In vitro rna interference method of echinococcus granulosus lactate dehydrogenase gene, related reagent, preparation method and use

By targeting the EmLDH-B gene of Echinococcus granulosus using dsRNA interference technology, the problem of lactate dehydrogenase gene expression in Echinococcus granulosus has been solved, providing a new and effective approach for the treatment of echinococcosis and achieving the stability and therapeutic potential of gene silencing.

CN120099003BActive Publication Date: 2025-12-26INST OF PARASITIC DISEASE PREVENTION & CONTROL CHINESE CENT FOR DISEASE CONTROL & PREVENTION (NAT RES CENT FOR TROPICAL DISEASES) +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510299017.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-13
Publication Date
2025-12-26
Estimated Expiration
2045-03-13

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively reduce the expression of the lactate dehydrogenase gene in Echinococcus tapeworms, and traditional drug treatments for echinococcosis have problems with toxic side effects and poor patient compliance, which limit the therapeutic effect of echinococcosis.

Method used

Using dsRNA interference technology, dsRNA specifically targeting Echinococcus multilocularis lactate dehydrogenase B (EmLDH-B) was designed and transfected into Echinococcus protoscolex larvae using immersion or electroporation methods to inhibit the expression of the EmlDH-B gene.

Benefits of technology

It significantly reduced the expression of the lactate dehydrogenase gene in Echinococcus tapeworm, providing a new therapeutic target and laying the foundation for potential treatment options for echinococcosis, while also demonstrating high efficiency and stability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099003B_ABST
    Figure CN120099003B_ABST
Patent Text Reader

Abstract

The application discloses an in-vitro RNA interference method for a Taenia solium lactate dehydrogenase gene, related reagents, a preparation method and uses. The reagent for reducing expression of the Taenia solium lactate dehydrogenase gene can specifically interfere with an EmLDH-B gene, and provides a new idea for in-depth research on a Taenia solium infection mechanism and development of a potential treatment target.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering, and particularly relates to an in vitro RNA interference method for Echinococcus granulosus lactate dehydrogenase gene, related reagents, preparation method and use. BACKGROUND

[0002] Hydatid disease (also known as echinococcosis) is caused by the metacestode larva (hydatid cyst) of Echinococcus granulosus parasitizing in the human or animal body, which is a serious parasitic disease in the world, and the most serious harm to the human body is cystic echinococcosis (CE) and alveolar echinococcosis (AE) caused by Echinococcus granulosus and Echinococcus multilocularis, respectively. The 10-year mortality rate of patients with alveolar echinococcosis can be as high as more than 90% without treatment, and it is known as "worm cancer" and "second cancer". Hydatid disease is one of the 17 neglected tropical diseases recognized by the World Health Organization.

[0003] Current treatment methods for hydatid disease include surgical resection, liver transplantation and drug chemotherapy, but these treatment methods have many shortcomings. Surgical resection has a high risk of complications and recurrence rate, and patients still need to take anti-echinococcus drugs for a long time after surgery. The main drugs currently used in clinical practice are benzimidazole drugs represented by albendazole, but these drugs have low oral absorption rate, poor efficacy, significant toxic side effects caused by long-term use, and poor patient compliance, which seriously limits their clinical application. Therefore, the development of new and effective vaccines and reliable therapeutic drugs is an urgent need to reduce the risk of infection and treat hydatid disease. With the development of molecular biology and the accumulation of parasitic genome data, it is becoming more and more feasible to use computational screening to screen potential new vaccines, diagnostic antigens and anti-parasitic drugs. Using RNA interference (RNAi) technology to silence and study the function of Echinococcus granulosus proteins is not only more efficient and convenient, but also can shorten the research time, reduce the experimental error, and reduce the economic cost, which is an effective means to verify potential anti-Echinococcus granulosus drug or vaccine targets.

[0004] RNA interference (RNAi) is a biological process that specifically degrades the mRNA of target genes through double-stranded RNA (dsRNA) molecules and prevents their translation, resulting in the silencing of target genes, commonly referred to as "knockdown" of gene expression. The dsRNA initiates the RNA interference process by being cleaved into short siRNA or miRNA precursors by the Dicer enzyme, specifically inhibiting the activity of the target gene and selectively silencing the mRNA transcript expression of the target gene. The use of dsRNA as an interference molecule is mainly because it can effectively initiate the RNAi pathway and specifically target the target gene, thereby avoiding non-specific interference. At the same time, as an exogenous molecule, dsRNA can efficiently and accurately silence the target gene, reduce off-target effects in experiments, and ensure the stability and reliability of the results. Compared with other RNA interference molecules (such as siRNA and miRNA), the efficiency and controllability of dsRNA in initiating the RNAi process make it an ideal choice. Studies have shown that dsRNA can significantly reduce the expression of target genes (by 55% to 75%) and induce significant phenotypic changes, and its effect can last more than 7 days. In contrast, siRNA can only produce about 45% silencing effect on target genes in a short period of time (2 to 4 days) and fails to induce any phenotypic changes. Since the effect of siRNA is temporary and usually cannot cause significant phenotypic changes, dsRNA is more superior in research that requires continuous gene silencing and observation of phenotypic changes. In addition, miRNA, as an endogenous transcription product, mainly regulates gene expression by inhibiting the translation or inducing the degradation of mRNA, but its mechanism of action and application range are limited compared with dsRNA.

