Construction method and application of IgM gene knockout zebrafish antibody deletion model

Abstract

The invention provides a construction method and application of an IgM gene knockout zebrafish antibody deletion model, and belongs to the technical field of zebrafish model construction.The method is based on a CRISPR gene knockout technology and specifically comprises the following operation steps that gRNA is synthesized for a CRISPR target located in a CH2 exon region of a zebrafish IgM gene, the gRNA and Cas9 mRNA / Cas9 protein are introduced into a wild type zebrafish embryo, and the zebrafish antibody deletion model is obtained. The P0-generation mutant and wild type zebra fish are hybridized to generate a heterozygote F1 generation, and then the heterozygote F1 generation is selfed to obtain a homozygote mutant, namely the IgM gene knockout zebra fish antibody deletion model. The invention provides the first IgM gene knockout zebrafish antibody deletion model, which is beneficial to exploring the biological function of the IgM gene and determining the influence of immunoglobulin antibody M synthesis disorder on the immune response of the zebrafish, and has application value for rapidly screening and evaluating vaccine adjuvant drugs and natural efficacy factors.

Description

Technical Field

[0001] The present invention relates to the technical field of zebrafish model construction, and in particular to a construction method and application of an IgM gene knockout zebrafish antibody deficiency model. Background Art

[0002] Immunoglobulin is one of the most critical effector molecules in humoral immunity, among which immunoglobulin M (IgM) is the oldest and most conserved immunoglobulin. Similar to mammals, the precursor mRNA encoding the μ chain (Ighμ) of IgM in teleost fish can form two types, secretory (sIgM) and membrane-bound (mIgM), through differential splicing. Most teleost sIgM contains 4 Cμ domains and 1 secretory tail, and mIgM contains 3 Cμ domains and a secretory tail, but zebrafish mIgM contains only one Cμ domain.

[0003] Unlike the pentamer IgM of mammals, the IgM in the serum and mucus of teleost fish exists mainly in the form of tetramers with a molecular weight of about 660-800 kDa. The monomers lack J chains and are mainly bound by disulfide bonds. Studies have shown that disulfide bonds can increase the stability of IgM and its affinity for antigens. The content of IgM is highest in serum and relatively low in mucus. Immunization or pathogen stimulation will lead to the production of IgM antibodies of a certain titer in serum and mucus. IgM antibodies can not only play a role in systemic immune tissues, but also recognize antigens in mucosal tissues. As one of the most important effector molecules, IgM is of great significance for the prevention and treatment of diseases.

[0004] As a teleost model organism, zebrafish IgM-related research is crucial. Current research focuses on the gene structure, expression pattern, and in vitro functional verification of zebrafish IgM, such as antibody affinity determination, but lacks genetic tools to systematically analyze the dynamic process of immune response in vivo. Traditional methods such as antibody neutralization and immunosuppressant blocking have off-target effects or affect other immunoglobulins, and cannot distinguish between secretory and membrane-bound functional differences, resulting in limited research on key mechanisms such as immune response and immune memory. In addition, zebrafish mIgM contains only a single Cμ domain, which may have a unique regulatory mechanism in antigen presentation or B cell activation. However, existing technologies such as RNA interference and antibody depletion are difficult to achieve complete removal of IgM, resulting in questions such as whether IgM deficiency will affect the compensatory upregulation of other immunoglobulins? Does IgM have the dual functions of immune effector molecules and immune cell development regulatory factors in teleosts? Such core issues cannot be verified. Summary of the invention

[0005] In view of the technical problems existing in the background technology, the present invention provides a scheme for constructing a zebrafish model that can simulate IgM deficiency disease, aiming to solve the technical problem of lack of applicable tools in fish IgM-related research.

[0006] In a first aspect, the present invention provides a method for constructing an IgM gene knockout zebrafish antibody deficiency model, specifically: establishing an IgM gene knockout zebrafish antibody deficiency model based on CRISPR gene knockout technology, wherein the CRISPR target is located in the CH2 exon region of the zebrafish IgM gene.

[0007] In some embodiments of the present invention, the above construction method comprises the following steps: S1. Synthesizing gRNA based on CRISPR target, wherein the gRNA comprises the sequence shown in SEQ ID NO.1; S2. Introduce gRNA and Cas9 mRNA (or Cas9 protein) into wild-type zebrafish embryos to obtain P0 mutants; hybridize the P0 mutants with wild-type zebrafish to produce heterozygous F1 generations, which are then self-fertilized to obtain homozygous mutants, which are the IgM gene knockout zebrafish antibody deficiency model.

