Method for marking gram-negative bacterial vesicles by using fluorescent protein carrier and application of gram-negative bacterial vesicles

Abstract

The invention discloses a method for marking gram-negative bacterial vesicles by using a fluorescent protein carrier and application, and belongs to the technical field of seamless cloning and marking of bacterial outer membrane vesicles. The invention discloses a method for marking Gram-negative bacterium vesicles by using a fluorescent protein carrier. The fluorescent protein carrier pBAD18-ClyA-EGFP (Enhanced Green Fluorescent Protein) is transferred into Gram-negative bacteria. The problems that traditional multi-fragment connection is tedious in operation, residual dye influences tests after OMVs are marked by fluorescent dye, and the dye has no specificity are solved, after OMVs are marked, the composition and structural integrity of the OMVs are protected, and the migration path of the OMVs in cells and tissue organs can be specifically tracked and positioned.

Description

Technical Field

[0001] The invention relates to the technical field of seamless cloning and labeling of bacterial outer membrane vesicles, and more specifically to a method and application of labeling Gram-negative bacterial vesicles using a fluorescent protein vector. Background Art

[0002] At present, the research on bacterial outer membrane vesicles (OMVs) is quite hot, but most reports are limited to the analysis of vesicle components and the study of toxicity mechanisms. There are few reports on how to label OMVs and track their shuttle paths in cells and host tissues and organs. Currently, researchers use fluorescent dyes such as DIR, PKH26, and DIO to label exosomes, but because they are non-specific, they cannot be used to label OMVs for scientific research on cells and experimental animals.

[0003] Therefore, providing a method and application of labeling Gram-negative bacterial vesicles using fluorescent protein vectors is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0004] In view of this, the present invention provides a method and application of labeling Gram-negative bacterial vesicles using fluorescent protein vectors, using green fluorescent protein (EGFP) and bacterial outer membrane protein cytolysin A (ClyA) to express fusion protein, thereby achieving the purpose of labeling OMVs and being applied in scientific research.

[0005] The present invention minimizes the impact on the composition and structure of OMVs, uses seamless cloning technology to connect multiple fragments, inserts green fluorescent protein (EGFP) into the bacterial outer membrane protein ClyA to mark OMVs, and aims to track and locate the migration path of OMVs in cells and experimental animal tissues and organs.

[0006] The present invention solves the problems of cumbersome traditional multi-fragment connection operations, the influence of residual dyes on experiments after fluorescent dyes are used to label OMVs, and the non-specificity of dyes. After labeling OMVs, the present invention not only protects the integrity of its components and structure, but also can specifically track and locate the migration path of OMVs in cells and tissues and organs.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] A fluorescent protein vector pBAD18-ClyA-EGFP is provided. A ClyA gene sequence and an EGFP gene sequence are inserted into the vector pBAD18; the ClyA gene sequence is shown as SEQ ID NO.1; and the EGFP gene sequence is shown as SEQ ID NO.2.

[0009] Furthermore, a method for labeling Gram-negative bacterial vesicles using a fluorescent protein vector is provided, wherein the fluorescent protein vector pBAD18-ClyA-EGFP is transferred into Gram-negative bacteria.

[0010] Furthermore, the fluorescent protein vector pBAD18-ClyA-EGFP or the method described is used in labeling Gram-negative bacterial vesicles.

[0011] Furthermore, the fluorescent protein vector pBAD18-ClyA-EGFP or the method described is used in tracking and locating the migration path of Gram-negative bacterial OMVs in cells and tissues and organs.

[0012] ClyA is an outer membrane protein of Enterobacter. Reports have shown that bacterial membrane vesicles (OMVs) contain a large amount of this protein. Inserting EGFP into the C-terminus of ClyA can be expressed on the bacterial outer membrane, thereby specifically marking OMVs without affecting their conformational changes.

