Mutant ibpA RNAT, system and method for regulating target gene expression based on mutant ibpA RNAT, and application of mutant ibpA RNAT
By developing the mutant ibpA RNAT, the zipper structure is expanded by using temperature to induce the development of its zipper structure, precise regulation of gene expression is achieved, the problem of difficult to accurately control the bacterial treatment effect in tumor treatment is solved, and the time-space specificity and efficiency of treatment are improved.
Patent Information
- Application Number
- CN202510329788.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-20
- Publication Date
- 2025-06-06
AI Technical Summary
The prior art is difficult to accurately regulate the time and place of the treatment effect of bacteria in tumor treatment, resulting in drug enrichment, insufficient resource utilization and damage to normal tissues.
A mutant ibpA RNAT was developed to optimize its nucleotide sequence through gene mutations, so that it expands its zipper structure when the temperature rises, exposing the ribosome binding site and the QKI binding site of the RNA-binding protein, thereby accurately regulating gene expression.
It has achieved non-invasive and highly space-time-specific regulation of microbial gene expression, improved protein translation efficiency, and is suitable for drug development of intelligent live bacteria, and can specifically express therapeutic proteins in tumor tissues.
Smart Images

Figure CN120099037A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of gene engineering, and specifically relates to a mutant ibpA RNAT, a system and method for regulating target gene expression based on the mutant ibpA RNAT, and an application thereof. Background Art
[0002] Bacterial therapy may become a promising strategy in tumor treatment due to the unique properties of bacteria and unlimited transformation. The disordered vasculature, hypoxic, slightly acidic, and eutrophic microenvironment of tumors induce bacteria to preferentially colonize. In order to improve the effectiveness of local tumor treatment and avoid potential toxicity caused by systemic administration, tumor bacterial treatment must be strictly controlled. Precise regulation of the time and place where bacteria produce therapeutic effects is crucial for drug enrichment, resource utilization, and reducing damage to normal tissues.
[0003] Gene expression systems based on protein regulators such as the classic Lambda and Lac repressors have been established for tight and dose-dependent control of protein synthesis. Recently, the research focus has shifted from protein regulators to RNA-based regulators as tools for conditional gene expression. RNA structures regulate various steps of gene expression. Translation initiation can be regulated by metabolites or temperature-sensitive RNA structures, called riboswitches or RNA thermometers (RNATs), respectively. RNATs control translation initiation by blocking the ribosome binding site at lower temperatures. Increased temperature destabilizes the RNA stem-loop structure and promotes the entry of ribosomes. RNATs have a simple structure and mode of action, and they have great prospects in synthetic biology. When the temperature rises, ibpA RNAT unfolds in a zipper structure, exposing the ribosome binding site, thereby promoting the translation process. However, once the temperature drops, RNAT binds again in a zipper structure, blocking the ribosome binding site. For tumor treatment, it is not enough to produce therapeutic proteins only when induction is applied. At present, it is still necessary to develop a more controllable and efficient regulatory element to further improve protein translation efficiency and realize the drug development of smart live bacteria. Summary of the invention
[0004] The purpose of the present invention is to provide a mutant ibpA RNAT, a system and method and application for regulating target gene expression based on the mutant ibpA RNAT. The mutant ibpA RNAT of the present invention can accurately regulate gene expression and improve protein translation efficiency, and provides a new method for non-invasively and highly spatiotemporally specific regulation of microbial gene expression, which is beneficial to the drug development and application of smart live bacteria.
[0005] The present invention provides a mutant ibpA RNAT, and the nucleotide sequence of the mutant ibpA RNAT is shown as SEQ ID NO.1.
[0006] The present invention also provides an expression cassette of a mutant ibpA RNAT, comprising a constitutive promoter and the mutant ibpA RNAT described in the above technical solution.
[0007] The present invention also provides the use of the mutant ibpA RNAT described in the above technical solution or the expression cassette described in the above technical solution in regulating the expression of a target gene.
[0008] The present invention also provides a target gene expression regulation system based on the mutant ibpA RNAT and RNA binding protein QKI described in the above technical solution, including a response module and a modification module;
[0009] The response module comprises: P-ibpA RNAT-target gene; the P-ibpA RNAT-target gene comprises a constitutive promoter, the mutant ibpA RNAT described in the above technical solution and the target gene connected in sequence; the target gene comprises a reporter gene or a functional protein gene fused with a secretion signal peptide;
[0010] The remodeling module comprises: RBS-QKI; the RBS-QKI comprises a ribosome binding site and a coding gene of RNA binding protein QKI which are sequentially connected.