[0005] RNAi technology is widely used in gene and protein function research and provides support for drug target and vaccine molecule development, and has shown great potential in the genomics research of helminth parasites such as schistosomes. For example, the use of dsRNA successfully silenced the cathepsin B gene of schistosomes, resulting in the inhibition of the corresponding mRNA transcript, and no corresponding mRNA and protein were detected in the post-RNAi evaluation S, J, Horn M, et al. RNA interference in Schistosoma mansoni schistosomula: selectivity, sensitivity and operation for larger-scale screening. PLoS Negl Trop Dis. 2010, 4(10):e850). In addition, RNAi technology has also been used to study glucose transporter and leucine aminopeptidase genes, further demonstrating their importance in the hatching and survival of schistosome eggs. In fascioliasis, RNAi technology revealed the role of cathepsin-L cysteine proteases in the process of newly hatched larvae penetrating the rat intestinal epithelium, especially in their invasion of the liver (McGonigle L, Mousley A, Marks NJ, et al. The silencing of cysteine proteases in Fasciola hepatica newly excysted juveniles using RNA interference reduces gut penetration. Int J Parasitol. 2008, 38(2): 149-55). In echinococcosis research, although RNAi technology has been less applied, it has also made positive progress, mainly for gene function research, especially for key genes related to parasite growth, development and immune escape. For example, by targeting and interfering with the calmodulin gene of Echinococcus granulosus using siRNA, the expression of the gene was successfully inhibited, thereby verifying its importance in parasite biology (Mousavi SM, Afgar A, Mohammadi MA, et al. Calmodulin-specific small interfering RNA induces consistent expression suppression and morphological changes in Echinococcus granulosus. Sci Rep. 2019, 9(1): 3894).By targeting and silencing the relevant genes of E. multilocularis 14-3-3 protein and elp, etc. by siRNA, it was found that the transcription and translation process was significantly affected (Mizukami C, Spiliotis M, Gottstein B, et al. Gene silencing in Echinococcus multilocularis protoscoleces using RNA interference. Parasitol Int. 2010, 59(4): 647-52).

[0006] Lactate dehydrogenase (LDH) is an important metabolic enzyme, which is a key enzyme of anaerobic glycolysis, plays a core role in energy metabolism, catalyzes the reversible conversion between pyruvate and lactate, and provides energy for cells under hypoxic conditions. For parasites in anoxic or hypoxic environment, their energy is mainly derived from anaerobic glycolysis. Therefore, LDH is a hot molecule in the study of parasitic diseases, and the design of drug targets, diagnostic tools and vaccine candidate molecules around LDH has always been the focus of parasitic disease prevention and control research. So far, studies have explored the molecular structure and function of LDH of Plasmodium, Toxoplasma, Trichomonas, Schistosoma, Clonorchis sinensis and other parasites, and found that LDH is a potential diagnostic and therapeutic candidate target. For example, in Toxoplasma, knocking down LDH expression can lead to slower growth rate of the worm in vitro culture, lower virulence, and reduced cyst load in mice (Abdelbaset AE, Fox BA, Karram MH, et al. Lactate dehydrogenase in Toxoplasma gondii controls virulence, bradyzoite differentiation, and chronic infection. PLoS One. 2017, 12(3): e0173745). Anti-Toxoplasma vaccines and new drugs based on LDH have made rapid progress. However, there are few studies on LDH in Echinococcus granulosus. Through bioinformatics methods, the full-length cDNA sequence of LDH in E. granulosus was identified, and it was speculated that this protein was a transmembrane protein and could be an ideal target for vaccine and drug development (Gnag Lu, Yajun Lu, Lihua Li, et al. Identification and bioinformatics analysis of lactate dehydrogenase genes from Echinococcus granulosus. Asian Pacific Journal of Tropical Medicine. 2010, 757-761). Therefore, it is essential to establish a relatively stable RNA interference system for LDH gene in vitro for the study of Echinococcus granulosus gene function. So far, there is no report on the use of RNAi technology to study the lactate dehydrogenase gene of Echinococcus granulosus, and it is not clear what effects the knockdown of this gene will have. The lactate dehydrogenase gene of Echinococcus multilocularis includes two subtypes, EmLDH-A and EmLDH-B. SUMMARY

[0007] In order to study the function of EmLDH-B gene of Echinococcus multilocularis, the expression of the gene in the Echinococcus multilocularis needs to be reduced, and the application discloses a reagent for reducing the expression of Echinococcus multilocularis lactate dehydrogenase gene, which comprises dsRNA of EmLDH-B; the dsRNA of EmLDH-B is dsRNA of the full length of the EmLDH-B protein coding gene or dsRNA of a fragment greater than 400 bp in the EmLDH-B protein coding gene.

[0008] Further, the nucleic acid sequence of the dsRNA of EmLDH-B is shown in SEQ ID NO: 1.

[0009] In the second aspect, the application further discloses application of the reagent for reducing the expression of Echinococcus multilocularis lactate dehydrogenase gene in preparation of a drug for treating echinococcosis, wherein the reagent for reducing the expression of Echinococcus multilocularis lactate dehydrogenase gene comprises dsRNA of EmLDH-B; the dsRNA of EmLDH-B is dsRNA of the full length of the EmLDH-B protein coding gene or dsRNA of a fragment greater than 400 bp in the EmLDH-B protein coding gene.

[0010] In some embodiments, the nucleic acid sequence of the dsRNA of EmLDH-B in the application is shown in SEQ ID NO: 1.

[0011] In the third aspect, the application further discloses an in vitro RNA interference method for Echinococcus multilocularis lactate dehydrogenase gene, which is the reagent for reducing the expression of Echinococcus multilocularis lactate dehydrogenase gene in the first aspect, and the reagent is transfected into Echinococcus multilocularis protoscolex to interfere with the expression of EmLDH-B gene.

[0012] In some embodiments, the RNA interference method is to transfect the dsRNA of EmLDH-B into the Echinococcus multilocularis protoscolex by the soaking method to interfere with the expression of LDH-B in the Echinococcus multilocularis protoscolex. The soaking method is to add a solution containing a specific RNA sequence (such as dsRNA or siRNA) into a cell or tissue culture solution, so that the RNA molecules are naturally absorbed or penetrated into the cells by the cell membrane, and then the RNA interference mechanism is started, the expression of the target gene is inhibited, and the gene silencing effect is achieved.