[0013] It can be seen from the above technical solutions that, compared with the prior art, the present invention discloses a method and application of labeling Gram-negative bacterial vesicles using fluorescent protein vectors, which has the following beneficial effects:

[0014] (1) Labeling OMVs maintains their original shape and size, greatly reducing the impact on OMVs in experimental research. Traditional labeling of OMVs has residual dyes that cannot be removed, and the impact of treating experimental animals or cells on the experiment is unpredictable. Using EGFP labeling avoids this drawback.

[0015] (2) This method is low-cost. After the recombinant vector is successfully constructed, it only needs to be transferred into the Gram-negative bacteria used in the experiment to label the OMVs, without the need to purchase fluorescent dyes for each experiment.

[0016] (3) The present invention uses seamless cloning to connect ClyA, EGFP and the vector in one step, thereby improving the fidelity of the base sequence and reducing experimental operations. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0018] Figure 1 The accompanying drawing is the map information of the plasmid pBAD18 of the present invention;

[0019] Figure 2 The attached figure is the spectrum information after the target fragment is inserted into the present invention;

[0020] Figure 3 The accompanying drawings show the colony growth of target fragments of different proportions according to the present invention;

[0021] Among them, the molar ratios of AF: each fragment and vector were 0.5:1, 1:1, 1.5:1, 2:1, 2.5:1 and 3:1 respectively;

[0022] Figure 4 The accompanying drawing shows the enzyme-cut recombinant vector of the present invention;

[0023] Wherein, M: Marker; 1-3: the results of plasmid extraction and enzyme digestion after amplification and culture of 3 positive bacteria;

[0024] Figure 5 The accompanying drawings show the PCR verification of ClyA and ClyA-EGFP fragments of the present invention;

[0025] Wherein, M: Marker; 1-3: PCR amplification results of ClyA-EGFP fragment extracted from plasmid after amplification and culture of 3 positive bacteria; 4-6: PCR amplification results of ClyA fragment extracted from plasmid after amplification and culture of 3 positive bacteria;

[0026] Figure 6 The accompanying drawing shows the extraction of OMVs after transfer into homologous recombination vectors of the present invention;

[0027] Among them, A: CLSM×200; B: CLSM×400;

[0028] Figure 7 The accompanying figure shows the particle size distribution of OMVs before and after DLS detection labeling of the present invention;

[0029] Among them, A: OMVs size distribution without EGFP labeling; B: OMVs size distribution after EGFP labeling;

[0030] Figure 8 The attached figure shows the OMVs before and after labeling observed by scanning electron microscope of the present invention;

[0031] Among them, A: OMVs not labeled with EGFP; B: OMVs labeled with EGFP;

[0032] Fig. 9 The accompanying drawing is a flow chart of the present invention using fluorescent protein vectors to label Gram-negative bacterial vesicles;

[0033] Fig.10 The attached figure shows the tracking of the migration path of EGFP-OMVs of the present invention; H&E 400×;

[0034] Among them, A: co-localization of fluorescence between uterus and ovary in group B; B: co-localization of fluorescence between uterus and ovary in group C;

[0035] a: uterus; b: ovary. DETAILED DESCRIPTION

[0036] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0037] Example 1 Information Acquisition of Recombinant Vectors

[0038] Obtain pBAD18 map information from the Snapgene database ( Figure 1 ); the ClyA gene sequence (as shown in SEQ ID NO.1) and the EGFP gene sequence (as shown in SEQ ID NO.2) were retrieved from the CCR database, and then the plasmid map was opened using SnapGene (version 7.2.0), and the two target fragments were inserted. The pBAD18-ClyA-EGFP vector map is shown in Figure 2 .

