Application of McMYC2 transcription factor in regulating stress resistance of Mentha haplocalyx
By overexpressing the mint McMYC2 transcription factor through genetic engineering, the problem of improving the stress resistance of mint was solved, and the transgenic mint plants were made more drought-tolerant and drought-resistant, with increased SOD and POD activity and reduced water loss rate.
Patent Information
- Application Number
- CN202510212200.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-25
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2045-02-25
AI Technical Summary
Peppermint has limited yield potential. Abiotic stress factors such as drought are the main limiting factors for plant growth, development and yield formation. Existing technologies cannot improve the stress resistance of peppermint through molecular means to promote quality improvement.
Using genetic engineering techniques, we clarified the important function of the peppermint McMYC2 transcription factor in regulating stress resistance. We enhanced the drought resistance of peppermint plants by overexpressing the McMYC2 transcription factor, constructed a recombinant vector containing the McMYC2 encoding gene, and transformed it into peppermint plants for overexpression.
It improved the drought resistance of transgenic mint plants, enhanced the activity of superoxide dismutase (SOD) and peroxidase (POD), reduced the relative water loss rate, and significantly improved the drought resistance of mint.
Smart Images

Figure CN120099078B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering breeding, and relates to application of McMYC2 transcription factor in regulation of resistance of Mentha canadensis L. BACKGROUND
[0002] Mentha canadensis L. is a traditional Chinese medicinal material, and its dry aboveground parts have the effects of clearing heat and relieving superficies, soothing liver and relieving depression, and are used for treating wind-heat cold, headache, fever and sore throat. The leaves and stems of Mentha canadensis L. contain volatile components, commonly known as essential oil, and the content of the essential oil is a main index for evaluating the medicinal and flavor of Mentha canadensis L. Modern pharmacological studies show that the essential oil of Mentha canadensis L. has the effects of relieving phlegm, anti-inflammatory and analgesic, and exciting central nervous system. Meanwhile, the essential oil of Mentha canadensis L. is widely used in food, spices, cosmetics and the like, and in some areas of China, Mentha canadensis L. is also a fresh vegetable, an ornamental plant and a potential energy plant, and has great medicinal and economic values.
[0003] It is found that the essential oil of Mentha canadensis L. is also closely related to the life activities of plants, such as regulation of pollination, seed dispersal and growth and development of plants. In recent years, more and more studies show that the essential oil of Mentha canadensis L. is closely related to the abiotic and biotic defense processes of plants. For example, menthol existing in the essential oil of Mentha canadensis L. has insecticidal and antiviral activities in addition to characteristic aroma and flavor. Meanwhile, the essential oil of Mentha canadensis L. has a good control effect on citrus sour rot, and Liu Linyu et al. also found that the essential oil of Mentha canadensis L. has a good inhibitory effect on plant pathogenic fungi such as Botrytis cinerea, Sclerotinia sclerotiorum, Fusarium oxysporum, Phytophthora capsici and Colletotrichum lindemuthianum, and Qu Yangchun et al. found that the essential oil of different species has a significant inhibitory effect on Aspergillus flavus, and can be used for mold control and preservation of rice. In addition, the essential oil of Mentha canadensis L. can effectively inhibit fruit rot and prolong the preservation time of fruits. It can be seen that the essential oil of Mentha canadensis L. not only has medicinal and commercial development values, but also has a significant regulation effect on the growth and development of crops. Meanwhile, the essential oil of Mentha canadensis L. is a plant-derived “green pesticide” and has a certain biocontrol effect, and has important significance for preventing and controlling plant diseases and insect pests, reducing environmental pollution and reducing agricultural production costs.
[0004] At present, with the increasing demand for essential oil in the market, the output value of the essential oil of Mentha canadensis L. also rapidly increases. However, the yield-increasing potential of Mentha canadensis L. is limited. In addition, abiotic stress factors such as drought are one of the main limiting factors for plant growth and development and yield formation. How to improve the resistance of Mentha canadensis L. through molecular means, promote the quality improvement of Mentha canadensis L. and realize the innovation of the source of Mentha canadensis L. has become a problem to be solved in the breeding and improvement of Mentha canadensis L. SUMMARY
[0005] In order to breed high-quality and strong-adaptability new varieties of Mentha haplocalyx, and improve the drought resistance of Mentha haplocalyx, the application discloses a gene engineering method, and the important function of a Mentha haplocalyx McMYC2 transcription factor in regulating the stress resistance of Mentha haplocalyx is determined.