[0011] The present invention also provides a target gene expression regulation recombinant vector, which includes a basic vector and corresponding modules and a modified module in the target gene expression regulation system described in the above technical solution.
[0012] The present invention also provides a target gene expression regulation engineered bacterium, wherein the engineered bacterium is constructed by transferring the target gene expression regulation recombinant vector described in the above technical solution into a recipient bacterium.
[0013] The present invention also provides the use of the gene expression regulation system described in the above technical solution, the gene expression regulation recombinant vector described in the above technical solution, or the gene expression regulation engineered bacteria described in the above technical solution in the preparation of products for treating diseases.
[0014] The present invention also provides a method for regulating the expression of a target gene in an engineered bacterium, comprising the following steps: applying heat induction to the target gene expression regulating engineered bacterium described in the above technical solution.
[0015] The present invention provides a mutant ibpA RNAT. Compared with the wild-type ibpA RNAT, the base at position 7 of the mutant ibpA RNAT of the present invention is replaced by U to A, the base at position 15 is replaced by G to U, and the base at position 21 is replaced by C to A. These mutations enable the QKI protein to recognize two specific sequences in the stem-loop structure of RNAT. As the temperature rises, RNAT unfolds in a zipper structure, allowing ribosomes to bind and initiate translation. Furthermore, the downstream constitutively expressed QKI protein can bind to the two specific sequences in the unfolded RNAT, thereby precisely regulating gene expression.
[0016] Furthermore, the present invention transforms the vector containing the target gene expression regulation system into attenuated receptor bacteria to construct intelligent live bacteria, utilizes the characteristics of bacteria to target and colonize the core area of the tumor, and regulates the expression of functional proteins specifically in the tumor tissue through thermal induction (photothermal, magnetic thermal, ultrasonic thermal effect), thereby achieving precise expression at the lesion site and improving the disease treatment effect. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.
[0018] Figure 1 A schematic diagram of an engineered bacterium comprising a target gene expression regulation system provided by the present invention;
[0019] Figure 2 Schematic diagram of the operation of RNAT induced by heat provided by the present invention
[0020] Figure 3 A graph showing the results of heat gene expression in the engineered bacteria provided by the present invention;
[0021] Figure 4 The result diagram of the relationship between ultrasound and temperature provided by the present invention;
[0022] Figure 5 A diagram showing the gene expression results of the engineered bacteria provided by the present invention after being induced by ultrasound;
[0023] Figure 6 This is a graph showing the protein secretion results of the engineered bacteria provided by the present invention after being induced by ultrasound;
[0024] Figure 7 This is a result diagram of immunofluorescence detection of ultrasound-regulated intelligent live bacteria expressing IL-2 in tumors of breast cancer model mice provided by the present invention;
[0025] Figure 8 This is a diagram showing the effect of the engineered bacteria provided by the present invention on inhibiting tumor growth. DETAILED DESCRIPTION
[0026] The present invention provides a mutant ibpA RNAT, and the nucleotide sequence of the mutant ibpA RNAT is shown in SEQ ID NO.1: AUGACUAACUUGCUUAAUCUAAGGAGUUUAUGACC. The present invention obtains the mutant ibpA RNAT by gene mutation. Specifically, the present invention replaces the base at position 7 from U to A, the base at position 15 from G to U, and the base at position 21 from C to A in the wild-type ibpA RNAT to obtain the mutant ibpA RNAT. The mutant ibpA RNAT is a stem-loop structure in which a ribosome binding sequence is isolated. When the temperature rises, the RNAT unfolds in a zipper manner, exposing the ribosome binding sequence and the RNA binding protein QKI binding sequence. The ribosome and QKI can bind to their respective sites to regulate the continuous translation of the target gene.
[0027] The present invention also provides an expression cassette of a mutant ibpA RNAT, comprising a constitutive promoter and the mutant ibpA RNAT described in the above technical solution. In a specific embodiment, the constitutive promoter comprises P J23100 ; the P J23100 The nucleotide sequence is shown in SEQ ID NO.2: TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC. The sequence composed of the constitutive promoter and the mutant ibpA RNAT described in the above technical solution is shown in SEQ ID NO.3: 5'-TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCATGACTAACTTGCTT AATCTAAGGAGTTTATGACC-3'.