[0008] The present invention designs a CRISPR target for the CH2 exon region of the zebrafish IgM gene and synthesizes a gRNA for a specific site, and then knocks out the CH2 region based on the CRISPR system, resulting in a frameshift mutation in the constant region domain (Cμ) of the IgM heavy chain, which makes the secretory (sIgM) tetramer and the membrane-bound (mIgM) single domain unable to fold normally, ensuring the functional loss of the model at the protein level. At the same time, the present invention self-pollinates the P0 generation chimera with the same target mutant, combines sequencing to screen out homozygous mutants, and avoids the interference of the heterozygous background on the immune phenotype. Compared with conventional single-generation knockouts, this strategy significantly improves the genetic stability of the model and ensures the repeatability of the experiment. In addition, it can be understood that hybridization and self-pollination are performed after the zebrafish are cultivated to the adult state according to the zebrafish breeding standards.

[0009] Preferably, in the above construction method, the mutant is identified in the following manner: DNA is extracted from the sample to be tested, and PCR amplification is performed using primers with sequences as shown in SEQ ID NO.2~3, followed by sequencing, wherein the mutant contains the sequence shown in SEQ ID NO.4.

[0010] Preferably, in the above construction method, the wild-type zebrafish is of AB strain.

[0011] Preferably, in the above construction method, Cas9 mRNA is zCas9 mRNA, and the ratio of the introduction amount of zCas9 mRNA to gRNA is (6-10):1.

[0012] Preferably, in the above construction method, gRNA and Cas9 mRNA (or Cas9 protein) are introduced into wild-type zebrafish embryos by microinjection.

[0013] In a second aspect, based on the above construction method, the present invention provides tissues / organs of an established IgM gene knockout zebrafish antibody deficiency model.

[0014] In a third aspect, based on the above-mentioned construction method, the present invention provides an application of the established IgM gene knockout zebrafish antibody deficiency model in the evaluation or screening of fish vaccines, vaccine adjuvants, immunization strategies, immunopotentiators, and drugs.

[0015] In a fourth aspect, the present invention provides a kit for constructing an IgM gene knockout zebrafish antibody deficiency model, the kit comprising at least a gRNA targeting the CH2 exon region of the zebrafish IgM gene, and the gRNA comprises a sequence as shown in SEQ ID NO.1.

[0016] Preferably, the above kit also includes Cas9 mRNA / Cas9 protein, primers with sequences as shown in SEQ ID NO.2~3, and other reagents for PCR detection.

[0017] Compared with the prior art, the present invention has the following beneficial effects: (1) The present invention designs a CRISPR target for the CH2 exon region of the zebrafish IgM gene, which is a common coding region for secretory and membrane-bound IgM. Therefore, compared with traditional RNA interference (only partial inhibition) or antibody depletion (inability to distinguish between sIgM and mIgM), the present invention effectively achieves the simultaneous and complete absence of both types of IgM through site-directed gene knockout.

[0018] (2) This invention innovatively achieves the knockout of zebrafish immunoglobulin M for the first time, thus successfully establishing a zebrafish IgM knockout model. The current vaccine evaluation system relies on serum antibody titer detection, but it cannot simulate the impact of mucosal immune barrier failure (such as gill and intestinal mucosal IgM deficiency) on pathogen invasion. As a teleost model organism, the zebrafish IgM knockout model can fill the following technical gaps: clarify the weight distribution of IgM in systemic immunity and mucosal immunity; reveal the key path for pathogens to break through the immune barrier.

[0019] (3) The present invention provides the first fish model that can simulate IgM deficiency disease, which is helpful to explore the biological function of the IgM gene and clarify the impact of immunoglobulin M synthesis disorders on the immune response of zebrafish. This has application value for the rapid screening and evaluation of vaccine adjuvant drugs and natural efficacy factors. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solution of the present invention, the following is a brief introduction to the drawings used in the present invention. Obviously, the drawings described below are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained based on these drawings without creative work.

[0021] Figure 1 The zebrafish in the embodiment of the present invention ighm Location map of the five target sequences within gene exon5; Figure 2 This is a diagram showing the target site sequencing results of the wild-type AB strain zebrafish in the embodiment of the present invention; Figure 3 This is a schematic diagram of the IgM knockout zebrafish screening in an embodiment of the present invention; Figure 4 This is an analysis diagram of the expression of IgM mRNA level and protein level in the IgM knockout zebrafish in the embodiment of the present invention; Figure 5 This is a statistical chart of the survival rates of different strains of zebrafish infected with SVCV in the examples of the present invention. DETAILED DESCRIPTION

[0022] The following embodiments of the technical solution of the present invention are described in detail in conjunction with the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present invention, and are therefore only used as examples, and cannot be used to limit the protection scope of the present invention.