[0006] The application provides the application of the Mentha haplocalyx transcription factor in regulating the stress resistance of Mentha haplocalyx, and the transcription factor is McMYC2, and the amino acid sequence of the McMYC2 is shown in SEQ ID NO:1.
[0007] Further, in the application, the stress resistance includes drought resistance.
[0008] Further, in the application, the Mentha haplocalyx transcription factor McMYC2 is overexpressed, and the drought resistance of the Mentha haplocalyx plant is enhanced.
[0009] In a second aspect, the application provides a genetic recombination vector containing a coding gene of the Mentha haplocalyx transcription factor McMYC2, and the nucleotide sequence of the coding gene is shown in SEQ ID NO:2.
[0010] In a third aspect, the application provides a recombination genetic engineering bacterium containing the genetic recombination vector.
[0011] Based on the above characteristics of the McMYC2, the application provides a breeding method of drought-resistant Mentha haplocalyx varieties in a fourth aspect: an overexpression recombination vector containing a coding gene of the Mentha haplocalyx transcription factor McMYC2 is constructed, and the overexpression recombination vector is transferred into a Mentha haplocalyx plant to perform overexpression; and the nucleotide sequence of the coding gene of the Mentha haplocalyx transcription factor McMYC2 is shown in SEQ ID NO:2.
[0012] Compared with the prior art, the application of the McMYC2 transcription factor in regulating the stress resistance of Mentha haplocalyx has the following beneficial effects:
[0013] The application overexpresses the coding gene (namely, the McMYC2 gene) of the Mentha haplocalyx McMYC2 transcription factor in the Mentha haplocalyx plant through a genetic engineering method, and a transgenic Mentha haplocalyx plant with overexpression of the McMYC2 gene is obtained. Tests prove that the transgenic Mentha haplocalyx plant is more drought-resistant than a wild type (WT) Mentha haplocalyx plant, has higher activities of superoxide dismutase (SOD) and peroxidase (POD), and has lower relative water loss. qRT-PCR analysis shows that overexpression of the McMYC2 can significantly improve the expression level of a drought-related gene McWRKY57 in a Mentha haplocalyx leaf, and it is indicated that the McMYC2 plays an important function in the drought resistance of the Mentha haplocalyx. In addition, the McMYC2 gene responds to abscisic acid (ABA), NaCl, AlCl3, CdCl2, CuCl2 and other abiotic stresses, is a widely-expressed gene, and participates in the stress resistance process of the Mentha haplocalyx plant.
[0014] Based on the above functions of McMYC2 gene, it is used as a candidate gene for peppermint variety improvement to improve drought tolerance of peppermint, which provides a technical approach for reference for peppermint variety improvement. BRIEF DESCRIPTION OF DRAWINGS
[0015] Figure 1 For peppermint McMYC2 gene cloning, the position indicated by the red arrow is the target gene band.
[0016] Figure 2 For the structure diagram of McMYC2 gene and McMYC2 protein.
[0017] Figure 3 For the expression pattern of McMYC2 gene in leaves (A) and roots (B) under the treatment of 100 μmol / L ABA.
[0018] Figure 4 For the expression pattern of McMYC2 gene in leaves (A) and roots (B) under the treatment of 150 μmol / L NaCl.
[0019] Figure 5 For the expression pattern of McMYC2 gene in leaves (A) and roots (B) under the treatment of 100 μmol / L AlCl3.
[0020] Figure 6 For the expression pattern of McMYC2 gene in leaves (A) and roots (B) under the treatment of 100 μmol / L CdCl2.
[0021] Figure 7 For the expression pattern of McMYC2 gene in leaves (A) and roots (B) under the treatment of 100 μmol / L CuCl2.
[0022] Figure 8 For the expression pattern of McMYC2 gene in leaves (A) and roots (B) under the treatment of drought.
[0023] Figure 9 For the phenotype of WT and transgenic peppermint after 3h treatment of 20% PEG. Yellow and red arrows respectively indicate the stems of WT and transgenic peppermint under 20% PEG treatment.