[0013] In some embodiments, the interference concentration of the dsRNA of EmLDH-B is 60 μg / mL, and the transfection time is 3 days. The interference concentration here refers to the final concentration of the dsRNA of EmLDH-B in the transfection system. The transfection system comprises a transfection buffer, the dsRNA of EmLDH-B, and a culture medium containing the Echinococcus multilocularis protoscolex.

[0014] In some embodiments, the RNA interference method transfects the dsRNA of EmLDH-B into the protoscolex of E. multilocularis to interfere with the expression of LDH-B of the protoscolex of E. multilocularis by electroporation. The electroporation is a method of applying short-time, high-intensity electric pulses by using an electroporator to cause the cell membrane to reversibly form pores for a short time, so that the RNA molecules enter the cells through the pores to achieve the RNA interference effect.

[0015] In some embodiments, the reagent for reducing the expression of lactate dehydrogenase gene of Echinococcus is prepared by the following method: using the protoscolex cDNA of E. multilocularis as a template, and using the primer pair of LDH-B-ds-F and LDH-B-ds-R, the sequences of which are shown in SEQ ID NO: 2 and 3, respectively, to perform PCR amplification to obtain dsDNA; and using the T7 transcription system to transcribe the obtained dsDNA into the dsRNA of EmLDH-B.

[0016] In some embodiments, the PCR amplification conditions are as follows: annealing temperature 55°C, 30s; extension temperature 72°C, 50s; 38 cycles; and final extension temperature 72°C, 10 min.

[0017] In the fourth aspect, the present application further discloses a method for preparing a reagent for reducing the expression of lactate dehydrogenase gene of Echinococcus, which comprises the following steps: using the protoscolex cDNA of E. multilocularis as a template, and using the primer pair of LDH-B-ds-F and LDH-B-ds-R, the sequences of which are shown in SEQ ID NO: 2 and 3, respectively, to perform PCR amplification to obtain dsDNA; and using the T7 transcription system to transcribe the obtained dsDNA into the dsRNA of EmLDH-B; wherein the reagent for reducing the expression of lactate dehydrogenase gene of Echinococcus comprises the dsRNA of EmLDH-B; and the nucleic acid sequence of the dsRNA of EmLDH-B is shown in SEQ ID NO: 1.

[0018] In the fifth aspect, the present application further discloses a kit for preparing a reagent for reducing the expression of lactate dehydrogenase gene of Echinococcus, which comprises the primer pair of LDH-B-ds-F and LDH-B-ds-R, the sequences of which are shown in SEQ ID NO: 2 and 3, respectively; and further comprises the protoscolex cDNA of E. multilocularis and a T7 transcription kit; wherein the reagent for reducing the expression of lactate dehydrogenase gene of Echinococcus comprises the dsRNA of EmLDH-B; and the nucleic acid sequence of the dsRNA of EmLDH-B is shown in SEQ ID NO: 1.

[0019] In some embodiments, the kit further comprises the RT-qPCR primer pair of LDH-B-q-F and LDH-B-q-R, the sequences of which are shown in SEQ ID NO: 4 and 5, respectively, for verifying the effect of the prepared reagent for reducing the expression of lactate dehydrogenase gene of Echinococcus.

[0020] The reagent for reducing the expression of Echinococcus granulosus lactate dehydrogenase gene provided by the application can specifically interfere with EmLDH-B gene, and provides a new idea for the in-depth study of the infection mechanism of Echinococcus granulosus and the development of potential therapeutic targets. The homology between EmLDH-A and EmLDH-B and the amino acid sequence of human LDH is 50-53%, and the homology with mouse LDH protein is 35-38%. The dsRNA as shown in SEQ ID NO: 1 in the application is significantly different from the mRNA of human LDH, mouse LDH and even EmLDH-A, and there is no 21-23 nt completely identical sequence, so it has high interference specificity and will not knock down human LDH, mouse LDH and EmLDH-A.

[0021] The concept, specific structure and generated technical effects of the application will be further described below in combination with the drawings, so as to fully understand the purposes, features and effects of the application. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions of the embodiments of the application, the drawings needed in the embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0023] Figure 1 is the fluorescence chart of Cy3-labeled dsRNA transfected Echinococcus granulosus protoscolex and the BF (Bright Field) bright field microscope mode chart. The scales of the left and right charts are the same.

[0024] Figure 2 is the gene expression change after interference by different concentrations of EmLDH-B-dsRNA by soaking method. A: different concentrations of interference for 3 days; B: different concentrations of interference for 24 hours.

[0025] Figure 3 is the gene expression change after 24 hours of interference by different concentrations of EmLDH-B-dsRNA by electroporation method.

[0026] Figure 4 is the change of EmLDH-B gene transcription level of Echinococcus granulosus protoscolex after 60 μg / mL dsRNA is interfered by soaking method (**P<0.01, ***P<0.001).

[0027] Figure 5 is the change of EmLDH-B gene transcription level of Echinococcus granulosus protoscolex after 60 μg / mL dsRNA is interfered by electroporation method (***P<0.001).

[0028] Figure 6 LDH-B gene expression after gene interference (***P<0.001).

[0029] Figure 7 Effect of EmLDH-B gene interference on survival of E. multilocularis protoscoleces.

[0030] Figure 8 Number of E. multilocularis cysts on the liver surface of each group (*P<0.05, **P<0.01).

[0031] Figure 9 HE staining of mouse liver (the arrow points to the cyst tissue formed on the liver). Among them, A: un-infected; B: PBS-PSC; C: dsGFP-PSC; D: dsLDH-B-PSC; and the same scale. DETAILED DESCRIPTION

[0032] For the convenience of those skilled in the art to understand, some terms appearing in this text are explained and described.