[0028] The present invention also provides the use of the mutant ibpA RNAT described in the above technical solution or the expression cassette described in the above technical solution in regulating the expression of a target gene.
[0029] The present invention also provides a target gene expression regulation system based on the mutant ibpA RNAT and RNA binding protein QKI described in the above technical solution, comprising a response module and a modification module; in a specific embodiment, the response module and the modification module are directly connected.
[0030] The response module includes: P-ibpA RNAT-target gene; the P-ibpA RNAT-target gene includes a sequentially connected constitutive promoter, the mutant ibpA RNAT described in the above technical solution and the target gene; the target gene includes a reporter gene or a functional protein gene fused with a secretion signal peptide; in the present invention, the secretion signal peptide is connected to the 5' end of the target gene. In a specific embodiment, the secretion signal peptide includes YopE; the nucleotide sequence of YopE is shown in SEQ ID NO.4: 5'-ATGAAAATATCATCATTTATTTCTACATCACTGCCCCTGCCGACA-3'.In a specific embodiment, the reporter gene may be mCherry; the nucleotide sequence of the mCherry is as shown in SEQ ID NO.5: ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTCCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAG。In a specific embodiment, the functional protein gene can be the therapeutic gene IL-2 mutant "Super IL-2"; the nucleotide sequence of the therapeutic gene IL-2 mutant "Super IL-2" is as shown in SEQ ID Shown in NO.6: ATGAAAATATCATCATTTATTTCTACATCACTGCCCCTGCCGACAGCACCTACTTCAAGTTCTACAAAGAAAACACAGCTACAACTGGAGCATTTACTGCTGGATTTACAGATGATTTTGAATGGAATTAATAATTACAAGAATCCCAAACTCACCAGGATGCTCACATTTAAGTTTTACATGCCCAAGAAGGCCACAGAACTGAAACATCTTCAGTGTC TAGAAGAAGAACTCAAACCTCTGGAGGAAGTGCTAAATTTAGCTCAAAGCAAAAACTTTCACTTTGATCCCAGGGACGTAGTAAGCAATATCAACGTATTTGTTCTGGAACTAAAGGGATCTGAAACAACATTCATGTGTGAATATGCTGATGAGACAGCAACCATTGTAGAATTTCTGAACAGATGGATTACCTTTTGTCAAAGCATCATCTCAACACTGACTTGA.
[0031] The remodeling module comprises: RBS-QKI; the RBS-QKI comprises a ribosome binding site and a coding gene of RNA binding protein QKI which are sequentially connected. In a specific embodiment, the nucleotide sequence of the RBS is shown in SEQ ID NO.7: TCACACAGGAC; in the present invention, the nucleotide sequence of the gene encoding the RNA binding protein QKI is shown in SEQ ID NO.8: ATGTATGTGCCTGTAAAAGAATACCCTGATTTTAATTTTGTTGGGAGAATCCTTGGACCTAGAGGACTTACAGCTAAACAACTTGAAGCAGAAACGGGATGTAAAATAATGGTCCGAGGCAAAGGCTCAATGAGGGATAAAAAGAAGGAGGAGCAAAATAGAGGCAAGCCCAATTGGGAGCATCTAAATGAAGACTTACATGTACTAATCACTGTGGAAGATGCTCAGAACAGAGCAGAAATCAAGCTGAAGAGAGCGGTTGAAGAAGTGAAGAAGTTACTGGTACCTGCGGCTGAAGGTGAAGACAGCCTGAAGAAGATGCAGCTGATGGAGCTTGCAATTCTGAATGGCACCTACAGAGACGCCAACATTAAATCACCAGCCTGA. In a specific embodiment, RBS and QKI are connected via a linker sequence, and the linker sequence can optimize ribosome binding and translation initiation to ensure efficient gene expression. In a specific embodiment, the nucleotide sequence of the linker sequence is: TATACAT.