[0024] Figure 10 For the determination of SOD and POD activities of WT and transgenic peppermint under 20% PEG treatment. Figure 10 A in the figure is the change of SOD activity under 20% PEG treatment; Figure 10 B in the figure is the change of POD activity under 20% PEG treatment.
[0025] Figure 11 For the relative water loss rate of leaves of WT and transgenic peppermint.
[0026] Figure 12 Expression of McWRKY57 in mint leaves with transient overexpression of McMYC2. DETAILED DESCRIPTION
[0027] The application will be described in connection with the embodiments hereinbelow. It will be obvious to a person skilled in the art that the application is not limited to those embodiments described but can be carried out in other ways than those preferred embodiments without departing from the scope of the present application. The embodiments described in the application serve merely as examples which do not limit the scope of the application.
[0028] The mint (M.canadensis L.) used in the experiment was planted in an artificial climate greenhouse, and the growth conditions were 16h light / 8h darkness. The tobacco used in the experiment was Nicotiana benthamiana, which was planted in a constant temperature and light incubator and grown for 4-5 weeks under normal conditions for standby.
[0029] Example 1
[0030] This example provides screening of the mint McMYC2 gene.
[0031] Studies have shown that the core bHLH transcription factor MYC2 in the jasmonic acid (JAs) signaling pathway plays an important role in regulating plant resistance to biological and abiotic stress and regulating secondary metabolism. Therefore, the bHLH genes of the mint were screened in the present application. Using the GO annotation of the previous mint MeJA treatment transcriptome data and the Blast comparison of the local homologous proteins of the Arabidopsis bHLH family members, 123 bHLH transcription factors Unigen were screened. The RPKM values of these bHLH transcription factors under normal conditions (CK) and MeJA treatment were obtained using the transcriptome data, and the Log2 (MeJA / CK) values of RPKM were taken. The results showed that 61 bHLH genes were up-regulated under MeJA induction, and 62 were down-regulated.
[0032] Subsequently, 4 MYCs genes were identified from the up-regulated bHLH transcription factors, which were significantly up-regulated by jasmonic acid, and the up-regulation of Unigene0042863 was the most significant. According to the express sequence tag (EST) sequence obtained by transcriptome sequencing, the partial cDNA sequences of the above 4 MYCs genes were spliced, and further NR (non-redundant protein) database annotation and sequence analysis showed that Unigene0042863 was homologous to MYC2, a MYCs gene related to the regulation of abiotic stress and secondary metabolism in plants, so it was named as McMYC2 gene.
[0033] Example 2
[0034] This example provides cloning of the McMYC2 gene of Mentha haplocalyx.
[0035] 1. Total RNA extraction and first strand cDNA synthesis of Mentha haplocalyx
[0036] The normal cultured 2-week-old Mentha haplocalyx young leaves were collected, frozen in liquid nitrogen and ground into powder. The total RNA of the leaves was extracted according to the steps described in the RNAprepPure polysaccharide and polyphenol plant total RNA extraction kit (DP441) of Tiangen. The obtained RNA was subjected to 1% agarose gel electrophoresis to judge the integrity of the RNA, and the concentration and purity of the RNA were determined by Nanodrop 2000 spectrophotometer. The first strand of cDNA was synthesized using HiScript II 1st Strand cDNA Synthesis Kit (+gDNAwiper) (R212, vazyme) kit according to the instructions. The reaction system and RT-PCR reaction program are shown in Table 1.
[0037] Table 1. Reverse transcription reaction system and RT-PCR reaction program
[0038] Component Amount 4 x gDNA wiper Mix 4 μL Oligo(dT)23 VN (50 μM) 1 μL Random hexamers (50 ng / μl) 1 μL Total RNA 1 μg RNase free dH2O To 16 μL 42 °C, 2 min / 10 x RT Mix 2 μL HiScript II Enzyme Mix 2 μL 50 °C, 15 min; 85 °C, 15 s /
[0039] 2. Amplification and DNA purification of McMYC2 gene
[0040] According to the McMYC2 gene sequence obtained above, the full-length amplification primers of McMYC2 gene were designed by using DNAMAN software: McMYC2-F: 5'-ATGATTGATTACCGTCTGCCG-3' (SEQ ID NO: 3); McMYC2-R: 5'-CTAGTTTATTTCAGCAGCAAGTC-3' (SEQ ID NO: 4).
