Use of ghugt73c3 gene or the encoded protein in improving seed oil content and seed size of plants

By overexpressing the GhUGT73C3 gene in plants, the problems of insufficient oil content and seed size in cottonseed were solved, resulting in a significant increase in seed oil content and seed size, thus meeting health and energy requirements.

CN120099081BActive Publication Date: 2026-01-02INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510274412.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-10
Publication Date
2026-01-02
Estimated Expiration
2045-03-10

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively increase the oil content and seed size of cottonseed, resulting in a shortage of cottonseed oil supply that cannot meet people's demand for healthy oils and bioenergy.

Method used

By overexpressing the GhUGT73C3 gene in plants, the oil content and seed size of plant seeds can be regulated by the gene or its encoded protein. The GhUGT73C3 gene was heterologously expressed in Arabidopsis thaliana using recombinant vectors and transgenic technology. The oil content and fatty acid composition of the seeds were determined, and the seed size was determined by gas chromatography and particle size analysis.

Benefits of technology

It significantly increases the oil content and seed size of plant seeds, enhances the nutritional value of cottonseed oil and the production potential of biodiesel, and meets health and energy needs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099081B_ABST
    Figure CN120099081B_ABST
Patent Text Reader

Abstract

The application discloses application of a GhUGT73C3 gene or a protein coded by the gene in improving seed oil yield and seed size, and belongs to the technical field of genetic engineering. The application determines the oil content and fatty acid components of the seeds of the transgenic line by means of gas chromatography (GC), and determines the grain length, grain width and thousand seed weight of the seeds of the transgenic line, so as to determine the application of the GhUGT73C3 gene in improving cotton seed oil yield and seed size, and also determine the application of the protein UGT expressed by the GhUGT73C3 gene in improving cotton seed oil yield and seed size, which will have wide application space and market prospect in the agricultural field.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the field of genetic engineering, in particular to application of a GhUGT73C3 gene or a protein coded by the same in improving seed oil yield and seed size of plants. BACKGROUND

[0002] The global supply of vegetable oil is far lower than the demand, and the vegetable oil demand in 2023 / 24 will increase by about 5.6 million tons, while the supply will increase by about 2.6 million tons, with a gap of 3 million tons, which cannot meet the needs of people's healthy life. Cotton is one of the important fiber and oil crops in the world, and plays an important role in ensuring clothing and food. Cottonseed is the main by-product of cotton, accounting for about 60% of the total cotton output. The oil content of cotton kernel after shelling is 27.19-39.89%, which is the fourth largest source of edible oil in the world.

[0003] With the development of China's economy and the improvement of people's living standards, people have paid more and more attention to nutrition and health. Compared with other vegetable oils, cottonseed oil contains a large amount of essential fatty acids for the human body, has a high nutritional value, and the content of unsaturated fatty acids such as oleic acid and linoleic acid is close to 80%, which makes cottonseed oil have strong antioxidant capacity. Among them, oleic acid can reduce cholesterol in the blood, prevent cholesterol from depositing on the blood vessel wall, and is beneficial to the cardiovascular system; linoleic acid can be used to treat high blood lipids and arteriosclerosis, etc. In addition, cottonseed oil contains a high content of vitamin E, which has the ability to improve the body's resistance to cell aging, reduce the incidence of cardiovascular diseases, etc.

[0004] Cottonseed oil also has broad application prospects as a bioenergy fuel. 99% of the fatty acid carbon chains in cottonseed oil are concentrated between C16 and C18, which is extremely similar to diesel components, and the conversion efficiency of cottonseed oil into biodiesel is as high as 95%. Moreover, cottonseed oil is rich in oxygen and does not contain sulfur, and the converted biodiesel burns more fully, is environmentally friendly, and does not pollute the environment. In recent years, the cotton planting area in China has decreased from 50.0894 million mu in 2019 to 42.5745 million mu in 2024. Therefore, using genetic engineering methods to increase the oil content of cottonseed is the only way to maintain the total output of cottonseed oil and even to improve the utilization efficiency of cotton by-products.

