequence of GFP (SEQ ID NO: 8):

[0077] GTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCTGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGAC GGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAG

[0078] The upstream and downstream primers for PCR amplification of GFP dsDNA are:

[0079] ds_GFP_F (SEQ ID NO:9):

[0080] TAATACGACTCACTATAGGGAGAAGTCAGTGGAGAGGGTGAAG

[0081] ds_GFP_R (SEQ ID NO: 10):

[0082] TAATACGACTCACTATAGGGAGAACTAGTTGAACGGATCCATC.

[0083] ⑤ Transfection system : Add 580 μL of transfection buffer and 20 μL of dsRNA to each well of a 24-well culture plate, let stand for 25 min, then add 400 μL of 25% FBS complete medium containing 5000 protoscolex to be transfected, so that the final concentration of dsRNA in the transfection system is 60 μg / mL. Place the culture plate in a CO 2 The cells were cultured in a cell culture incubator at 37°C.

[0084] ⑥ RT-PCR testing: The protoscolex was collected 3 days after transfection to extract RNA, and the reversed cDNA was used with a kit (TaKaRa, TB Premix Ex Taq TM II (Tli RNaseH Plus, Catalog No.: RR820A) was used to detect the expression of LDH-B gene in protoscolex after transfection ( Figure 6 ). The mRNA expression level of EmLDH-B interference group was significantly reduced. Compared with the PBS blank control group, the gene expression was reduced to 19% of the PBS blank control group. This experiment showed that interference treatment can significantly inhibit the expression of EmLDH-B gene in protoscolex (P<0.001).

[0085] ⑦ Survival rate test : The survival rate of protoscolex was observed continuously for 8 days after transfection. The results showed that the interference of EmLDH-B gene had little effect on the survival rate of protoscolex during in vitro culture. The survival rates of the three groups were all higher than 60% ( Figure 7 ).

[0086] ⑧ Infectivity of the worm after interference: SPF-grade C57BL / 6 mice were used to verify the infectivity after EmLDH-B gene interference. The experiment was divided into 4 groups, namely the uninfected group (un-infected), PBS-treated protoscoleces (PBS-PSC), GFP-dsRNA-treated protoscoleces (dsGFP-PSC) and EmLDH-dsRNA (dsLDH-B-PSC). The mice were infected by right lobe puncture, with 2000 protoscoleces per mouse, and 3 mice were infected in each group. After 30 days of infection, the whole liver was removed, and the cysts on the surface of the liver were statistically analyzed; and the liver tissues of the infected site were selected for hematoxylin (HE) staining to observe the effect of cyst formation on the liver. The results showed that 3 days after the EmLDH-B gene interference, the infectivity of Echinococcus multilocularis to the liver of C57BL / 6 mice was significantly reduced ( Figure 8 , 9). This provides a new idea for the development of potential therapeutic targets for echinococcosis, and to some extent proves that reagents containing dsRNA of EmLDH-B are expected to be used in the preparation of drugs for the treatment of echinococcosis.

[0087] Reagent preparation:

[0088] The formula of DMEM complete medium is as follows: 50 mL fetal bovine serum (Gibco, catalog number 10091148), 5 mL penicillin-streptomycin (10,000 U / mL, Gibco, catalog number 15140148), 445 mL DMEM (Wisent, catalog number 319-006-CL), mix well, and store at 4°C.

[0089] The formula of 25% FBS complete culture medium is as follows: 25 mL fetal bovine serum, 1 mL penicillin-streptomycin, 74 mL DMEM, mix well, and store at 4°C.

[0090] The formula of transfection buffer is as follows: Prepare immediately before use, add 60 μL Lipo2000 (Invitrogen, catalog number 11668030) to 1500 μL DMEM medium, mix well, and let stand at room temperature for 5 minutes.