[0023] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by technicians in the technical field to which the present invention belongs; the terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention; the term "including" and any variations thereof in this article are intended to cover non-exclusive inclusions.

[0024] Some specific examples are listed below. It should be noted that the examples described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention. If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in this field or the product instructions are used. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be obtained commercially.

[0025] The wild-type zebrafish used in the following examples are wild-type AB strain zebrafish purchased from the National Zebrafish Resource Center.

[0026] Example 1 This example provides a target and gRNA for achieving zebrafish IgM gene knockout, as follows: (1) Determination of targets.

[0027] According to Ensembl (GRCz11): ENSDARG00000096355, select ighv1-4-205 transcript in the Ensembl website and download zebrafish ighm The genomic sequence of the gene has 7 exons. Figure 1 As shown, in this example, multiple targets were designed near the 5' end of exon5, and the targeting results showed that only one target was effective; specifically, dark gray highlights are primer sequences, frame lines are effective targets, light gray highlights and middle lines are invalid targets, and wavy lines are non-unique targets.

[0028] (2) Target sequence detection and gRNA synthesis.

[0029] The target sequence was amplified from the wild-type DNA and sequenced to confirm that the target sequence was basically consistent with the sequence provided on the Ensemble website. The wild-type AB sequence was as follows: Figure 2 Then, gRNA was synthesized according to T7 RNA polymerase (NEB, cat#M0251S), and the sequence of gRNA included: GATCAGGAGGTAACGAATGCGG (SEQ ID NO.1); it is an existing technology to synthesize gRNA using T7 RNA polymerase when the target site is known, so it will not be described in detail here.

[0030] Example 2 Based on the target and gRNA provided in Example 1, this example provides a method for establishing an IgM gene knockout zebrafish antibody deficiency model, comprising the following steps: Injection into zebrafish embryos ighd -gRNA / zCas9 mRNA complex (zCas9 mRNA, 400 ng / μL; gRNA, 50 ng / μL) was used to obtain the P0 generation mutant with IgM gene knockout.

[0031] After the P0 generation mutant with IgM gene knockout was crossed with wild-type zebrafish to produce heterozygous F1 generation, the heterozygous was self-fertilized to obtain homozygous mutant, namely IgM knockout zebrafish (IgM - / - ).

[0032] Specifically, the mutants were identified by PCR amplification combined with Sanger sequencing, wherein the primers used in PCR are as follows: ighm -F: 5'-GCTTTCTTCTGTATGTTGCC-3' (SEQ ID NO.2), ighm-R: 5'-CCTGCTATCTTTCCGCTTAT-3' (SEQ ID NO.3); The length of the amplified fragment was 327 bp, the annealing temperature was 55°C, and sequencing was performed using the forward primer.

[0033] The results are as follows Figure 3 As shown: Figure 3 A is a schematic diagram of zebrafish IgM gene knockout; Figure 3 B is the wild type and homozygous sequence. The specific homozygous sequence is: GTATCAGAATGATCAGGAGGTAACGATCTTTGAACAATTTTTTCAA (SEQ ID NO.4); the homozygous F2 generation had no morphological differences after being cultured to adult fish (see Figure 3 C), indicating that the knockout had no effect on the normal growth of adult fish.

[0034] Example 3 Taking the wild type as the control, this example verifies the successful establishment of the antibody deficiency model of IgM gene knockout zebrafish by detecting the IgM mRNA and protein expression of IgM knockout zebrafish, as follows: Stable adult zebrafish were dissected and wild-type and IgM - / - of head kidney, spleen, gills, intestine, gonads, liver, skin and serum.

[0035] RNA was extracted from each tissue and tested by qPCR. Figure 4 A) shows that, compared with wild type, different IgM - / - The IgM expression in the tissues was extremely low. The qPCR test was performed using the following primers: q- igm -F: AAGAACGGCTCAGTAACCGAA (SEQ ID NO.5), q- igm -R: CTTATTGTGCTCAAACACGCA (SEQ ID NO.6); β-actin-F: AGGTCATCACCATCGGCAAT (SEQ ID NO.7), β-actin-R:GATGTCCACGTCGCACTTCA (SEQ ID NO. 8).

[0036] At the same time, Western blot was performed using serum, head kidney in vitro culture medium and gill mucus. Serum was diluted 1:10 in PBS and mixed with 2×SDS Loading buffer in equal amounts. 20 μL of head kidney in vitro culture medium and gill mucus were mixed with 2×SDS Loading buffer in equal amounts. The prepared protein samples were incubated in a metal bath at 100°C for 10 min, and then 20 μL was loaded for SDS PAGE, with a constant voltage of 120V for 2 h, and the transfer condition was a constant voltage of 9V for 1 h. After transfer, 5% milk powder was used for blocking for 2 h, primary antibody (rabbit anti-zebrafish IgM antibody) for 1 h, and secondary antibody (HRP-conjugated Goat anti-Rabbit IgG (H+L) for 1 h. The results are shown in Figure 2. Figure 4 B shows that the size of wild-type zebrafish IgM protein is between 660-800 kDa, and IgM knockout zebrafish has no expression of IgM protein in serum, mucosal tissue gills, and systemic immune tissue head kidney.