[0005] UGT (UDP-glucosyltransferase) gene belongs to the uridine diphosphate (UDP)- glycosyltransferase gene family, which catalyzes the glycosylation of substrate molecules using UDP glucose as a sugar donor, and belongs to the UDP-dependent glycosyltransferase. UGTs usually catalyze the glycosylation modification of small molecule compounds such as flavonoids, alkaloids and plant hormones through the formation of glycosidic bonds (Liet al. 2018). The UGT gene family has many members, mainly involved in plant secondary metabolic pathways, plant detoxification reactions and plant responses to biotic and abiotic stresses. In rice, Dong et al. found that UGT83A1 gene is involved in the regulation of cell proliferation and expansion of spikelet development, indirectly affecting the expression of auxin level and auxin-related genes, and regulating grain size development (Dong et al. 2020); Wu et al. found a major QTL, qEDR5.1, which encodes a UDP glycosyltransferase gene, regulating the difference in endosperm development between upland rice and rice (Wu et al. 2022). Cao et al. found that UGT71C4 gene remodels the morphological development of cotton seeds by affecting the shift of metabolic flow in the phenylpropanoid metabolic pathway (Cao et al. 2024). In cotton, the research on the function of UGT family genes is relatively less, and there is no related research on the regulation of UGT gene on cottonseed oil content and seed size. SUMMARY

[0006] The purpose of the present application is to provide the application of GhUGT73C3 gene or the protein coded by it in improving the oil yield and seed size of plants, so as to solve the problems existing in the prior art.

[0007] To achieve the above purpose, the present application provides the following scheme:

[0008] One of the technical schemes of the present application is the application of GhUGT73C3 gene or the protein coded by it in improving the oil yield of plants.

[0009] The second technical scheme of the present application is a method for improving the oil yield of plants, overexpressing GhUGT73C3 gene to improve the oil content of plant seeds.

[0010] The third technical scheme of the present application is the application of recombinant vector, expression cassette, transgenic cell line or recombinant bacteria containing GhUGT73C3 gene in improving the oil yield of plants.

[0011] The fourth technical scheme of the present application is the application of GhUGT73C3 gene or the protein coded by it in regulating the size of plant seeds.

[0012] The fifth technical scheme of the present application is a method for regulating the size of plant seeds, overexpressing GhUGT73C3 gene to improve the kernel length, kernel width and thousand kernel weight of plant seeds.

[0013] Sixth, the application of the recombinant vector, expression cassette, transgenic cell line or recombinant bacteria containing the GhUGT73C3 gene in regulating the size of plant seeds.

[0014] Based on the above technical solutions, the present application has the following technical effects:

[0015] The present application determines the oil content and fatty acid components of the transgenic strain seeds by Gas Chromatography (GC) after heterologous expression of the GhUGT73C3 gene in Arabidopsis thaliana, and determines the seed length, width and thousand seed weight of the transgenic strain seeds, thereby clarifying the application of the GhUGT73C3 gene in improving the cotton seed oil yield and seed size, and clarifying the application of the protein UGT expressed by the GhUGT73C3 gene in improving the cotton seed oil yield and seed size, which will have a wide application space and market prospect in the field of agriculture. BRIEF DESCRIPTION OF DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced as follows. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0017] Figure 1 Cloning of the GhUGT73C3 gene.

[0018] Figure 2 GhUGT73C3 connected pEarleyGate 101 vector bacterial liquid identification.

[0019] Figure 3 GhUGT73C3 gene coding protein subcellular localization schematic diagram.

[0020] Figure 4 Basta screening of GhUGT73C3 transgenic Arabidopsis thaliana positive seedlings.

[0021] Figure 5 PCR identification of GhUGT73C3 transgenic Arabidopsis thaliana positive seedlings.

[0022] Figure 6 qRT-PCR results of GhUGT73C3 transgenic Arabidopsis thaliana positive seedlings.

[0023] Figure 7 Western Blot identification of GhUGT73C3 transgenic Arabidopsis thaliana positive seedlings.

[0024] Figure 8 Seed oil content (a) and fatty acid component content (b) of Arabidopsis thaliana transformed with GhUGT73C3 gene.

[0025] Figure 9 Seed size (a) and grain length (b), grain width (c), and thousand seed weight (d) of Arabidopsis thaliana transformed with GhUGT73C3 gene. DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present application will now be described in detail, which should be considered to be illustrative of certain aspects, features and embodiments of the present application, but not a limitation of the present application.

[0027] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, where particular ranges of values are given, understand that each intervening value, to the upper or lower limit of the ranges is also specifically included. Each smaller range that falls within the broader ranges is also specifically included in the present application. The upper and lower limits of these smaller ranges can independently be included or excluded in the range, and are also encompassed by the application, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of the limits are also included.