[0091] The present invention establishes a method for verifying the function of lactate dehydrogenase gene (EmLDH-B) in Echinococcus multilocularis (larvae) by using RNAi technology. The protoscolex of Echinococcus multilocularis was transfected with 60 μg / ml of LDH-B-dsRNA and immersed for 3 days to interfere with its EmLDH-B gene. Subsequently, verification was carried out, including using trypan blue staining to detect the vitality of the protoscolex; detecting the mRNA expression level of the EmLDH-B gene in each experimental group by RT-PCR, and verifying the infectivity of the EmLDH-B gene after interference by using a mouse model of alveolar echinococcosis. The results show that the method can effectively inhibit the transcription of the LDH-B (EmLDH-B) gene of the protoscolex of Echinococcus multilocularis.

[0092] Specific examples are used herein to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only used to help understand the method of the present invention and its core idea. At the same time, for those skilled in the art, according to the idea of ​​the present invention, there will be changes in the specific implementation methods and application scope. Changes and improvements to the present invention will be possible without exceeding the concept and scope specified in the claims. In summary, the contents of the embodiments of this specification should not be understood as limiting the present invention.

Claims

1. An agent for reducing the expression of lactate dehydrogenase gene of Echinococcus, characterized in that: The dsRNA comprises EmLDH-B; the dsRNA of EmLDH-B is the full-length dsRNA of the EmLDH-B protein encoding gene or the dsRNA of a fragment larger than 400 bp in the EmLDH-B protein encoding gene.

2. The agent for reducing the expression of lactate dehydrogenase gene of Echinococcus according to claim 1, characterized in that: The nucleic acid sequence of EmLDH-B dsRNA is shown in SEQ ID NO:

1.

3. Use of an agent for reducing the expression of lactate dehydrogenase gene of Echinococcus in the preparation of a drug for treating echinococcosis, wherein the agent for reducing the expression of lactate dehydrogenase gene of Echinococcus comprises dsRNA of EmLDH-B; the dsRNA of EmLDH-B is a dsRNA of the full length of the EmLDH-B protein encoding gene or a dsRNA of a fragment larger than 400 bp in the EmLDH-B protein encoding gene.

4. The use according to claim 3, characterized in that: The nucleic acid sequence of EmLDH-B dsRNA is shown in SEQ ID NO:

1.

5. An in vitro RNA interference method for the lactate dehydrogenase gene of Echinococcus, characterized in that: The reagent for reducing the expression of lactate dehydrogenase gene of Echinococcus according to claim 1 or 2 is used and transfected into the protoscolex of Echinococcus multilocularis to interfere with the expression of EmLDH-B gene.

6. The in vitro RNA interference method of the lactate dehydrogenase gene of Echinococcus according to claim 5, characterized in that: The dsRNA of EmLDH-B was transfected into the protoscolex of Echinococcus multilocularis by the immersion method to interfere with the expression of LDH-B in the protoscolex of Echinococcus multilocularis.

7. The in vitro RNA interference method of the lactate dehydrogenase gene of Echinococcus according to claim 6, characterized in that: The interference concentration of EmLDH-B dsRNA was 60 μg / mL, and the transfection time was 3 days.

8. The in vitro RNA interference method of the lactate dehydrogenase gene of Echinococcus according to claim 5, characterized in that: The dsRNA of EmLDH-B was transfected into the protoscolex of Echinococcus multilocularis by electroporation to interfere with the expression of LDH-B in the protoscolex of Echinococcus multilocularis.

9. A method for preparing the agent for reducing the expression of lactate dehydrogenase gene of Echinococcus according to claim 2, characterized in that: Using the protoscole cDNA of Echinococcus multilocularis as a template and LDH-B-ds-F and LDH-B-ds-R as a primer pair, whose sequences are shown in SEQ ID NOs: 2 and 3, PCR amplification is performed to obtain dsDNA; the obtained dsDNA is transcribed into the dsRNA of EmLDH-B by the T7 transcription system.

10. A kit for preparing the reagent for reducing the expression of lactate dehydrogenase gene of Echinococcus according to claim 2, characterized in that: The method comprises a primer pair LDH-B-ds-F and LDH-B-ds-R, whose sequences are shown in SEQ ID NOs: 2 and 3 respectively; and also comprises Echinococcus multilocularis protoscoleus cDNA and a T7 transcription kit.

Images