[0039] ClyA gene sequence:

[0040] ATGACTGAAATCGTTGCAGATAAAACGGTAGAGGTAGTTAAAAACGCAATCGAAACCGCAGATGGAGCATTAGATCTTTATAATAAATATCTCGATCAGGTCATCCCCTGGCAGACCTTCGATGAAACCATAAAAGAGTTAAGTCGCTTTAAACAGGAGTATTCACAGGCAGCCTCCGTTTTAGTTGGCGATATTAAAACCTTACTTATGGATAGCCAGGATAAGTATTTTGAAGCAACCCAAACGGTGTATGAATGGTGTGGTGTTGCGACGCAATTGCTCGCAGCATATATTTTGCTATTTGATGAGTACAATGAGAAGAAAGCATCCGCCCAGAAAGACATTCTCATTAAAGGTACTGGATGACGGCATCACGAAGCTGAATGAAGCGCAAAAATCTCTGCTGGTAAGCTCACAAAGTTTCAACAACGCTTCCGGAAAAGCTGCTGGCGTTAGATAGCCAGTTAACCAATGATTTTTCAGAAAAAAGCAGCTATTTCCAGTCACAGGTAGATAAAATCAGGAGGGAAGCGTATGCCGGTGCCGCAGCCGGTGTCGTCGCCGGTCCATTTGGATTAATCATTTCCTATTCTATTGCTGCGGCCGTAGTTGAAGGGAAACTGATTCCAGAATTGAAGAACAAGTTAAAATCTGTGCAGAATTTCTTTACCACCCTGTCTAACACGGTTAACAAAGCGAATAAAGATATCGATGCCGCCAAATTGAAATTAACCACCGAAGATAGCCGCCATCGGTGAGATAAAAACGGAAACTGAAACAACCAGATTCTACGTTGATTATGATGATTTAATGCTTTCTTTGCTAAAAGAAGCGGCCAAAAAAATGATTAACACCTGTAATGAGTATCAGAAAAGACACGGTAAGAAGAC ACTCTTTGAGGTAC CTGAAGTCTGA ; SEQ ID NO.1.

[0041] EGFP gene sequence:

[0042] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACC ACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCC TGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAG CGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCG GCATGGACGAGCTGTACAAG ; SEQ ID NO.2.

[0043] Example 2 Method for constructing a recombinant vector

[0044] The pBAD18 vector was double-digested with restriction endonucleases EcoRⅠ and HindⅢ. The digestion system was as follows: QuickCut EcoRⅠ5μL, QuickCut HindⅢ5μL, plasmid DNA 1μg, ddH 2 Add 0 to 50 μL and react at 37°C for 4 h to obtain the linearized pBAD18 vector.

[0045] E. coli DH5α was grown to OD 600 When the pH is 0.8, take 1 mL of bacterial solution and centrifuge at 5000 r / min for 5 min, discard the supernatant and add 100 μL ddH2 O was resuspended as a template, and the ClyA target fragment amplification system and procedure were as follows:

[0046] ClyA cloning system: ClyA-F 1μL, ClyA-R 1μL, 10× Buffer 5μL, dNTP 4μL, Tap enzyme 1μL, template 5μL, ddH 2 O 33 μL.

[0047] ClyA reaction program: 95°C for 3 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 29 cycles; 72°C for 5 min, 12°C∞.

[0048] Using the synthetic EGFP gene sequence (shown in SEQ ID NO.2) as a template, the PCR cloning EGFP target fragment system and procedure are as follows:

[0049] EGFP reaction system: EGFP-F 1μL, EGFP-R 1μL, 10×Buffer 5μL, dNTP 4μL, Tap enzyme 1μL, template 5μL, ddH 2 O 33 μL.

[0050] EGFP cloning program: 95°C for 3 min; 95°C for 30 s, 55°C for 30 s, 72°C for 40 s, 29 cycles; 72°C for 5 min, 12°C∞.

[0051] The primer sequences used are as follows:

[0052] ClyA-F:

[0053] ACCCGTTTTTTTGGGCTAGCGAATTC ATGACTGAAATCGTTGCAGAT;SEQ ID NO.3;

[0054] ClyA-R:

[0055] TCCTCGCCCTTGCTCACCATGTCGACGAC TCAGACTTCAGGTACCTCAA AGAGT;SEQ ID NO.4;

[0056] EGFP-F:

[0057] ACTCTTTGAGGTACCTGAAGTCTGA ATGGTGAGCAAGGGCGAGGA;SEQ ID NO.5;

[0058] EGFP-R:

[0059] TCTCATCCGCCAAAACAGCCAAGCTT CTTGTACAGCTCGTCCATGC; SEQ ID NO. 6.