[0033] In this text, the singular forms "a", "an" and "the" include their plural forms unless the context clearly indicates otherwise. Therefore, for example, "a reagent" can be understood to include multiple reagent components.

[0034] In this text, unless otherwise specified, the term "comprising", "including" or "containing" means containing the listed values, steps or components, but also does not exclude containing other values, steps or components.

[0035] In this text, "individual" or "patient" are used interchangeably and refer to a vertebrate, preferably a mammal. The mammal can be a human, a non-human primate, a mouse, a rat, a dog, a cat, a horse or a cow, but is not limited to these examples.

[0036] The terms "treatment," "treat," or "treating," or "alleviation," or "amelioration," are used interchangeably and refer to the method of obtaining beneficial or desired results, including but not limited to therapeutic benefit and / or prophylactic benefit. As used herein, therapeutic benefit typically means eradication, or lessening of the severity of the underlying disorder being treated. Additionally, a therapeutic benefit is achieved with the eradication, lessening of severity, or diminishment of one or more of the signs or symptoms associated with the underlying disorder such that an improvement is observed in the animal, notwithstanding the fact that the animal can still be afflicted with the underlying disorder. For a prophylactic benefit, the risk of developing a particular disease is reduced. As used herein, the term "therapeutic effect" generally includes therapeutic benefit and / or prophylactic benefit as described above. A prophylactic effect includes delaying or eliminating the appearance of a disease or condition, delaying or eliminating the onset of symptoms of a disease or condition, slowing, halting, or reversing the progression of a disease or condition, or any combination thereof.

[0037] As used herein, the term "in vivo" generally refers to events that occur in the body of an animal.

[0038] As used herein, the term "in vitro" generally refers to events that occur outside the body of an animal. For example, an in vitro cell function assay or any in vitro assay in an animal. In vitro assays include cell-based assays in which dead or live cells are used. In vitro assays also include cell-free assays in which whole cells are not used.

[0039] The scheme of the present application will be explained below in conjunction with the examples. Those skilled in the art will understand that the following examples are only used to illustrate the present application, and should not be regarded as limiting the scope of the present application. The specific techniques or conditions not noted in the examples are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The reagents or instruments not noted by the manufacturer are all conventional products that can be obtained by purchase.

[0040] To solve the problem of high difficulty in verifying the function of Echinococcus gene, the present application provides a scheme based on RNA interference (RNAi) technology to verify the function of EmLDH-B gene of Echinococcus multilocularis. The technical scheme adopts a series of accurate molecular biology means, interferes with the gene expression of E. multilocularis metacestode by targeting the dsRNA of EmLDH-B gene, thereby effectively inhibiting the transcription of EmLDH-B, and first proves that the EmLDH-B gene knockdown by dsRNA has a significant and stable inhibitory effect on the infectivity of Echinococcus. The specific technical scheme includes the following steps:

[0041] 1. Primer design: dsDNA and RT-PCR primers were designed using Primer Premier 6.0 software. The primer sequence was designed at the 5' end of the EmLDH-B gene transcript, and a T7 promoter sequence ("TAATACGACTCACTATAGGGAGAA", SEQ ID NO: 6) was added at the 5' end of the primer for subsequent T7 transcription. The RT-qPCR primer was designed at the 3' end region of the EmLDH-B gene to ensure specific amplification of the target gene and accurate detection of the interference effect. The DNA and RNA sequence arrangements shown in this paper are from 5' to 3'.

[0042] 2. Protoscolex (PSC) collection and processing: Protoscoleces (PSC) were collected from the cysts of Echinococcus multilocularis infected gerbils, washed repeatedly with sterile PBS buffer to remove host tissue residues, and filtered through 100 μm and 40 μm filters to collect high-purity protoscoleces. Subsequently, part of the washed protoscoleces were snap-frozen in liquid nitrogen and stored at -80°C for subsequent total RNA extraction from protoscoleces; the remaining protoscoleces were cultured in DMEM complete medium for subsequent in vitro RNA interference experiments.

[0043] 3. RNA extraction and cDNA synthesis: Total RNA was extracted from protoscoleces using the TRIzol method, and cDNA was synthesized using a reverse transcription kit for subsequent dsRNA synthesis and RT-PCR detection.

[0044] 4. dsRNA synthesis: LDH-B-dsDNA target gene fragment (EmLDH-B-dsDNA) in Echinococcus multilocularis protoscolex cDNA was amplified by PCR, and EmLDH-B-dsDNA dsRNA was synthesized by in vitro transcription using a T7 transcription kit. The resulting dsRNA was verified by electrophoresis for fragment size and concentration, ensuring that it was greater than the concentration standard for interference experiments (60 μg / mL). 60 μg / mL is the preferred final concentration for interference experiments.

[0045] 5. dsRNA transfection and viability detection: Cy3 red fluorescent labeled dsRNA was used to observe the transfection efficiency. The labeled dsRNA was added to the culture system of protoscoleces to be transfected, and the distribution of fluorescent expression was monitored using a laser confocal microscope to evaluate the effective introduction of dsRNA. The viability of protoscoleces was detected by trypan blue staining, and the morphological structure of the transfection group and the control group was observed by scanning electron microscopy to evaluate the effect of transfection on the morphology of protoscoleces.

[0046] 6. RT-PCR detection and animal infection verification: collect the sample after transfection and extract RNA, detect the mRNA expression level of EmLDH-B gene by RT-PCR, and verify the inhibition effect of dsRNA transfection on the expression of target gene. In the mouse model of hepatic alveolar echinococcosis, the protoscoleces after transfection are implanted into C57BL / 6 mice, the number of liver cysts in each group of mice is counted, and the pathological changes of liver tissue structure are observed by hematoxylin-eosin staining. The results show that EmLDH-B gene interference significantly reduces the infectivity of E. multilocularis to host mice.