[0028] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All patents, patent applications, publications, and descriptions mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the patents, patent applications, publications, and descriptions are cited.

[0029] Many modifications and variations of this application can be made without departing from its spirit or scope, which will be apparent to those skilled in the art. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only. It is to be understood that the application is not limited in scope by the specific embodiments described herein. Rather, the intent is to embrace all changes and modifications that can come within the spirit and scope of the application.

[0030] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed materials and methods.

[0031] The technical solutions described in the present application are all conventional solutions in the art, and the reagents or raw materials used are purchased from commercial channels or are disclosed, unless otherwise specified.

[0032] The present application provides the application of GhUGT73C3 gene or the protein coded by the gene in improving the oil yield of plant seeds.

[0033] In some specific embodiments, the nucleotide sequence of the GhUGT73C3 gene is shown as SEQ ID NO. 1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 2.

[0034] In some specific embodiments, overexpression of the GhUGT73C3 gene increases the oil content of the plant seeds.

[0035] The embodiments of the present application also provide a method for increasing the oil yield of plant seeds, overexpression of the GhUGT73C3 gene increases the oil content of the plant seeds.

[0036] The embodiments of the present application also provide the use of a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the GhUGT73C3 gene in increasing the oil yield of plant seeds.

[0037] The embodiments of the present application also provide the use of the GhUGT73C3 gene or the encoded protein in regulating the size of plant seeds.

[0038] In some specific embodiments, the nucleotide sequence of the GhUGT73C3 gene is shown as SEQ ID NO. 1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 2.

[0039] In some specific embodiments, overexpression of the GhUGT73C3 gene increases the kernel length, kernel width and thousand kernel weight of the plant seeds.

[0040] The embodiments of the present application also provide a method for regulating the size of plant seeds, overexpression of the GhUGT73C3 gene increases the kernel length, kernel width and thousand kernel weight of the plant seeds.

[0041] The embodiments of the present application also provide the use of a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the GhUGT73C3 gene in regulating the size of plant seeds.

[0042] The present application determines the application of the GhUGT73C3 gene and the expression protein UGT in increasing the oil yield of plant seeds by heterologous expression of the GhUGT73C3 gene in Arabidopsis thaliana, determination of the oil content and fatty acid component content of the seeds of the transgenic lines by Gas Chromatography (GC), and determination of the kernel length, kernel width and thousand kernel weight of the seeds of the transgenic lines, and determines the application of the GhUGT73C3 gene and the expression protein UGT in increasing the size of plant seeds.

[0043] Example 1

[0044] Cloning of the GhUGT73C3 gene in cotton

[0045] 1.1 Required tool enzymes, reagents, kits, drugs

[0046] (1) Enzymes and reagents: 2x Max Master Mix (P515) high-fidelity enzyme, 2x Taq Plus Master Mix II (Dye Plus), Invitrogen TM Gateway TM BP Clonase TM II Enzyme mix, Invitrogen TM Gateway TM LR Clonase TM II Enzyme mix, FastPure Plant Total RNA Extraction Kit (for samples rich in polysaccharides and polyphenols) purchased from Nanjing Nuowezhan Biotechnology Co., Ltd., HiScript III RT SuperMix Reverse Transcription Kit, Green Realtime PCR qRT-PCR fluorescence quantitative enzyme purchased from TOYOBO Biological Company, Plasmid MiniPrep Kit plasmid extraction reagent kit purchased from Beijing Quansijing Company, QuickGel Extraction Kit gel recovery reagent kit purchased from Beijing Quansijing Company, E. coli competent DH5a purchased from Kangwei Century, Agrobacterium competent GV3101 purchased from Weidi Biology, primers used in experiments were purchased from Zhengzhou Shangya Biological Engineering Company.

[0047] (2) Other drugs: Agarose purchased from Quansijing Biological Company, Proteose peptone, yeast extract, chloroform, isopentanol, ethanol, isopropyl alcohol, sodium chloride, etc. are domestic analytical pure, kanamycin and ampicillin, etc. are purchased from Baobiological Engineering Dalian Co., Ltd.

[0048] (3) Preparation of solutions: Various reagents mentioned in this paper but not listed are prepared according to the methods in the third edition of Molecular Cloning Laboratory Guide, and biochemical reagents are analytical pure or above.