[0037] The above results show that the present invention successfully constructed an IgM gene knockout zebrafish model.

[0038] Example 4 Using the wild type as a control, this example tested the sensitivity of the IgM gene knockout zebrafish model to viruses to demonstrate the application ability of this model in related immune research, as follows: Adult zebrafish at least three months old were selected and injected intraperitoneally with 10 μL of spring viremia of carp virus (SVCV) into the wild type and IgM knockout types, respectively. The control group was injected with M199 culture medium. The infection temperature was controlled at 24°C. The fish were fasted for 24 h before and after infection. The mortality of different groups was recorded every 24 h after infection, and the survival rate was calculated.

[0039] Test results such as Figure 5 As shown, two control groups (WT-Control, IgM - / - -Control) had a survival rate of 100%, the survival rate of the wild-type infection group (WT-Infection) was 68%, and the survival rate of the IgM knockout infection group (IgM - / - The survival rate of zebrafish in the IgM knockout group after infection was 44%, and the survival rate was significantly lower than that in the wild-type group, indicating that IgM knockout zebrafish are more sensitive to viruses and that IgM plays an important role in the host's resistance to viral infection.

[0040] In summary, the present invention successfully established and cultivated IgM gene knockout zebrafish based on CRISPR gene knockout technology, and the obtained model is stable and reliable, which can be used to explore the biological function of fish IgM gene, screen vaccines, vaccine adjuvants, immunization strategies, immune enhancers, etc., and provide irreplaceable tool support for immunoglobulin evolution theory and disease prevention and control technology.

[0041] It should be noted that the present invention is not limited to the above-mentioned embodiments. The above-mentioned embodiments are only examples, and the embodiments having the same structure as the technical idea and exerting the same effect within the scope of the technical solution of the present invention are all included in the technical scope of the present invention. In addition, without departing from the scope of the main purpose of the present invention, various modifications that can be thought of by those skilled in the art to the embodiments and other methods of combining some of the constituent elements in the embodiments are also included in the scope of the present invention.

Claims

1. A method for constructing an IgM gene knockout zebrafish antibody deficiency model, characterized in that: An IgM gene knockout zebrafish antibody deficiency model was established based on CRISPR gene knockout technology, in which the CRISPR target was located in the CH2 exon region of the zebrafish IgM gene.

2. The construction method according to claim 1, characterized in that: The following steps are involved: Synthesize gRNA based on CRISPR target; The gRNA and Cas9 mRNA / Cas9 protein were introduced into wild-type zebrafish embryos to obtain P0 mutants. The P0 mutants were hybridized with wild-type zebrafish to produce heterozygous F1 generations, and then self-fertilized to obtain homozygous mutants, which is the IgM gene knockout zebrafish antibody deficiency model.

3. The construction method according to claim 2, characterized in that: The gRNA includes the sequence shown in SEQ ID NO.

1.

4. The construction method according to claim 3, characterized in that: The mutant detection method is: using primers with sequences as shown in SEQ ID NO.2-3 to perform PCR amplification and then sequence, and the mutant contains the sequence shown in SEQ ID NO.

4.

5. The construction method according to claim 3, characterized in that: The Cas9 mRNA is zCas9 mRNA, and the ratio of the introduced amount of zCas9 mRNA to gRNA is (6-10):

1.

6. The construction method according to claim 2, characterized in that: The wild-type zebrafish is of AB strain.

7. The construction method according to claim 2, characterized in that: Microinjection was used to introduce gRNA and Cas9mRNA / Cas9 protein into wild-type zebrafish embryos.

8. The tissue or organ of the IgM gene knockout zebrafish antibody deficiency model established by the construction method according to any one of claims 1 to 7.

9. A kit for constructing an IgM gene knockout zebrafish antibody deficiency model, characterized in that: Contains C targeting the zebrafish IgM gene H 2. A gRNA for the exon region, wherein the gRNA comprises the sequence shown in SEQ ID NO.

1.

10. Use of the IgM gene knockout zebrafish antibody deficiency model prepared by the construction method according to any one of claims 1 to 7 in evaluating or screening fish vaccines, vaccine adjuvants, immunization strategies, immunopotentiators, and drugs.

Images