Novel efficient ultra-high flux screening method

Abstract

The invention relates to a novel efficient ultra-high flux screening method, and particularly provides a novel method for sorting a cellobiose epimerase mutant or sorting a strain for expressing the cellobiose epimerase mutant. By means of the method, CE enzyme mutants with different enzyme activities or strains expressing the CE enzyme mutants with different enzyme activities can be classified, and the CE enzyme mutants with higher enzyme activity or strains expressing the CE enzyme mutants with higher enzyme activity are obtained through screening.

Description

Technical Field

[0001] The invention relates to the fields of biotechnology and food, and in particular to a novel and efficient ultra-high throughput screening method. Background Art

[0002] In the context of the big health era, nutrition and health have become important labels for future food. Mid-to-high-end white milk and milk-based ingredients with lactose-free, low-sugar, prebiotics, high dietary fiber and clean labels as selling points have become one of the trends in the future dairy industry.

[0003] White milk products contain about 4.5% background lactose, and the further expansion of its market share is limited by the problem of lactose intolerance. The existing lactose conversion technology (such as hydrolysis and transglycoside) is difficult to fundamentally solve the problem of sugar reduction in dairy products due to the large number of monosaccharide byproducts and low conversion rate. In addition, whey (lactose solid content up to 80%) is a byproduct of cheese processing and concentrated protein production industry, with an annual global output of nearly 6 million tons. At present, most of it is directly discharged, causing huge waste of resources and environmental pollution. Its primary processing investment is large, the return on income is low, and there are significant resource dispersion disadvantages and technical shortcomings compared with foreign lactose processing industries. Therefore, the value-added utilization of lactose has become a bottleneck problem for the upgrading and development of the dairy industry. Through green bioconversion technology, the background lactose in dairy products can be converted into high-value functional sugars such as lactulose as much as possible through isomerization catalysis, which can not only realize the low-lactose and low-sugar claims of dairy products, but also greatly improve the nutrition and biological activity of dairy products, which has important market value.

[0004] At present, the conversion of lactose to lactulose can be achieved by chemical methods, but the chemical method has problems such as severe reaction conditions, many side reactions, difficulty in product separation and purification, high cost, low product safety and possible environmental pollution. In comparison, the enzymatic conversion method has the characteristics of strong reaction specificity, almost no side reactions, high product purity, mild reaction conditions and environmental friendliness, which provides a more feasible way for the preparation of lactose-based high-value functional sugars. The key is to obtain efficient enzyme preparations.

[0005] The enzymes used for enzymatic production of lactulose are mainly β-galactosidase and cellobiose epimerase (CE). Among them, the co-substrate fructose needs to be added during the production of β-galactosidase, which has the disadvantages of more by-products and low lactulose conversion rate (about 15%). Compared with the traditional β-galactosidase method for producing lactulose, CE enzyme has higher production efficiency and does not require the participation of co-substrates, which provides a better choice for the production of lactulose. Existing research teams have been conducting research on high-efficiency CE enzymes and have obtained some CE enzyme mutants with higher activity, but their enzyme activity does not meet the requirements of industrialization.

[0006] In order to facilitate the screening of CE enzyme mutants with higher enzyme activity, new and efficient screening methods need to be researched and explored simultaneously. Summary of the invention

[0007] In order to solve the above problems, the inventors of the present application have conducted in-depth research and exploration and provided a novel method for sorting cellobiose epimerase mutants or strains expressing cellobiose epimerase mutants. The inventors of the present application found that after the substrate lactose was catalyzed by the CE enzyme or its mutant to produce lactulose, the fluorescence intensity of the fluorescent indicator containing 10-hydroxybenzo [h] quinoline (HBQ) and pyridine-3-boric acid (PDBA) at Ex405nm / Em505nm was significantly reduced, and fluorescence quenching occurred, and the higher the concentration of lactulose produced, the more significant the fluorescence quenching. Thus, using the method of sorting cellobiose epimerase mutants or strains expressing cellobiose epimerase mutants of the present application, CE enzyme mutants with different enzyme activities or strains expressing CE enzyme mutants with different enzyme activities can be classified, and CE enzyme mutants with higher enzyme activities can be screened or strains expressing CE enzyme mutants with higher enzyme activities can be screened.