[0041] The cDNA or DNA of the mint leaf was used as a template to amplify the McMYC2 gene. The PCR amplification system is shown in Table 2, and the amplification procedure is shown in Table 3. The PCR product was identified and separated by 1% agarose gel electrophoresis. The PCR product of the McMYC2 gene was recovered using the Biomed DNA gel recovery kit (DH103-01) according to the instructions. The concentration of the PCR product was determined using a Nanodrop 2000 spectrophotometer, and it was ready for use.
[0042] Table 2. PCR amplification system of McMYC2 gene
[0043]
[0044]
[0045] Table 3. PCR amplification procedure of McMYC2 gene
[0046]
[0047] After sequencing and comparison of the PCR product, the correct CDS sequence was obtained. Sequence analysis showed that the full-length of the McMYC2 gene was 1854 bp (nucleotide sequence is shown as SEQ ID NO: 2), encoding 617 amino acids (amino acid sequence is shown as SEQ ID NO: 1), with a theoretical molecular weight of 67.728 KDa and a theoretical isoelectric point of 5.64. The DNA sequence of the McMYC2 gene was further cloned by PCR (indicated by the arrow). Figure 1 After sequencing, structural analysis showed that the McMYC2 gene had no intron structure (indicated by the arrow). Figure 2 This is similar to the structure of the MYC2 genes of Arabidopsis, Artemisia annua, and Hevea brasiliensis.
[0048] 3. Connection of McMYC2 gene with vector, transformation, and identification of recombinant bacteria
[0049] According to the steps described in the pClone007 Blunt Vector Kit (TSV-007B) gene cloning kit of Beijing Qianke Biotechnology Co., Ltd., the PCR product of the McMYC2 gene was connected to the intermediate vector pClone007 Blunt Vector. The reaction system is shown in Table 4.
[0050] Table 4. Cloning reaction system of McMYC2 gene
[0051] Component Amount Fragment of interest 1-8 μL pClone007 Blunt Vector 1 μL 10 x Topo 1 μL ddH2O up to 10 μL
[0052] Put the above reaction system in the metal bath at 25°C for 15 min. After the reaction is completed, the reaction solution is transformed into E. coli DH5a competent cells. The steps are as follows: take 50 μL of melted E. coli DH5a competent cells on ice, add 10 μL of reaction product, mix gently, and stand on ice for 30 min; heat shock at 42°C for 45-60 s, quickly transfer to ice bath, and stand for 2 min; add 200 μL of LB culture solution without resistance to the centrifuge tube, mix well, and then place in a 37°C shaking bed for 1 h of recovery at 200 rpm; take 200 μL of the recovered solution and evenly spread on an LB medium plate containing Amp resistance, and place the plate in a 37°C incubator for overnight culture. Pick a single colony and place it in an LB liquid culture medium containing 50 mg / mL Amp for overnight culture. Use bacterial liquid PCR to identify the recombinants, sequence the positive bacterial liquid containing the target fragment (Beijing Qikelong Biotechnology Co., Ltd.), and confirm that the McMYC2 gene sequence transformation is successful. Mix the positive bacterial liquid with 50% glycerol at a volume ratio of 1:1, and store at -20°C for later use.
[0053] Example 3
[0054] This example provides an analysis of the expression characteristics of the McMYC2 gene under abscisic acid (ABA) and abiotic stress.
[0055] Select mint plants with consistent growth, quickly absorb the root moisture with blotting paper, and place them in 100 μmol / L ABA, 150 μmol / L NaCl, 100 μmol / L AlCl3, 100 μmol / L CdCl2, and 100 μmol / L CuCl2 aqueous solutions for hydroponic treatment, and on dry blotting paper for drought treatment, with 3 biological replicates in each group. At 0, 1, 3, 6, 12, and 24 h after treatment, take samples of leaves and roots, freeze them in liquid nitrogen, and store them at -80°C for later use. Refer to Example 2 for total RNA extraction and reverse transcription methods.
[0056] Design qRT-PCR primers (Table 5) according to the McMYC2 gene sequence to perform McMYC2 gene expression analysis, with β-actin as the internal reference gene. Use a BIO-RAD qPCR instrument to perform fluorescence quantitative testing. The qRT-PCR reaction system is shown in Table 6, and the qRT-PCR program is shown in Table 7, with 3 replicates for each sample. Calculate the relative mRNA expression of McMYC2 gene using the 2 -ΔΔCT method, and use IBM SPSS Statistics 26 software for significance analysis.