[0047] Through the above technical solutions, the in vitro RNA interference method of Echinococcus granulosus lactate dehydrogenase gene is successfully established, specific gene interference is realized, and a new idea is provided for the in-depth study of Echinococcus granulosus infection mechanism and the development of potential therapeutic targets.

[0048] Example 1, design of dsDNA and RT-qPCR primer fragment sequence

[0049] ① Design of dsDNA primers to interfere with target genes using Primer Premier 6.0 : The length of dsDNA is 450-500 bp. The dsDNA with a score of 479 bp is selected as the first evaluation result, the design site is close to the 5' end of the E. multilocularis lactate dehydrogenase B gene transcript, and T7 promoter sequence (SEQ ID NO: 6) "TAATACGACTCACTATAGGGAGA" is added to the upstream and downstream primers of the dsDNA amplification fragment at the 5' end.

[0050] ② Design of RT-qPCR primers to interfere with target genes using Primer Premier 6.0 : The qPCR site is close to the 3' end of the E. multilocularis lactate dehydrogenase B gene transcript.

[0051] EmLDH-B-dsDNA target gene sequence (SEQ ID NO: 7):

[0052] GATTATTCCTGAAGTGGTGAAGTACAGTCCGGACTGTATCATCGTGGTCGTTTCGAACCCAGTTGACATTCTTACCTATGTCACCTGGAAACTGAGTGGATTGCCAAGAAATCGGGTTATTGGCTCAGGAACCATCTTGGATTCGGCTAGGTTCAGACACATCCTTGGACAGAAGCTGGATCTAGCTGCCAGTTCAATTCATGGCTACATCATTGGCGAGCATGGTGATTCTAGTGTTGCTGTTTGGAGTCGTGTGTCTGTTGGTGGTGTCAACTTGAGTACCGTTTATCCCAAGTTTGGCGAAGATGGTGATCCCAATAACTTCAAGGCCGTGCACAAAGATGTCATTGATAGTGCGTACGAGATAATCCGTTTGAAGGGTTACACTTCATGGGCTATTGGGCTTTGTTGTGCTAATCTCTGCGCAGCACTTCTCAGTGATCGCAATGTCGTGATTCCCGTGACTACGAATGTTGCGG

[0053] Table 1, primer sequences

[0054]

[0055] Example 2, collection of protoscolex (PSC)

[0056] The abdominal cavity of the Chinese hamster from the Parasitic Disease Prevention and Control Institute of the Chinese Center for Disease Control and Prevention (National Tropical Disease Research Center) was killed, soaked in 75% alcohol for 3 minutes, placed in a biological safety cabinet, cut open the abdominal cavity, removed the cyst wall tissue and blood vessels on the host connective tissue and washed with sterile PBS buffer (Sangon Biotech, item number: E607008) for 3-5 times, then placed in a mortar and immersed in sterile PBS buffer. Cut open the cyst and cut it into small pieces as much as possible. Filter the mixture through a 40-mesh filter screen and collect the effluent in a 50-ml centrifuge tube and stand for 5 minutes. Repeat the process of immersing the cyst tissue on the filter screen in sterile PBS buffer, cutting and filtering for 3-5 times. Remove the supernatant in the 50-ml Ep centrifuge tube and pour it into sterile PBS buffer. Wash the oncosphere with sterile PBS buffer and repeat the washing process for at least 5 times. Resuspend the precipitate with sterile PBS buffer and pass the mixture through a 100-μm cell filter (Jingan Biotech, item number: J00100) to collect the effluent. Then pass the effluent through a 40-μm cell filter (Jingan Biotech, item number: J00040) and rinse the oncosphere on the top of the filter with sterile PBS buffer for 3 times. Collect the Echinococcus multilocularis oncosphere (Em-PSC) in a 1.5-ml centrifuge tube and wash with DEPC water for 2-3 times. Immediately freeze part of the oncosphere in liquid nitrogen and transfer it to -80℃ for storage after 15 minutes. Culture the rest of the oncosphere in DMEM complete medium.

[0057] Example 3, RNA extraction

[0058] Take out the frozen original head cercaria, add 500 μL TRIzol (Invitrogen, item number: 15596026CN), and use a handheld electric tissue grinder (TIANGEN, OSE-Y30) to grind and homogenize. After grinding, immediately place the centrifuge tube in ice bath for 5 min; add 500 μL TRIzol again to make the final volume in the tube 1 ml, and place at room temperature for 10 min; add 200 μL chloroform, invert 15 times; place at room temperature for 5 min; centrifuge at 4°C, 12000g, 15 min; carefully transfer 400 μL of the upper aqueous phase liquid into a new sterilized 1.5 ml centrifuge tube, and note that the orange-red layer should not be sucked in; after adding 400 μL of isopropanol, vortex and shake, and place at 4°C for 10 min; centrifuge at 4°C, 12000g, 10 min; carefully suck out the supernatant and discard; add 1 ml of 75% ethanol (DEPC water preparation, -20°C pre-cooling) to wash the bottom of the tube; centrifuge at 4°C, 12000g, 10 min; carefully suck out the supernatant and discard; dry the precipitate at room temperature for 15 min; add 30 μL of RNase-free water to dissolve the precipitate, and obtain the total RNA of E. granulosus protoscolex, and use NanoDrop 2000 spectrophotometer to identify the RNA purity and concentration.