[0032] The present invention connects the target gene fused with a protein secretion signal peptide to the downstream of RNAT, and the target gene can be any gene required for treating various types of diseases, and under heat induction, the specific expression of the gene in the disease site can be achieved. The present invention constructs a target gene expression control system based on mutant ibpA RNAT and RNA binding protein QKI, activates RNAT by increasing temperature, recruits ribosomes and QKI (that is, mutant ibpA RNAT forms a natural binding region of RNA binding protein QKI in the stem-loop structure by introducing three mutations, and once the temperature rises to induce the opening of the stem-loop structure, the QKI protein pre-constitutively expressed in the system will bind to the QKI binding sequence at the mutant ibpARNAT stem-loop structure without affecting the binding of the ribosome), triggers QKI to bind to a specific sequence in the RNAT stem-loop structure, and makes the stem-loop structure unable to recover (that is, when the induction is removed, the temperature drops back to normal, and the mutant ibpARNAT can no longer self-bind into a stem-loop structure), thereby regulating the continuous translation of the target gene, so that the target gene is expressed in a specific window, and accurate expression at the lesion site is achieved.
[0033] In the specific embodiment, the present invention uses mCherry and IL-2 mutant protein "SuperIL-2" as examples to illustrate that the control system provided by the present invention can achieve specific expression of genes at the disease site. mCherry and IL-2 cannot be understood as the entire protection scope of the present invention. The target gene of the present invention can be any gene required for treating various types of diseases.
[0034] The present invention also provides a target gene expression regulation recombinant vector, the vector comprising a basic vector and corresponding modules and a modified module in the target gene expression regulation system described in the above technical solution. The present invention has no special limitation on the construction method of the vector, and conventional methods can be used.
[0035] The present invention also provides a target gene expression regulation engineered bacterium, which is constructed by transferring the target gene expression regulation recombinant vector described in the above technical solution into a recipient bacterium. In a specific embodiment, the recipient bacterium includes attenuated Salmonella typhimurium VNP20009. The present invention has no special limitation on the method of transfer, and a conventional transformation method can be used, which can be electrotransformation.
[0036] The present invention also provides the use of the gene expression regulation system described in the above technical solution, the gene expression regulation recombinant vector described in the above technical solution, or the gene expression regulation engineered bacteria described in the above technical solution in the preparation of products for treating diseases. In the present invention, the product includes a drug. In the present invention, the disease includes a tumor. In the present invention, the tumor includes breast cancer. The gene expression regulation system described in the present invention can improve the effectiveness of local tumor treatment while avoiding potential toxicity caused by systemic administration, ultimately meeting clinical needs.
[0037] The present invention also provides a method for regulating the expression of a target gene in engineered bacteria, comprising the following steps: applying heat induction to the target gene expression regulation engineered bacteria described in the above technical solution. In a specific embodiment, the heat induction includes: heating induction or ultrasonic radiation induction.
[0038] To further illustrate the present invention, a mutant ibpARNAT, a system and method for regulating target gene expression based on mutant ibpA RNAT and applications provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.
[0039] Example 1
[0040] Preparation of smart live bacteria
[0041] 1. Construction of a vector containing a response module: P-ibpARNAT-target gene and a modification module: RBS-QKI.
[0042] The plasmids described in Table 1 were constructed using pET-32a (purchased from SigmaAldrich, catalog number 69015-M) as the basic plasmid. All plasmids in the present invention were synthesized by Nanjing GenScript Biotechnology Co., Ltd., and the expression plasmids constructed in the embodiments of the present invention were sequenced by Nanjing GenScript Biotechnology Co., Ltd.
[0043] Table 1 Plasmid information
[0044]
[0045]
[0046] 2. Preparation of electroporation competent attenuated Salmonella VNP20009 (purchase website: https: / / www.atcc.org / products / baa-3199).
[0047] (1) Take out the corresponding bacterial strain from the -80°C refrigerator, inoculate it into 2 ml of non-resistant LB liquid culture medium and incubate it in a shaking incubator at 37°C and 220 rpm overnight.
[0048] (2) Take the overnight culture solution and inoculate it into 150 ml of LB liquid medium without resistance. Incubate it in a shaker at 37°C and 220 rpm for about 2 hours. Then measure the OD value of the medium at regular intervals. 600 Value, when OD 600 When the concentration reaches 0.3-0.5, take out the conical flask and put it in an ice box for 30 minutes.
[0049] (3) In a sterile clean bench, dispense the bacterial suspension into 50 ml centrifuge tubes, then centrifuge at 4°C, 4000 rpm for 10 min. Discard the supernatant and resuspend in 10 ml of ice-cold sterile double-distilled water.
[0050] (4) Centrifuge at 4000 rpm for 10 min at 4°C, discard the supernatant, resuspend the bacteria in 10 ml of ice-cold sterile 10% glycerol, and incubate on ice for 10 min.