[0049] (4) LB liquid medium: Tryptone 10 g / L, yeast extract 5 g / L, sodium chloride (NaCl) 10 g / L;

[0050] LB solid medium: Tryptone 10 g / L, yeast extract 5 g / L, sodium chloride (NaCl) 10 g / L, agar powder 15 g / L, constant volume to 1 L;

[0051] LB selection medium: before the LB plate, when the medium is cooled to 55°C after high pressure sterilization, add the corresponding concentration of antibiotics, shake evenly and then plate.

[0052] (5) Main instruments: PCR amplifier (BIO-RAD), high-speed centrifuge (Hettich MIKRO 200R), electrophoresis equipment (BIO-RAD), gel imaging system (BIO-RAD), fluorescent quantitative PCR instrument (ABI7500), vacuum freeze dryer (Alpha I-5; Martin Christ), gas chromatograph (Nexis GC-2030, Shimadzu Corporation, Kyoto, Japan), full-automatic sample grinder (JXFSTRBP-64, Shanghai Jingxin). Alpha I-5; Martin Christ), gas chromatograph (Nexis GC-2030, Shimadzu Corporation, Kyoto, Japan), full-automatic sample grinder (JXFSTRBP-64, Shanghai Jingxin).

[0053] 1.2 Cloning of GhUGT73C3 gene

[0054] The reference sequence of GhUGT73C3 is from the genome of TM-1 (Cotton Research Institute, Chinese Academy of Agricultural Sciences), and the gene number is Gh_D11G379500. The primer is designed by using Oligo 6 software, and the complete CDS sequence of 1473 bp is amplified from the cotton material Zhongmian No. 3 by using PCR (Polymerase Chain Reaction) technology, which encodes 490 amino acid residues. The gene CDS sequence is shown as SEQ ID NO. 1, and the amino acid sequence is shown as SEQ ID NO. 2.

[0055] The CDS sequence of GhUGT73C3 gene is (SEQ ID NO. 1):

[0056]

[0057] The amino acid sequence of the GhUGT73C3 protein is (SEQ ID NO. 2):

[0058] MGEELHFLLIPLMSPGHLLPMVDMAHLLATHGVTVSIITTPLNALRFTSVVDSAVASGLRIQVHHLPFPAKEFGLPENCENMDQLPSRDLIMNFLMAANELQQRFEELFNKLKPKPSCMVSGKNLPWTVKTATKFNVPRIVFDGMGCFSFVCTHKLELSKVHEMVSEFESFKIPGLLHEIELKKAQLPENLNPVSNDLINIRDIRKAELVCDGIVVNTFEELENEYVKEFKSIKGNGKVWCIGPVSAINKLSSDKAERGQKQCRFETLQPWLDSKEPGSVIYACLGSISGLTKWQLIELGLGLESSGKPFIWVIRENPKSNEIEKWILDEKFEDRVKDRGIIIHGWSPQLWVLSHPAIGAFLTHCGWNSTMEAVSAGVPVITCPLFAEQFINEKLVVDVLGIGVSAGVESAVTWGLEDKFGLLMKRERVKNAINEVMEKSEAGEERRRKAKQIGETANKAIEKGGSSYQEMEMLIQFVLQRTKEVAQTSS*.

[0059] 1.3 Process of cloning specific genes

[0060] (1) The test material, Gossypium hirsutum L. cv. Zhongmian No. 3, was planted in the test field of the Cotton Research Institute of Chinese Academy of Agricultural Sciences and managed according to general field management. The parts taken included roots, stems, leaves, flowers, buds, hypocotyls, ovules at different development stages, and fibers. The taken materials were quickly frozen in liquid nitrogen and stored in a -80°C refrigerator for use. The plant DNA was extracted using a modified CTAB method, and the total RNA was extracted using a Trizol kit.

[0061] (2) 1 μg of RNA was reverse transcribed into cDNA, and the cDNA solution was diluted 10 times as a PCR reaction template.

[0062] The total RNA of cotton ovules at each stage was extracted and reverse transcribed into cDNA using a reverse transcription kit of Trizol, and the specific steps were as follows:

[0063] ①Genomic DNA removal system: RNA template 1 μg, 4×gDNA wiper Mix 4 μL, RNase-free ddH2O to 16 μL.

[0064] After the above system is prepared, use a pipette to mix and beat, and then place it in a PCR instrument for 2 min at 42°C.

[0065] ②Reverse transcription reaction system: 5×HiScript III qRT SuperMix 4 μL, reaction solution of step ① 16 μL.