[0060] The homology arm sequences are underlined.

[0061] Seamless cloning and connecting of each fragment. According to the instructions of OK Clon DNA Ligation KitⅡ of Acori Biotechnology, 6 comparative examples (Table 1) were set up, the amount of vector was 100ng, and the molar ratio of each fragment to vector was 0.5:1, 1:1, 1.5:1, 2:1, 2.5:1 and 3:1. The calculation formula is as follows:

[0062] Insert amount ng = B / C × A × vector amount ng

[0063] A is the molar ratio of insert to vector, B is the size of insert (bp), and C is the size of vector (bp).

[0064] Table 1 Dosage of target fragments in different proportions

[0065] DNA / ng ratio 0.5：1 1：1 1.5：1 2：1 2.5：1 3：1 pBAD18 100 100 100 100 100 100 ClyA 9.885107 19.77021 29.65532 39.54043 49.42554 59.31064 EGFP 7.804032 15.60806 23.4121 31.21613 39.02016 46.82419

[0066] Add pBAD18, ClyA and EGFP according to Table 1 and wash with ddH 2 O was added to 10 μL system, reacted at 50℃ for 30 min, and then transformed into DH5α competent cells. After shaking on a shaker at 100 r / min for 45 min, 100 μL of the bacterial solution was spread on ampicillin (100 μg / mL) resistant LB medium and cultured overnight. The number of colonies grown with different amounts of target fragments was shown in Figure 2. Figure 3 .

[0067] Positive colonies were selected for culture and plasmid extraction, and restriction enzyme digestion was performed using EcoRⅠ and HindⅢ. Figure 4 PCR was used to verify the ClyA (primers ClyA-F / R) and ClyA-EGFP (primers ClyA-F and EGFP-R) fragments. The system and procedure used were the same as above. The results are shown in Figure 5 The bands were correctly sent to Qingke Biotechnology Company for sequencing, and the sequencing primers are as follows:

[0068] Sequencing primer F: GACGCTTTTTATCGCAACTC; SEQ ID NO. 7;

[0069] Sequencing primer R: TCAGACCGCTTCTGCGTTCT; SEQ ID NO.8.

[0070] The sequencing results were correct.

[0071] Example 3 Bacterial OMVs extraction and characterization

[0072] The verified positive bacteria were cultured to the logarithmic phase of growth to extract OMVs. The OMVs were extracted using the Runji Bio Bacterial Vesicle Isolation Kit (BacMV40-10). The specific operation is as follows:

[0073] (1) Collect fresh bacterial suspension and cool it on ice. Centrifuge at 5000 × g at 4°C for 20 min. Collect the supernatant and repeat the above centrifugation to remove all bacteria and bacterial debris.

[0074] (2) Pipette 40 ml of the supernatant treated above into a 50 ml centrifuge tube, add 4 ml of binding buffer, cover tightly, and invert to mix.

[0075] (3) Pipette 1.6 ml of the binding resin (mix the binding resin thoroughly before aspiration and aspirate quickly) and add it to the 50 ml centrifuge tube in step (2). Close the lid tightly, invert and mix at room temperature for 15 minutes, and centrifuge at 1500×g for 2 minutes.

[0076] (4) Take 1 ml of supernatant (do not discard it), carefully pour out the remaining supernatant, gently blow up the resin with the supernatant, and transfer all of it to the purification column (which has been placed in the collection tube). Let it stand for 2 minutes, centrifuge at 2000×g for 2 minutes at room temperature, discard the filtrate, and put the purification column back into the collection tube.

[0077] (5) Take 2 ml of washing solution and add it to the purification column (which has been placed in the collection tube), let it stand for 3 minutes, centrifuge it at 3000×g at room temperature for 2 minutes, discard the filtrate, and repeat the washing process once.