[0057] Table 5. qRT-PCR specific primer design
[0058] Name Primer sequence (5'-3') qMcMYC2-F TGAAGCATCTGTTGTAGTGAAGC (SEQ ID NO: 5) qMcMYC2-R CAATGATCTTCGACTCCGGT (SEQ ID NO: 6) β-actin-F CCAGGAATTGCTGATAGGATGAG (SEQ ID NO: 7) β-actin-R GCGCCACCACCTTAATCTTC (SEQ ID NO: 8) qRTWRKY57-F CCATCCTAGGCTCCCTCATC (SEQ ID NO: 9) qRTWRKY57-R ATTTCGCATTCTGGGAGGCA (SEQ ID NO: 10)
[0059] Table 6. qRT-PCR reaction system
[0060]
[0061]
[0062] Table 7. qRT-PCR procedure
[0063]
[0064] Figure 3 Expression pattern of McMYC2 gene in leaves (A) and roots (B) under 100 μmol / L ABA treatment. Figure 3 It is shown that the expression of McMYC2 in leaves is continuously down-regulated under ABA treatment, reaching the lowest value at 3 h and remaining until 24 h; in roots, McMYC2 presents an expression pattern of first up-regulation and then down-regulation, reaching the peak at 1 h after ABA treatment, rapidly decreasing to the expression level lower than that at 0 h after 3 h, and reaching the lowest expression at 24 h.
[0065] Figure 4 Expression pattern of McMYC2 gene in leaves (A) and roots (B) under 150 μmol / L NaCl treatment. Figure 4 It is shown that under NaCl treatment, the expression of McMYC2 in leaves presents an expression pattern of first up-regulation and then down-regulation, rapidly up-regulating and reaching the maximum value at 1 h, and the expression amounts at 6 h and 24 h are consistent with that at 0 h; in roots, its expression is continuously up-regulated, reaching the maximum expression amount at 6 h, decreasing to the expression amount consistent with that at 0 h at 12 h, and then up-regulating again.
[0066] Figure 5 Expression pattern of McMYC2 gene in leaves (A) and roots (B) under 100 μmol / L AlCl3 treatment. Figure 6 Expression pattern of McMYC2 gene in leaves (A) and roots (B) under 100 μmol / L CdCl2 treatment. Under AlCl3 and CdCl2 treatments, the expression patterns of McMYC2 in leaves are similar, both rapidly down-regulating within 1 h after treatment and continuously down-regulating until 24 h; in roots, both also present similar expression patterns, rapidly down-regulating the expression amount within 1 h after treatment, and the expression levels at 24 h are consistent with that at 1 h.
[0067] Figure 7Expression patterns of McMYC2 gene in leaves (A) and roots (B) under 100 μmol / L CuCl2 treatment. In CuCl2 treatment, the expression of McMYC2 in leaves showed similar expression patterns as AlCl3 and CdCl2 treatments; the expression in roots showed an expression pattern of first rising and then falling, reaching the maximum at 1 h, and the expression at the rest of time points was lower than that at 0 h, and the expression at 6 h was the lowest.
[0068] Figure 8 Expression patterns of McMYC2 gene in leaves (A) and roots (B) under drought treatment. Under drought conditions, the expression of McMYC2 in leaves was rapidly up-regulated at 1 h and reached the maximum, and then rapidly down-regulated to the minimum and remained until 24 h; in roots, the expression of McMYC2 gene was rapidly up-regulated in response to drought, reached the maximum at 1 h, and then decreased, and the expression at 24 h was still significantly higher than that at 0 h.
[0069] The above results show that McMYC2 may play an important regulatory role in the response of Mentha haplocalyx to various abiotic stresses such as exogenous ABA, NaCl, AlCl3, CdCl2, CuCl2 and drought, and the functions of McMYC2 in leaves and roots are different.
[0070] Example 4
[0071] This example provides the changes in phenotypes and physiological indicators of wild-type and transgenic Mentha haplocalyx under the condition of drought stress treatment simulated by 20% PEG solution.