[0008] To this end, in a first aspect of the present invention, the present invention provides a method for sorting cellobiose epimerase mutants, comprising:

[0009] 1-1) reacting equal concentrations of each candidate mutant with equal concentrations of substrate lactose, and independently sampling equal volumes at at least one reaction time point;

[0010] 1-2) mixing and reacting the samples collected at each time point in step 1-1) with a fluorescent indicator, wherein the fluorescent indicator comprises 10-hydroxybenzo[h]quinoline and pyridine-3-boric acid, and the volume of the fluorescent indicator mixed with the samples at each time point is the same;

[0011] 1-3) measuring the fluorescence intensity of each reaction solution obtained in step 1-2) at Ex405nm / Em505nm;

[0012] 1-4) Cellobiose epimerase mutants with different enzyme activities are sorted according to the fluorescence intensity of each candidate mutant at each reaction time point.

[0013] In some embodiments, in step 1-1), when sampling is performed at only one reaction time point, step 1-4) is performed as follows:

[0014] 1-4-a) Cellobiose epimerase mutants with different enzyme activities are sorted according to the fluorescence intensity of each candidate mutant at the same time point.

[0015] In some embodiments, in step 1-4-a), the lower the fluorescence intensity, the higher the enzyme activity of the candidate mutant, and / or, the higher the fluorescence intensity, the lower the enzyme activity of the candidate mutant.

[0016] In some embodiments, step 1-4-a) is performed by comparing the fluorescence intensity of each candidate mutant at the same reaction time point, and the candidate mutant with the lowest fluorescence intensity is the target cellobiose epimerase mutant.

[0017] In some embodiments, in step 1-1), when sampling is performed at more than one reaction time point, step 1-4) is performed as follows:

[0018] 1-4-b) According to the change of fluorescence intensity of each candidate mutant at different time points, cellobiose isomerase mutants with different enzyme activities are sorted.

[0019] In some embodiments, in step 1-4-b), as time passes, the more obvious the fluorescence quenching is, the higher the activity of the candidate mutant enzyme is, and / or, the less obvious the fluorescence quenching is, the lower the activity of the candidate mutant enzyme is.

[0020] In some embodiments, step 1-4-b) is performed by comparing the changes in fluorescence intensity of each candidate mutant at different time points, and the candidate mutant with the most obvious fluorescence quenching as time goes by is the target cellobiose epimerase mutant.

[0021] In a second aspect of the present invention, the present invention provides a method for sorting strains expressing cellobiose epimerase mutants, comprising:

[0022] 2-1) culturing the candidate strains of equal density with equal concentrations of lactose in the presence of a culture medium, and independently collecting equal volumes of fermentation broth at at least one culture time point;

[0023] 2-2) mixing and reacting the fermentation broth collected at each time point in step 2-1) with a fluorescent indicator, wherein the fluorescent indicator comprises 10-hydroxybenzo[h]quinoline and pyridine-3-boric acid, and the volume of the fluorescent indicator mixed with the fermentation broth collected at each time point is the same;

[0024] 2-3) measuring the fluorescence intensity of each reaction solution obtained in step 2-2) at Ex405nm / Em505nm;

[0025] 2-4) According to the fluorescence intensity of each candidate strain at each culture time point, strains expressing cellobiose epimerase mutants with different enzyme activities are sorted.

[0026] In some embodiments, in step 2-1), when the fermentation broth is collected at only one culturing time point, step 2-4) is performed as follows:

[0027] 2-4-a) According to the fluorescence intensity of each candidate strain at the same time point, strains expressing cellobiose epimerase mutants with different enzyme activities are sorted.

[0028] In some embodiments, in step 2-4-a), the lower the fluorescence intensity, the higher the enzyme activity of the cellobiose epimerase mutant expressed by the candidate strain, and / or, the higher the fluorescence intensity, the lower the enzyme activity of the cellobiose epimerase mutant expressed by the candidate strain.

[0029] In some embodiments, step 2-4-a) is performed in the following manner: comparing the fluorescence intensity of each candidate strain at the same culture time point, and the candidate strain with the lowest fluorescence intensity is the target strain.

[0030] In some embodiments, in step 2-1), when the fermentation broth is collected at more than one culture time point, step 2-4) is performed as follows:

[0031] 2-4-b) According to the change of fluorescence intensity of each candidate strain at different time points, strains expressing cellobiose epimerase mutants with different enzyme activities are sorted.