[0051] (5) Repeat step (4) once.
[0052] (6) Centrifuge at 4000 rpm for 10 min at 4°C, discard the supernatant, resuspend the bacteria in 1 ml of ice-cold sterile 10% glycerol, and dispense into 10 1.5 ml EP tubes pre-cooled on ice, 100 μl in each tube.
[0053] (7) Rapidly place in liquid nitrogen. After taking out, it can be used for transformation or placed in a -80℃ refrigerator for long-term storage.
[0054] 3. Prepare smart live bacteria by plasmid electroporation.
[0055] The constructed plasmid was electroporated into VNP20009 competent cells using the Gemini X2 system (BTX) at 2.5 kV and 186 ohms. The resulting bacteria were cultured in 800 microliters of Luria-Bertani (LB) medium at 37°C and 150 rpm for 1 hour. Subsequently, it was spread on LB solid medium containing ampicillin and cultured at 37°C for 12 hours. The genetically engineered bacteria of the target plasmid were selected and amplified overnight in LB medium at 37°C and 220 rpm. All clones were verified by sequencing, and the qualified bacteria were stored in a -80°C refrigerator for later use.
[0056] Example 2
[0057] Detection of gene expression induced by heating in smart live bacteria
[0058] In this example, mCherry is used as a reporter gene, and its nucleotide sequence is shown in SEQ ID NO. 5. The translation level of bacterial protein is induced by heating in the smart live bacteria.
[0059] Plasmid construction:
[0060] The plasmid constructed in this example is pET-32a-mCherry in Table 1.
[0061] Construct the corresponding strain:
[0062] The plasmid pET-32a-mCherry was transformed into VNP20009 competent cells by electroporation. The resulting bacteria were cultured in 800 μl Luria-Bertani (LB) medium at 37°C and 150 rpm for 1 hour. Subsequently, it was spread on LB solid medium containing ampicillin and cultured at 37°C for 12 hours. The genetically engineered bacteria of the target plasmid were selected and amplified overnight in LB medium at 37°C and 220 rpm. All clones were verified by sequencing, and the qualified bacteria were stored in a -80°C refrigerator for standby use.
[0063] Induction at different temperature intensities and detection of gene expression
[0064] The successfully constructed strain was amplified at 37°C and 220 rpm, while monitoring the OD 600 . Waiting for OD 600 =0.2-0.3, take two equal portions of 1 ml of bacterial solution and transfer them to 1.5 ml EP tubes, induce them at different temperatures (37°C, 42°C) in a metal bath for 30 min, then place them in an incubator at 37°C for 12 h, take four parallel samples from each group, pipette 10 μl and transfer them to a glass slide, place them under a fluorescence microscope, and detect the expression of the mCherry gene.
[0065] The results showed that at body temperature, the expression of mCherry was significantly inhibited. When the temperature rose to 42°C, the expression of the mCherry gene was activated, proving that the smart live bacteria containing the target gene expression regulation system can regulate the expression of the mCherry gene after being induced by heating. Figure 3 The results of the four parallel samples at 37°C were 1.045168, 0.957773, 1.215816 and 0.781242 respectively; the results of the four parallel samples at 42°C were 7.840071, 7.401546, 7.64143 and 7.297395 respectively.
[0066] The average body temperature of female Balb / c mice is usually between 36.5°C and 37.5°C. In the present invention, "body temperature" generally refers to 37°C.
[0067] Example 3
[0068] Detection of the relationship between ultrasonic radiation and temperature change
[0069] In this embodiment, a real-time detection system for ultrasonic-induced temperature rise is constructed to explore the relationship between ultrasonic radiation and temperature change.
[0070] System construction:
[0071] 10 ml of bacterial solution was placed in a medium dish, and an ultrasonic probe coated with a coupling agent (Haifu Medical, Chongqing, China) was placed under the dish. At the same time, a temperature detection probe (Testo 922, Germany) was inserted into the bacterial solution to detect the temperature change of the bacterial solution under different ultrasonic radiation conditions in real time.
[0072] The results showed that the temperature of the bacterial solution gradually increased under ultrasonic radiation, and at a duty cycle of 30%, the temperature of the bacterial solution could be maintained at a certain level. Figure 4 As shown, 2.0w / cm 2 The ultrasonic parameters can keep the bacterial solution temperature at 42°C, so this parameter will be used as the parameter for subsequent ultrasonic irradiation. Figure 4 .