[0066] After the above system is prepared, use a pipette to mix and beat, and then place it in a PCR instrument for 2 min at 42°C.

[0067] (3) Perform PCR reaction to amplify the target gene

[0068] The Oligo 6 software is used to design the full-length primer of GhUGT73C3 gene, and the mixed cDNA obtained by reverse transcription is used as a template to perform PCR amplification of the cotton GhUGT73C3 gene. The 2× Phanta Max Master Mix (P515) high-fidelity enzyme of Nuoyuan Company is used for amplification.

[0069] The reaction system is: 2×Phanta Max Master Mix 25 μL, upstream primer (10 μM) 2 μL, downstream primer (10 μM) 2 μL, cDNA template 1.6 μL, and ddH2O 19.4 μL.

[0070] The PCR reaction program is: 95°C for 3 min; 95°C for 15 sec, 56°C for 15 sec, 72°C for 60 sec, repeat for 35 cycles; 72°C for 5 min; 12°C for storage.

[0071] (4) After the PCR reaction is completed, 1.2% agarose gel electrophoresis is used for PCR detection, and the band size is consistent with the expected design, which is considered to be effective, and the results are shown in Figure 1 From Figure 1 it can be seen that the band size is between 1000-2000 bp, and the size is consistent with the expectation, and can be used for subsequent experiments.

[0072] (5) The Quick Gel Extraction Kit of Beijing Quanshijin Company is used for gel recovery of the target size band.

[0073] Example 2

[0074] ​Construction of GhUGT73C3 gene expression vector

[0075] The Gateway system was used to construct the GhUGT73C3 gene expression vector, and the cloned GhUGT73C3 gene fragment was connected to the expression vector pEarleyGate 101 using BP and LR reactions. The specific steps are as follows:

[0076] 2.1 PDONR / Zeo vector connection

[0077] The BP reaction primers were designed according to the pDONR / Zeo map, and the primer sequences are as follows:

[0078] GhUGT73C3-BP-F (SEQ ID NO. 3):

[0079] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGGAGAAGAGCTTCATT TCCTTT-3';

[0080] GhUGT73C3-BP-R (SEQ ID NO. 4):

[0081] 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTAAGAACTAGTTTGAGCTACCT CTTTA-3'.

[0082] The recovered DNA fragments were connected to the pDONR / Zeo vector through the BP reaction, and the reaction system is shown in Table 1.

[0083] Table 1 BP reaction system

[0084]

[0085] The above reaction system was prepared in a 200 μL centrifuge tube and placed at 25°C for 1 h. Then the ligation product was transferred to DH5α, which was grown overnight in LB solid medium containing blasticidin, and single colonies were selected for bacterial liquid identification using M13-F and M13-R primers. Positive bacterial liquid was selected for shaking plasmid extraction.

[0086] M13F (SEQ ID NO. 5): 5'-GTTGTAAAACGACGGCCAG-3';

[0087] M13R (SEQ ID NO. 6): 5'-CAGGAAACAGCTATGAC-3'.

[0088] 2.2 pEarleyGate 101 expression vector connection

[0089] The above plasmids were ligated into the expression vector pEarleyGate 101 via LR reaction, and the reaction system is shown in Table 2.

[0090] Table 2 LR reaction system

[0091]

[0092] Prepare the above reaction system in 200 μL centrifuge tubes and incubate at 25°C for 1 h. Then, transform the ligation product into *E. coli* competent cells DH5α, select single colonies, and identify the bacterial culture using 35S-F and EYFP-R primers. Select the correct positive bacterial cultures for plasmid extraction by shaking, transform into *Agrobacterium* competent cells GV3101, select single colonies, and identify the bacterial culture using 35S-F and EYFP-R primers. Figure 2 Use 50% glycerin for sterilization before use.

[0093] 35S-F (SEQ ID NO.7): 5'-cccactatccttcgcaag-3';

[0094] EYFP-R (SEQ ID NO. 8): 5'-gaacttgtggccgtttac-3'.