[0059] Example 4, cDNA preparation of E. multilocularis protoscolex

[0060] From the total RNA, 1 μg was taken for reverse transcription according to the kit operation steps (TaKaRa, PrimeScript RT reagent Kit with gDNA Eraser, item number: RR047A) to synthesize cDNA. TM

[0061] Example 5, dsRNA preparation

[0062] ① Amplification of target genes (dsDNA) : Using a conventional PCR amplification system, the template was E. multilocularis protoscolex cDNA, and the primers were the upstream and downstream primers of the dsDNA amplified fragment (LDH-B-ds-F / R). The annealing temperature was 55°C, 30 s; the extension temperature was 72°C, 50 s; a total of 38 cycles; and the final extension was 72°C, 10 min. The amplified product was verified by 1.5% agarose gel electrophoresis, which was a single band and met the expected length. The gel was purified using a gel recovery kit (Thermo, Gene JET Gel Extraction Kit, item number: K0692), and the DNA concentration was determined using a NanoDrop 2000 spectrophotometer, and stored at -20°C.

[0063] ② dsRNA synthesis : Using a kit (Invitrogen, MEGAscript T7 Transcription Kit, item number: AMB13152B), the cDNA was used as the template, and the dsRNA was synthesized according to the kit operation steps.​TM T7 Transcription Kit, Cat# AM1334) according to the manufacturer's instructions. The dsDNA template of the target gene 0.2 μg; 10x T7 reaction buffer 2 μL; ATP / CTP / GTP / UTP 2 μL each; T7 Enzyme mix 2 μL; final volume 20 μL, make up with dd H2O to 20 μL. After vortexing, incubate at 37 °C overnight.

[0064] ③ Purification of dsRNA : The overnight product was terminated by incubating at 75 °C for 5 min. 1 μL TURBO DNase was added and mixed, and the mixture was incubated at 37 °C for 15 min. 115 μL Nuclease-free water and 15 μL Ammonium Acetate Stop Solution were added and mixed. An equal volume of 150 μL isopropanol was added and mixed, and the mixture was precipitated at -20 °C for at least 1 h. The mixture was centrifuged at 4 °C at 13000 rpm for 15 min. The supernatant was discarded, and the precipitate was washed with 750 μL of 75% ethanol. The mixture was centrifuged at 4 °C at 13000 rpm for 5 min, and the supernatant was discarded. The ethanol was aspirated as much as possible, and the tube was left open at room temperature for 15 min. 30 μL of Nuclease-free water was added to dissolve the precipitate, and the mixture was vortexed and denatured at 65 °C for 15 min. The size of the dsRNA fragment was verified by 1.2% agarose gel electrophoresis, and the concentration of the dsRNA was determined to be 3 μg / μL using a NanoDrop™ 2000. The dsRNA was stored at -20 °C.

[0065] ④EmLDH-B dsRNA sequences (SEQ ID NO: 1):

[0066] GAUUAUUCCUGAAGUGGUGAAGUACAGUCCGGACUGUAUCAUCGUGGUCGUUUCGAACCCAGUUGACAUUCUUACCUAUGUCACCUGGAAACUGAGUGGAUUGCCAAGAAAUCGGGUUAUUGGCUCAGGAACCAUCUUGGAUUCGGCUAGGUUCAGACACAUCCUUGGACAGAAGCUGGAUCUAGCUGCCAGUUCAAUUCAUGGCUACAUCAUUGGCGAGCAUGGUGAUUCUAGUGUUGCUGUUUGGAGUCGUGUGUCUGUUGGUGGUGUCAACUUGAGUACCGUUUAUCCCAAGUUUGGCGAAGAUGGUGAUCCCAAUAACUUCAAGGCCGUGCACAAAGAUGUCAUUGAUAGUGCGUACGAGAUAAUCCGUUUGAAGGGUUACACUUCAUGGGCUAUUGGGCUUUGUUGUGCUAAUCUCUGCGCAGCACUUCUCAGUGAUCGCAAUGUCGUGAUUCCCGUGACUACGAAUGUUGCGG

[0067] Example 6, dsRNA transfection:

[0068] ① Cercariae to be transfected : The protoscolecide collected from the sand rat was cultured in DMEM complete medium for 2 days, and then 1% trypan blue staining was used to detect its viability, and the PSC activity was greater than 98%, and the sterile PBS buffer was washed three times for subsequent transfection experiment.

[0069] ② Transfection efficiency : Red fluorescent (Cy3) labeled dsRNA was used for transfection, and the distribution of Cy3 transfection was observed by laser confocal microscope to determine the transfection efficiency, and the results showed that no fluorescence was found at 24h and 48h, and red fluorescence was observed to be effectively introduced into the protoscolecide at 72h. Figure 1

[0070] ③ Transfection method :

[0071] ​Soak method: Different concentrations of EmLDH-B-dsRNA (10 pg / mL, 30 pg / mL, 60 pg / mL and 120 pg / mL) were used to interfere with the protoscolex, as follows: 580 pL of transfection buffer and 20 pL of dsRNA were added to each well of a 24-well culture plate, and allowed to stand for 25 min. Then, 400 pL of 25% FBS complete medium containing 5000 protoscoleces to be transfected was added, so that the final concentration of dsRNA in the transfection system was 10 pg / mL, 30 pg / mL, 60 pg / mL or 120 pg / mL. The culture plate was placed in a CO2 cell incubator and incubated at 37°C. The results showed that Figure 2 ) with increasing concentration, the expression of EmLDH-B was gradually significantly inhibited, and the inhibition effect of 60 pg / mL and 120 pg / mL was the most significant, but there was no statistical difference between the two. Therefore, 60 pg / mL was determined as the optimal interference concentration.