[0073] Example 4
[0074] Detection of gene expression induced by ultrasound radiation in smart live bacteria
[0075] In this example, mCherry is used as a reporter gene, and its nucleotide sequence is shown in SEQ ID NO. 5. The gene expression level of bacteria induced by ultrasonic radiation in the smart live bacteria was verified.
[0076] Plasmid construction:
[0077] The plasmid constructed in this example is pET-32a-mCherry in Table 1.
[0078] Construct the corresponding strain:
[0079] The plasmid pET-32a-mCherry was transformed into VNP20009 competent cells by electroporation. The resulting bacteria were cultured in 800 μl Luria-Bertani (LB) medium at 37°C and 150 rpm for 1 hour. Subsequently, it was spread on LB solid medium containing ampicillin and cultured at 37°C for 12 hours. The genetically engineered bacteria of the target plasmid were selected and amplified overnight in LB medium at 37°C and 220 rpm. All clones were verified by sequencing, and the qualified bacteria were stored in a -80°C refrigerator for standby use.
[0080] Ultrasound irradiation induction and gene expression detection
[0081] The successfully constructed strain was amplified at 37°C and 220 rpm, while monitoring the OD600 . Waiting for OD 600 =0.2-0.3, take 10 ml of bacterial solution and transfer it to a medium dish, take four parallel samples and transfer 10 μl to a glass slide, place it under a fluorescence microscope, and detect the expression of the mCherry gene; then perform ultrasonic induction for 30 minutes, after induction, take four parallel samples again and transfer 10 μl to a glass slide, place it under a fluorescence microscope, and detect the expression of the mCherry gene.
[0082] The results showed that before ultrasound, the expression of mCherry was significantly inhibited, and ultrasound induction activated the expression of mCherry gene, proving that the smart live bacteria containing the target gene expression regulation system can regulate the expression of mCherry gene after being induced by ultrasound radiation. Figure 5 ; Before ultrasound, the data of the four parallel samples were 0.976253, 0.980866, 1.182071 and 0.936212 respectively; after ultrasound, the data of the four parallel samples were 7.192369, 7.100556, 6.622814 and 6.548698 respectively.
[0083] Example 5
[0084] Detection of target protein secretion by smart live bacteria after induction by ultrasonic radiation
[0085] In this example, IL-2 is used as a reporter gene, and the nucleotide sequence is shown in SEQ ID NO.6.
[0086] It was verified that the smart live bacteria could secrete the target protein outside the bacteria after being induced by ultrasonic radiation.
[0087] 1. Construction of plasmids. The plasmids in this example are shown in Table 1.
[0088] 2. Transform the plasmid pET-32a-YopE-IL-2 into VNP20009 competent cells according to the method in Example 1.
[0089] 3. Ultrasound induction and protein secretion detection.
[0090] The successfully constructed strain was amplified at 37°C and 220 rpm, while monitoring the OD 600 . Waiting for OD 600 =0.4-0.6, take 10 ml of bacterial solution and transfer it to a medium dish, and place it in an incubator at 37°C for 12 h after focused ultrasound induction for 30 min.
[0091] The samples before and after ultrasonic induction were collected, and the 1.5 ml EP tube containing 1 ml of bacterial solution was centrifuged (3000 rpm) for 5 min, and the supernatant was filtered through a 0.2 μm filter. The IL-2 content in the sample was determined by the human interleukin 2 (IL-2) enzyme-linked immunosorbent assay (ELISA) kit (E-EL-H0099, Elabscience) according to the instructions.
[0092] The results showed that the IL-2 content in the bacterial supernatant after ultrasound induction increased significantly, indicating that the smart live bacteria successfully secreted the target protein after ultrasound radiation induction, and the YopE signal peptide had good secretion efficiency. Figure 6 ; The sample data before ultrasonic induction were 5.49, 6.01, 4.49 and 8.44 respectively; the sample data after ultrasonic induction were 50.38, 55.89, 54.23 and 61.22 respectively.
[0093] Example 7
[0094] Immunofluorescence detection of ultrasound-regulated IL-2 expression in tumors after tail vein injection
[0095] 1. Construction of plasmid pET-32a-YopE-IL-2. The plasmids in this example are shown in Table 1.
[0096] 2. Transform the plasmid pET-32a-YopE-IL-2 into VNP20009 competent cells according to the method in Example 1.