[0072] The homologous recombination primers for linking McMYC2 gene to overexpression vector pCAMBIA1300-GFP were designed as follows:
[0073] pCAMBIA1300-GFP-McMYC2-F: 5'-GGGGCCCGGGGTCGACATGATTGATTACCGTCTGCCG-3' (SEQ ID NO: 11); pCAMBIA1300-GFP-McMYC2-R: 5'-TACCGGATCCACTAGTGTTTATTTCAGCAGCAAGTG-3' (SEQ ID NO: 12).
[0074] According to the method for constructing a transgenic vector by Ma et al., the McMYC2 overexpression vector was constructed, and EHA105 was transformed with the McMYC2 overexpression vector by freeze-thaw method. Through Agrobacterium infection, resistant bud differentiation screening and RT-PCR detection, several Mentha haplocalyx stably overexpressing McMYC2 were obtained, and 2 strains of McMYC2OE-7 and McMYC2OE-14 were selected for simulated drought stress test, as follows.
[0075] The wild type and transgenic peppermint McMYC2OE-7, McMYC2OE-14 were all cut 6 cm above ground, and were placed in 20% PEG solution (simulated drought) and distilled water respectively, and their growth conditions were observed after 3 h.
[0076] In addition, sampling was carried out at 0 h, 1 h, 3 h, and 6 h after treatment, with 3 repeats in each group of samples, and a total of 3 repeats, to analyze the stress-related physiological indicators of wild type and transgenic peppermint under simulated drought treatment, including POD, SOD, and water loss rate.
[0077] The growth conditions of wild type and transgenic peppermint after 3 h of 20% PEG treatment are shown in Figure 9 Compared with the control (CK, distilled water treatment), after 3 h of 20% PEG simulated drought treatment, the wild type peppermint showed obvious stem lodging phenomenon (yellow arrow), while the McMYC2OE-7 and McMYC2OE-14 transgenic peppermint grew well and did not show stem lodging phenomenon (red arrow). The McMYC2OE-7 and McMYC2OE-14 transgenic peppermint showed a more drought-tolerant phenotype than the wild type peppermint, indicating that overexpression of McMYC2 enhanced the drought resistance of transgenic peppermint.
[0078] The determination of SOD and POD activity of WT and transgenic peppermint is shown in Figure 10 The results showed that before drought treatment (0 h), the SOD activity in McMYC2OE-7 and McMYC2OE-14 transgenic peppermint was lower than that in WT, and the SOD activity in WT and transgenic peppermint increased with the increase of drought treatment time. Among them, the SOD activity in McMYC2OE-7 transgenic peppermint was higher than that in WT at 1 h, 3 h, and 6 h, and the SOD activity in McMYC2OE-14 transgenic peppermint was higher than that in WT at 3 h and 6 h (A in Figure 10 At the same time, it was found that before drought treatment (0 h), the POD activity in transgenic peppermint was lower than that in WT, and the POD activity in WT showed a downward trend with the increase of drought treatment time, while the POD activity in McMYC2OE-7 and McMYC2OE-14 transgenic peppermint was significantly higher than that in WT at 6 h (B in Figure 10
[0079] The water loss rate results are shown in Figure 11 As shown, the results show that the relative water loss rate of McMYC2 OE-7, McMYC2 OE-14 transgenic peppermint leaves is lower than that of WT at 0.5h, 1h, 2h, 3h, 6h, 12h of treatment, indicating that overexpression of McMYC2 in peppermint can improve the SOD, POD enzyme activity of peppermint under drought conditions, reduce the water loss rate and enhance the drought resistance of transgenic peppermint.
[0080] Example 5
[0081] This example provides the expression of McWRKY57 in peppermint leaves with transient overexpression of McMYC2.
[0082] The pCAMBIA2300-GFP (VC) vector was double digested with BamHI and SalI, and the enzyme digestion system is shown in Table 8. At the same time, according to the McMYC2 gene sequence obtained above, the homologous recombination primers for connecting the pCAMBIA2300-GFP vector were designed using the DNAMAN software:
[0083] p2300GFP-McMYC2-F: 5'-CGGTACCCGGGGATCCATGATTGATTACCGT CTGCCG-3' (SEQ ID NO: 13); p2300GFP-McMYC2-R: 5'-TGCTCACCATGT CGACGTTTATTTCAGCAGCAAGTG-3' (SEQ ID NO: 14).