[0072] Electrotransformation method: Different concentrations of EmLDH-B-dsRNA (10 pg / mL, 30 pg / mL and 60 pg / mL) were used to interfere with the protoscolex, as follows: EmLDH-B-dsRNA was diluted to the working concentration using electrotransformation solution (Bio-Rad, item number 1652676), mixed with 5000 Taenia multiceps protoscoleces, and the final volume was 100 pL. The final concentration of EmLDH-B-dsRNA was 10 pg / mL, 30 pg / mL or 60 pg / mL. Then, the treated sample was transferred into a pre-cooled electrotransformation cup (Bio-Rad, item number 1652088) placed on ice. The treated sample was subjected to electroporation (125 V, 20 ms) using a cell electroporator (Gene Pulser Xcell Electroporation System, Bio-Rad). The treated sample was added to a 6-well culture plate, and 900 pL of DMEM complete medium was added. The culture plate was placed in a CO2 cell incubator for incubation. The results showed that with increasing concentration, the expression of EmLDH-B was gradually significantly inhibited, and the inhibition effect of 60 pg / mL was the most significant Figure 3 ).

[0073] The 60 μg / mL concentration of EmLDH-B-dsRNA was introduced into the protoscoleces of M. multiceps by soaking method and electroporation method, and cultured for 1 to 6 days continuously. The results showed that the mRNA expression of EmLDH-B in the soaking method treatment group was 0.26±0.04, 0.24±0.02, 0.19±0.04, 0.36±0.08, 0.48±0.11 and 0.49±0.01 respectively compared with the PBS control group for 1, 2, 3, 4, 5 and 6 days. The mRNA expression of EmLDH-B in the electroporation method treatment group was 0.39±0.05, 0.28±0.02, 0.53±0.07, 0.48±0.01, 0.42±0.08 and 0.43±0.13 respectively compared with the PBS control group for 1, 2, 3, 4, 5 and 6 days. The analysis results showed that the mRNA expression of EmLDH-B in the soaking method treatment group was lower than that in the PBS control group at different time points, especially on the 2nd and 3rd days, the expression was 0.24±0.02 and 0.19±0.04 respectively, showing more obvious gene silencing effect. The mRNA expression of EmLDH-B in the electroporation method treatment group was relatively high on the 2nd and 3rd days, which was 0.28±0.02 and 0.53±0.07 respectively. In addition, the interference effect of the soaking method treatment group reached the best on the 2nd to 3rd day after treatment, and the mRNA expression remained low for 3 days, showing the persistence of the interference effect. In contrast, the interference effect of the electroporation method treatment group rebounded on the 3rd day, and failed to maintain a low expression level. Therefore, compared with the electroporation method, the soaking method has more significant effect on the expression of EmLDH-B Figure 4 and 5 ).

[0074] ④ Transfection groups Three groups were set, EmLDH-B interference group (represented by EmLDH-B-dsRNA-PSC or dsLDH-B-PSC), negative control group (green fluorescent protein gene, GFP, represented by GFP-dsRNA-PSC or dsGFP-PSC) and PBS blank control group (represented by PBS-PSC). Each group had three samples, EmLDH-B gene interference was carried out by soaking transfection method, and the interference effect was verified, including scanning electron microscope detection and trypan blue staining detection of protoscoleces activity; the mRNA expression level of LDH-B gene in each group was detected by RT-PCR (the primer pair was LDH-B-q-F and LDH-B-q-R); the effect of EmLDH-B gene interference on host pathogenicity was verified by liver hydatid cystic echinococcosis mouse model.

[0075] The dsDNA sequence of GFP (SEQ ID NO: 8) is:

[0076] GTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCTGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAG

[0077] The upstream and downstream primers for PCR amplifying dsDNA of GFP are as follows:

[0078] ds_GFP_F (SEQ ID NO: 9):

[0079] TAATACGACTCACTATAGGGAGAAGTCAGTGGAGAGGGTGAAG

[0080] ds_GFP_R (SEQ ID NO: 10):

[0081] TAATACGACTCACTATAGGGAGAACTAGTTGAACGGATCCATC.

[0082] ⑤ Transfection system : 580 μL transfection buffer and 20 μL dsRNA were added to each well of a 24-well culture plate, and the plate was allowed to stand for 25 min, 400 μL 25% FBS complete medium was added, and 5000 original head larvae to be transfected were added, so that the final concentration of dsRNA in the transfection system was 60 μg / mL. The culture plate was placed in a CO2 cell incubator and continued to be cultured at 37°C.

[0083] ⑥ RT-PCR detection : RNA was extracted from the original head larvae after 3 days of transfection, and the reverse-transcribed cDNA was used as a template for PCR amplification of GFP dsDNA. Premix Ex Taq TM II(Tli RNaseH Plus), Cat. No. RR820A) to detect the expression of LDH-B gene in PSC after transfection by RT-PCR. Figure 6 The mRNA expression level of EmLDH-B interference group was significantly reduced, and the gene expression was reduced to 19% of the PBS blank control group. This experiment showed that interference treatment could significantly inhibit the expression of EmLDH-B gene in PSC (P < 0.001).

[0084] ⑦ Survival rate detection : The survival rate of PSC was observed for 8 days after transfection, and the results showed that EmLDH-B gene interference had little effect on the survival rate during in vitro culture of PSC, and the survival rate of the three groups was higher than 60% Figure 7 )。

[0085] ⑧Infectivity of the worm after interference: SPF C57BL / 6 mice were used to verify the infectivity after EmLDH-B gene interference. A total of 4 groups of experiments were divided, namely un-infected group (un-infected), PBS-treated PSC (PBS-PSC), GFP-dsRNA-treated PSC (dsGFP-PSC) and EmLDH-dsRNA (dsLDH-B-PSC). The right lobe of liver puncture method was used to infect mice, and the dose was 2000 PSC per mouse, and 3 mice were infected in each group. After 30 days of infection, the whole liver was removed, and the number of cysts on the surface of the liver was counted. The liver tissue at the infection site was selected for hematoxylin (HE) staining to observe the effect of cyst formation on the liver. The results showed that the infectivity of EmLDH-B gene interference for 3 days in C57BL / 6 mice was significantly reduced Figure 8 , 9). This provides a new idea for the development of potential therapeutic targets for echinococcosis, and to some extent proves that the reagent containing EmLDH-B dsRNA is expected to be used for the preparation of drugs for the treatment of echinococcosis.