[0097] 3. Amplify the successfully constructed strain at 37°C and 220rpm, and monitor OD 600 . Waiting for OD 600 =0.4-0.6, adjust the bacterial OD 600 The value was 0.2, and then two times the volume of PBS was added. Finally, each tumor-bearing mouse (average tumor volume was 100mm 3 ) 300ul bacterial solution was injected into the tail vein.
[0098] 4. Two days after the tail vein injection of bacteria, a specific group was given ultrasound stimulation (2W cm -2 ), the duration was 30 minutes, and ultrasound was given every 2 days, for a total of 3 times.
[0099] 5. Harvest tissue for immunofluorescence detection.
[0100] After the experimental animals were euthanized, fresh tumor tissues were obtained and sent to Wuhan Sevier Biotechnology Co., Ltd. for immunofluorescence sectioning and scanning.
[0101] The results showed that compared with the control group, ultrasound regulated the expression and secretion of IL-2 in mouse tumors by smart live bacteria. The experimental results are detailed in Figure 7 .
[0102] Example 8
[0103] Ultrasound-controlled intelligent live bacteria for breast cancer treatment after tail vein injection (4T1)
[0104] 1. Construction of plasmid pET-32a-YopE-IL-2. The plasmids in this example are shown in Table 1.
[0105] 2. Transform the plasmid pET-32a-YopE-IL-2 into VNP20009 competent cells according to the method in Example 1.
[0106] 3. Amplify the successfully constructed strain at 37°C and 220rpm, and monitor OD 600 . Waiting for OD 600 =0.4-0.6, adjust the bacterial OD 600 The value was 0.2, and then two times the volume of PBS was added. Finally, each tumor-bearing mouse (average tumor volume was 100mm 3 ) 300ul bacterial solution was injected into the tail vein.
[0107] 4. The cells were randomly divided into four groups (PBS group (G1), VNP20009 group (G2), pET-32a-YopE-IL-2 group (G3), and pET-32a-YopE-IL-2+US group (G4)). Two days after the tail vein injection of bacteria, the specific groups were given ultrasound stimulation (2 W cm -2 ), the time was 30 minutes, and ultrasound was given every 2 days for a total of 3 times. Tumor volume was monitored.
[0108] The results showed that compared with the PBS group, the VNP20009 group and the pET-32a-YopE-IL-2 group had a slight inhibitory effect on tumor growth, while the pET-32a-YopE-IL-2+US group had a significant inhibitory effect compared with the other three groups. Figure 8 and Table 2.
[0109] Table 2 Experimental data
[0110]
[0111] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A mutant ibpA RNAT, characterized in that: The nucleotide sequence of the mutant ibpA RNAT is shown in SEQ ID NO.
1.
2. An expression cassette of a mutant ibpA RNAT, characterized in that: It comprises a constitutive promoter and the mutant ibpA RNAT according to claim 1.
3. Use of the mutant ibpA RNAT according to claim 1 or the expression cassette according to claim 2 in regulating the expression of a target gene.
4. A target gene expression regulation system based on the mutant ibpA RNAT and RNA binding protein QKI according to claim 1, characterized in that: Includes response module and remodeling module; The response module comprises: P-ibpA RNAT-target gene; the P-ibpA RNAT-target gene comprises a constitutive promoter, the mutant ibpA RNAT according to claim 1 and a target gene connected in sequence; the target gene comprises a reporter gene or a functional protein gene fused with a secretion signal peptide; The remodeling module comprises: RBS-QKI; the RBS-QKI comprises a ribosome binding site and a coding gene of RNA binding protein QKI which are sequentially connected.
5. A recombinant vector for regulating expression of a target gene, characterized in that: The vector comprises a basic vector and corresponding modules and a modified module in the target gene expression regulation system according to claim 4.
6. A target gene expression regulation engineering bacterium, characterized in that: The engineered bacteria are constructed by transferring the target gene expression regulating recombinant vector described in claim 5 into a recipient bacterium.
7. Use of the gene expression regulation system according to claim 4, the gene expression regulation recombinant vector according to claim 5, or the gene expression regulation engineered bacteria according to claim 6 in the preparation of products for treating diseases.
8. A method for regulating the expression of a target gene in an engineered bacterium, characterized in that: The following steps are involved: Apply heat induction to the target gene expression regulation engineered bacteria as described in claim 6.