[0095] 2.3 Subcellular localization of UGT protein expressed by the GhUGT73C3 gene

[0096] After culturing *N. benthamiana* in a greenhouse at 25°C for 4-5 weeks under 16 hours of light, 8 hours of darkness, and with *Agrobacterium tumefaciens* containing the pEarleyGate101-GhUGT73C3 vector and an empty control, the bacteria were shaken and resuspended in a solution of 20 mM MES, 150 nM MAS, and 10 mM MgCl2. OD 600 After adjusting the pH value to around 1.0 and placing the cells in the dark for 3 hours, Agrobacterium was injected into tobacco leaves. After approximately 36 hours of incubation, the GFP signal from the leaves was collected using an Olympus FV1200 (Olympus, Japan). The GhUGT73C3-GFP fluorescence signal was observed to appear on both the cell nucleus and cell membrane, indicating that the GhUGT73C3 protein is localized in the cell nucleus and cell membrane. Figure 3 ).

[0097] Example 3

[0098] Obtaining Arabidopsis thaliana with overexpression of the GhUGT73C3 gene

[0099] 3.1 Obtaining Arabidopsis thaliana with the GhUGT73C3 gene

[0100] a. Wild-type Arabidopsis thaliana (Col-0) was grown in an Arabidopsis thaliana greenhouse at a temperature of 22°C and a light exposure of 16 hours, and was watered appropriately the day before infection.

[0101] b. In the clean bench, take 10 μL of Agrobacterium liquid with pEarlyGate101-GhUGT73C3 target gene vector to LB solid medium containing kanamycin and rifampicin for streaking, and place the plate in an incubator at 28°C overnight.

[0102] c. In the clean bench, pick a colony with a sterile gun head and place it in 100 mL of LB liquid medium (containing kanamycin and rifampicin) in a 28°C, 180 rpm shaker for overnight culture. When the OD 600 is between 1.0-1.6, stop the culture.

[0103] d. Transfer 100 mL of the bacterial solution to a 50 mL sterile centrifuge tube, centrifuge at 5000 rpm for 10 min, discard the supernatant, and resuspend the bacterial cells with resuspension solution (Table 3) until the OD 600 is 0.8, and place it in the dark for 2 h.

[0104] Table 3 Resuspension solution formula

[0105]

[0106] e. Pour the resuspension solution into a culture dish, immerse the entire Arabidopsis inflorescence in each pot in the bacterial solution for 1 min, and shake the Arabidopsis back and forth to improve transformation efficiency. Then cover it with plastic wrap, place it in the dark for 24 h, and then place it in the Arabidopsis greenhouse for daily cultivation. Harvest the T0 generation seeds.

[0107] f. After the T0 generation seeds are mixed and harvested, sow them in culture trays (nutrient soil: vermiculite volume = 1:1), water them appropriately, cover them with plastic wrap, and place them in the Arabidopsis greenhouse. After germination, spray them with 10% Basta herbicide in the morning and evening every day. The negative seedlings will wither and die, while the positive seedlings will grow normally with a tender green color until they reach a certain size. Then transplant the positive seedlings to new nutrient pots, take the rosette leaves after bolting for DNA extraction, and then perform PCR detection to determine the positive seedlings as Figure 4 . Figure 5

[0108] 3.2 Extraction of transgenic Arabidopsis RNA and qRT-PCR verification of gene expression

[0109] (1) Use the plant total RNA rapid extraction kit to extract the total RNA of the control strain and the transgenic Arabidopsis, use the reverse transcription kit of Nuaidian Company for reverse transcription reaction, and use the fluorescent quantitative kit of Nuaidian Company for qRT-PCR verification.

[0110] (2) The qRT-PCR reaction system is shown in Table 4.

[0111] Table 4 qRT-PCR reaction system​

[0112]

[0113]

[0114] qRT-PCR reaction steps are as follows: ① pre-denaturation: qRT-PCR starts at 95℃ for 30 sec; ② cycle reaction: 95℃ (10 sec) denaturation, 60℃ (30 sec) primer annealing, 40 cycles; ③ melting curve: 95℃ (15 sec), 60℃ (60 sec), 95℃ (15 sec). The Actin gene of Arabidopsis is selected as the internal reference gene, each template is repeated for 3 technical repeats, and 2 -ΔΔCT Method for calculating the relative expression of genes.

[0115] Fluorescence quantitative primer sequence:

[0116] qRT-AtActin_F (SEQ ID NO. 9): 5'-TAACTCTCCCGCTATGTATGTC-3';

[0117] qRT-AtActin_R (SEQ ID NO. 10): 5'-GAGAAACCCTCGTAGATTGG-3';

[0118] qRT-GhUGT73C3_F (SEQ ID NO. 11): 5'-TTAAAATTCCTGGTTTACTCCATGA-3';

[0119] qRT-GhUGT73C3_R (SEQ ID NO. 12): 5'-ACTGGGCCGATACACCATACTTT AC-3'.