[0084] According to the method described in Example 2, the McMYC2 gene was amplified with the correctly sequenced McMYC2 intermediate vector pClone007 Blunt Vector as the template. The PCR product of the McMYC2 gene and the enzyme digestion product of the VC vector were separated by agarose gel electrophoresis, and the gel was recovered for use. According to the instructions of the One Step Cloning Kit (C112, vazyme), the homologous recombination reaction was carried out, and the reaction system is shown in Table 9, to obtain the fusion expression vector pCAMBIA2300-McMYC2-GFP, and the sequence correctness was confirmed. IIOne Step Cloning Kit (C112, vazyme) instructions, homologous recombination reaction, reaction system see Table 9, get fusion expression vector pCAMBIA2300-McMYC2-GFP, and confirm the sequence correctness.
[0085] Table 8. Double enzyme digestion system
[0086] Component Amount 10 x Cutone TM buffer 5 μL FastAP 1 5 μL FastAP 2 5 μL Plasmid 5 μg ddH2O up to 50 μL
[0087] Table 9. Homologous recombination reaction system
[0088] Component Amount Exnase II 1 μL 5 x CEII Buffer 2 μL PCR products 5-100 ng vector 25-100 ng RNase free dH2O up to 10 μL
[0089] The fusion expression vector pCAMBIA2300-McMYC2-GFP (test) and the empty vector pCAMBIA2300-GFP (control) were respectively transformed into EHA105 Agrobacterium by freeze-thaw method, and the EHA105 Agrobacterium containing the two vectors were respectively injected into the lower epidermis of the opposite leaves in the middle of the mint seedlings (about 6 cm in height), and the leaves were collected after 3 days of culture at 23°C, and the RNA was extracted and reverse transcribed into cDNA. The expression changes of McMYC2 gene and McWRKY57 gene in the leaves of the control group and the test group were analyzed by qRT-PCR (primers see Table 5).
[0090] The expression of McMYC2 gene and McWRKY57 gene in the leaves of the mint is shown in Table 6. Figure 12 The results show that the expression of McMYC2 in the leaves of the test group is significantly up-regulated compared with the control group, and it can be seen that the transient overexpression of McMYC2 gene is successful. In addition, Figure 12 It can be seen that the expression level of McWRKY57 gene is significantly improved compared with the control group, indicating that overexpression of McMYC2 gene can significantly improve the expression level of drought response gene McWRKY57 in the leaves of the mint, and help to enhance the drought resistance of the mint.
[0091] The above-described embodiments are only some of the embodiments of the present application, not all the embodiments. The detailed description of the embodiments of the present application is not intended to limit the scope of the claimed application, but only represents selected embodiments of the present application. All other embodiments obtained by relevant deduction and replacement made by those skilled in the art under the condition of the concept of the present application, without making creative efforts, belong to the scope of protection of the present application.
Claims
1. Use of a Mentha transcription factor for upregulating drought resistance in Mentha, characterized in that, The transcription factor is McMYC2, the amino acid sequence of which is shown as SEQ ID NO: 1; the drought resistance of the peppermint plant is enhanced by overexpressing the peppermint transcription factor McMYC2.
2. A genetic recombination vector, characterized by, The gene recombination carrier contains a coding gene of the peppermint transcription factor McMYC2, the nucleotide sequence of which is shown as SEQ ID NO:
2.
3. A recombinant genetically engineered bacteria, characterized in that, The recombination genetically engineered bacteria contain the gene recombination carrier of claim 2.
4. A method of breeding a drought resistant variety of Mentha spicata, characterized in that, An overexpression recombination carrier containing a coding gene of the peppermint transcription factor McMYC2 is constructed and is transferred into a peppermint plant for overexpression; The nucleotide sequence of the coding gene of the peppermint transcription factor McMYC2 is shown as SEQ ID NO: 2.
Citation Information
Patent Citations
MYC (myelocytomatosis proteins) transcription factors derived from gossypium hirsutum L., coding genes thereof and applications of MYC transcription factors and coding genes to regulation of stress resistance of plant
CN104178497A
LaMYC7 protein, coding gene thereof and application of LaMYC7 protein in regulation and control of synthesis of plant terpenoids
CN115785240A