[0086] Preparation of reagents:

[0087] The complete culture medium of DMEM is as follows: 50 mL fetal bovine serum (Gibco, Cat. No. 10091148), 5 mL penicillin-streptomycin (10,000 U / mL, Gibco, Cat. No. 15140148), 445 mL DMEM (Wisent, Cat. No. 319-006-CL), and mix well, store at 4°C.

[0088] 25% FBS complete medium formula as follows: 25 mL fetal bovine serum, 1 mL penicillin-streptomycin, 74 mL DMEM, mix well, 4°C preservation.

[0089] Transfection buffer formula as follows: fresh preparation, 1500 μL DMEM medium, add 60 μL Lipo2000 (Invitrogen, item number 11668030) and mix, stand at room temperature for 5 min.

[0090] The application establishes a method for verifying the function of lactate dehydrogenase gene (EmLDH-B) in multilocular hydatid tapeworm (cysticercus) by using RNAi technology. The EmLDH-B gene of the multilocular hydatid tapeworm cysticercus is interfered by using 60 μg / ml of LDH-B-dsRNA for transfection and soaking treatment for 3 days. Then, verification is carried out, including detecting the activity of the cysticercus by using trypan blue staining method; detecting the mRNA expression level of the EmLDH-B gene of each experimental group by RT-PCR, and verifying the infectivity after the EmLDH-B gene interference by using a mouse model of hepatic alveolar echinococcosis. The results show that the method can effectively inhibit the transcription of the LDH-B (EmLDH-B) gene of the multilocular hydatid tapeworm cysticercus.

[0091] The principles and implementation modes of the application are described by using specific examples in the present document, and the above description of the examples is only used to help understand the method of the application and its core idea; meanwhile, for those skilled in the art, according to the idea of the application, changes will be made in the specific implementation modes and application ranges, and the changes and improvements of the application will be possible without exceeding the concept and range defined by the claims; in summary, the content of the examples in the present specification should not be understood as a limitation of the application.

Claims

1. An agent which reduces expression of a Echinococcus granulosus lactate dehydrogenase gene, characterized in that, The dsRNA comprising EmLDH-B; the nucleic acid sequence of the dsRNA of EmLDH-B is shown as SEQ ID NO:

1.

2. Use of an agent that reduces expression of a Echinococcus lactic acid dehydrogenase gene in the manufacture of a medicament for treating echinococcosis, characterized in that, The reagent for reducing the expression of Echinococcus granulosus lactate dehydrogenase gene comprises the dsRNA of EmLDH-B; The nucleic acid sequence of the dsRNA of EmLDH-B is shown as SEQ ID NO:

1.

3. A method for RNA interference of Echinococcus lactate dehydrogenase gene in vitro, characterized by, The reagent for reducing the expression of Echinococcus granulosus lactate dehydrogenase gene as claimed in claim 1 or 2 is transfected into the protoscolex of Echinococcus multilocularis to interfere with the expression of EmLDH-B gene.

4. The in vitro RNA interference method of Echinococcus lactate dehydrogenase gene according to claim 3, characterized in that, The protoscolex of Echinococcus multilocularis is transfected by the dsRNA of EmLDH-B through the soaking method to interfere with the expression of LDH-B of the protoscolex of Echinococcus multilocularis.

5. The in vitro RNA interference method of Echinococcus lactate dehydrogenase gene according to claim 4, characterized in that, The interference concentration of the dsRNA of EmLDH-B is 60 μg / mL, and the transfection time is 3 days.

6. The in vitro RNA interference method of Echinococcus lactate dehydrogenase gene according to claim 5, characterized in that, The protoscolex of Echinococcus multilocularis is transfected by the dsRNA of EmLDH-B through the electroporation method to interfere with the expression of LDH-B of the protoscolex of Echinococcus multilocularis.

7. A method of preparing the reagent for reducing the expression of Echinococcus granulosus lactate dehydrogenase gene according to claim 1, characterized in that, The dsDNA is obtained by PCR amplification with the protoscolex cDNA of Echinococcus multilocularis as a template and the primer pair of LDH-B-ds-F and LDH-B-ds-R, the sequences of which are shown as SEQ ID NO: 2 and 3, respectively; and the obtained dsDNA is transcribed into the dsRNA of EmLDH-B by the T7 transcription system. The protoscolex of Echinococcus multilocularis is transfected by the dsRNA of EmLDH-B through the soaking method to interfere with the expression of LDH-B of the protoscolex of Echinococcus multilocularis. The interference concentration of the dsRNA of EmLDH-B is 60 μg / mL, and the transfection time is 3 days. The protoscolex of Echinococcus multilocularis is transfected by the dsRNA of EmLDH-B through the electroporation method to interfere with the expression of LDH-B of the protoscolex of Echinococcus multilocularis. The dsDNA is obtained by PCR amplification with the protoscolex cDNA of Echinococcus multilocularis as a template and the primer pair of LDH-B-ds-F and LDH-B-ds-R, the sequences of which are shown as SEQ ID NO: 2 and 3, respectively; and the obtained dsDNA is transcribed into the dsRNA of EmLDH-B by the T7 transcription system.

Citation Information

Patent Citations

  • Method for transfecting interfering RNA to echinococcus granulosus by virtue of electroporation

    CN104342456A

  • Drug target for resisting echinococcus, reagent and kit for targeting echinococcus methylase and application of reagent and kit

    CN115873851A