[0120] The results are shown in Table 1: Figure 6 The expression amount of GhUGT73C3 gene in the three transgenic positive lines is significantly higher than that of the control line (p<0.01).

[0121] Western Blot experiment was then performed on the three lines. Compared with the control, the GhUGT73C3 protein of the three overexpression lines has extremely high expression Figure 7 .

[0122] 3.3 Determination of oil content and size of transgenic Arabidopsis seeds

[0123] The oil content and fatty acid component content of the seeds of the three overexpression lines were determined, and the results are shown in Table 2: Figure 8As shown in the table, compared with the WT of Arabidopsis, the oil content of the seeds of the three transgenic lines was increased by 4.91%, 6.89% and 10.56% respectively; the content of oleic acid (C18:1) in the fatty acid composition was increased by 17.16%, 22.32% and 14.67% respectively; and the content of linoleic acid (C18:2) was increased by 1.71%, 3.54% and 5.35% respectively, all reaching a significant or extremely significant level.

[0124] Further, the size of the seeds of the three overexpression lines was compared, and the grain length, grain width and thousand seed weight were determined, and the results are shown in the table. Figure 9 As shown in the table, compared with the control, the seeds of the three transgenic lines were significantly increased, in which the grain length was increased by 15.35%, 27.95% and 22.44% respectively, all reaching an extremely significant level; the grain width was increased by 12.93%, 21.77% and 19.05% respectively, all reaching an extremely significant level; and the thousand seed weight was increased by 7.07%, 23.23% and 34.35% respectively, reaching a significant or extremely significant level.

[0125] Obviously, the above embodiments of the present application are only examples for clearly illustrating the present application, and are not intended to limit the embodiments of the present application. Based on the above description, other different forms of changes or variations can be made by those skilled in the art. It is not necessary or possible to exhaust all the embodiments. Any modification, equivalent replacement and improvement within the spirit and principle of the present application should be included in the protection scope of the claims of the present application.

Claims

1. GhUGT73C3 The use of a gene or its encoded protein in increasing the oil yield of a plant seed, characterized in that, The GhUGT73C3 The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO.

2. The plant is Arabidopsis thaliana or Gossypium hirsutum.

2. Use according to claim 1, characterized in that, Overexpression GhUGT73C3 genes that increase oil content in seeds of plants.

3. A method of increasing oil yield of a plant seed, characterized by, Overexpression GhUGT73C3 genes that increase oil content in seeds of plants; The GhUGT73C3 The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 2; The plant is Arabidopsis thaliana or Gossypium hirsutum.

4. A composition comprising GhUGT73C3 The use of a recombinant vector, expression cassette, transgenic cell line or recombinant bacteria of a gene in improving the oil yield of plant seeds, characterized in that, The GhUGT73C3 The nucleotide sequence of the gene is shown as SEQ ID NO. 1; The plant is Arabidopsis thaliana or Gossypium hirsutum.

5. GhUGT73C3 Use of a gene or of a protein encoded thereby in modulating seed size in a plant, characterized in that The GhUGT73C3 The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO.

2. The plant is Arabidopsis thaliana or Gossypium hirsutum.

6. Use according to claim 5, characterized in that, Overexpression GhUGT73C3 Genes that increase grain length, grain width, and thousand kernel weight of a plant seed.

7. A method of regulating seed size in a plant, comprising, Overexpression GhUGT73C3 genes that increase grain length, grain width, and thousand seed weight in plants; The GhUGT73C3 The nucleotide sequence of the gene is shown as SEQ ID NO. 1; The plant is Arabidopsis thaliana or Gossypium hirsutum.

8. A composition comprising GhUGT73C3 Use of a recombinant vector, expression cassette, transgenic cell line or recombinant bacteria of a gene for regulating the size of plant seeds, characterized in that, The GhUGT73C3 The nucleotide sequence of the gene is shown as SEQ ID NO. 1; The plant is Arabidopsis thaliana or Gossypium hirsutum.

Citation Information

Patent Citations

  • Cotton glycosyl transferase gene GhUGT73C6 and application thereof for regulating plant type

    CN104789578A

  • Cotton GhUGT71 gene and application thereof in phlorizin synthesis

    CN119351457A