[0078] (6) Transfer the purification column to a 15 ml centrifuge tube with low protein adsorption, add 1.6 ml of elution buffer, let stand for 5 min, centrifuge at 300 × g at room temperature for 2 min, add the filtrate back to the purification column, let stand for 2 min, and finally centrifuge at 3000 × g for 2 min. The liquid obtained in the centrifuge tube is the concentrated bacterial OMVs solution.

[0079] like Figure 6 As shown, E. coli carrying pBAD18-ClyA-EGFP was cultured to the exponential growth phase, and then EGFP-OMVs were extracted and observed under a fluorescence microscope at 200 and 400 times, respectively. It can be seen that EGFP-OMVs emit green fluorescence, indicating that EGFP-OMVs are successfully labeled. Dynamic light scattering (DLS) was used to detect the particle size distribution, and the results are shown in Figure 7 As shown in Figure 2, the radius of OMVs before and after labeling with EGFP protein is concentrated between 30 and 40 nm, indicating that labeling with EGFP has no effect on the size of OMVs. The OMVs before and after labeling were observed under a scanning electron microscope. Figure 8 As shown, the surface is smooth and spherical, and there is no significant difference in features before and after marking.

[0080] Example 4

[0081] 1) A method for labeling Gram-negative bacterial vesicles using a fluorescent protein vector, the process being ( Fig. 9 )as follows:

[0082] pBAD18 was linearized by double digestion with EcoRI and HindIII, and the target fragments of ClyA and EGFP were cloned using specific primers, followed by seamless cloning and ligation and transfer into competent cells, and the bacteria were cultured to the exponential growth phase to extract the labeled OMVs (EGFP-OMVs). For the specific process, see Example 1-3.

[0083] 2) Observe and track the migration path of EGFP-OMVs:

[0084] Fifteen 6-week-old KM experimental mice were randomly divided into 3 groups, 5 mice in each group. Groups A, B, and C were perfused through the uterus with 20 μL of normal saline, 20 μL of 5×10 9 / mL EGFP-OMVs and 20 μL of E. coli containing pBAD18-ClyA-EGFP (1×10 9 CFU / mL), mice in group B were euthanized 24 hours after perfusion, and ovarian and uterine tissues were collected for embedding in OCT embedding medium. Mice in groups A and C were euthanized 3 days after perfusion, and ovarian and uterine tissues were collected for embedding in OCT embedding medium, and frozen sections were stained with H&E. The migration path of EGFP-OMVs was observed and tracked under a laser confocal microscope. The results are shown in Fig.10 No green fluorescence was observed in the uterus and ovaries of group A (not shown in the picture: no green fluorescence means the whole picture is black), while green fluorescent protein was observed in the uterus and ovaries of groups B and C. By co-localizing the green light channel and the white light channel, EGFP-OMVs were observed to enter the myometrium tissue and be distributed around the follicles, indicating that EGFP-OMVs can be transported from the uterus to the ovaries. This discovery provides a new idea for revealing the impact of endometritis on ovarian dysfunction.

[0085] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A fluorescent protein vector pBAD18-ClyA-EGFP, characterized in that: The ClyA gene sequence and the EGFP gene sequence are inserted into the vector pBAD18; the ClyA gene sequence is shown as SEQ ID NO.1; and the EGFP gene sequence is shown as SEQ ID NO.

2.

2. A method for labeling Gram-negative bacterial vesicles using a fluorescent protein vector, characterized in that: The fluorescent protein vector pBAD18-ClyA-EGFP according to claim 1 is transferred into Gram-negative bacteria.

3. Use of the fluorescent protein vector pBAD18-ClyA-EGFP described in claim 1 or the method described in claim 2 in labeling Gram-negative bacterial vesicles.

4. Use of the fluorescent protein vector pBAD18-ClyA-EGFP described in claim 1 or the method described in claim 2 in tracking and locating the migration path of Gram-negative bacterial OMVs in cells and tissues and organs.

Images