[0032] In some embodiments, in step 2-4-b), as time goes by, the more obvious the fluorescence quenching is, the higher the enzyme activity of the cellobiose diastereomerase mutant expressed by the candidate strain, and / or, the less obvious the fluorescence quenching is, the lower the enzyme activity of the cellobiose diastereomerase mutant expressed by the candidate strain.

[0033] In some embodiments, step 2-4-b) is performed as follows: compare the changes in fluorescence intensity of each candidate strain at different time points, and the candidate strain with the most obvious fluorescence quenching as time goes by is the target strain.

[0034] In some embodiments, the fluorescent indicator is a mixture of 10-hydroxybenzo[h]quinoline, pyridine-3-boronic acid, DMSO and PBS buffer.

[0035] In some embodiments, in the fluorescent indicator, the concentration of the 10-hydroxybenzo[h]quinoline is the same as the concentration of the pyridine-3-boronic acid.

[0036] In some embodiments, the fluorescent indicator is obtained by mixing a first solution, a second solution and a PBS buffer, wherein the first solution is a DMSO solution of 10-hydroxybenzo[h]quinoline, and the second solution is a DMSO solution of pyridine-3-boric acid.

[0037] In some embodiments, in the first solution, the concentration of the 10-hydroxybenzo[h]quinoline is 0.5-5 mM, preferably 5 mM.

[0038] In some embodiments, the concentration of pyridine-3-boric acid in the second solution is 0.5-5 mM, preferably 5 mM.

[0039] In some embodiments, the concentration of the 10-hydroxybenzo[h]quinoline in the first solution is the same as the concentration of the pyridine-3-boronic acid in the second solution.

[0040] In some embodiments, the concentration of the PBS buffer is 20-30 mM, preferably 25.3 mM.

[0041] In some embodiments, the pH of the PBS buffer is 7.0-7.5, preferably 7.4.

[0042] In some embodiments, the volume ratio of the second solution to the first solution is 1:1.

[0043] In some embodiments, the volume ratio of the PBS buffer to the first solution is 1:1-10:1, preferably 3:1.

[0044] In some embodiments, the volume of the sample taken at each time point in step 1-1) is the same as the volume of the fluorescent indicator mixed with the sample at each time point in step 1-2).

[0045] In some embodiments, in step 1-1), the reaction temperature is 20-30°C, preferably 25°C or 30°C.

[0046] In some embodiments, in step 1-1), the reaction speed is 100-500 rpm, preferably 200 rpm.

[0047] In some embodiments, in step 1-2), the reaction is carried out in an incubator. In some embodiments, the temperature of the incubator is 35-40°C, preferably 37°C.

[0048] In some embodiments, in step 1-2), the reaction time is 7-15 min, preferably 10 min.

[0049] In some embodiments, the volume of the fermentation broth collected at each time point in step 2-1) is the same as the volume of the fluorescent indicator mixed with the fermentation broth collected at each time point in step 2-2).

[0050] In some embodiments, in step 2-1), the culture temperature is 20-30°C, preferably 25°C or 30°C.

[0051] In some embodiments, in step 2-1), the culture rotation speed is 100-500 rpm, preferably 200 rpm.

[0052] In some embodiments, in step 2-2), the reaction is carried out in an incubator. In some embodiments, the temperature of the incubator is 35-40°C, preferably 37°C.

[0053] In some embodiments, in step 2-2), the reaction time is 7-15 min, preferably 10 min.

[0054] In some embodiments, in step 2-1), the concentration of lactose is 5-20 g / L, preferably 10 g / L.

[0055] In some embodiments, in step 2-1), the OD600 of each candidate strain is 0.01-0.8 (eg, 0.01, 0.05, 0.6, 0.8).

[0056] In some embodiments, in step 2-1), the culture medium is LB liquid culture medium.

[0057] In some embodiments, in step 2-1), equal densities of candidate strains are cultured in the presence of culture medium with equal concentrations of lactose, kanamycin and IPTG.

[0058] In some embodiments, the concentration of kanamycin is 10-100 mg / mL, preferably 50 mg / mL.

[0059] In some embodiments, the concentration of IPTG is 0.01-0.2 mM.

[0060] In some embodiments, in step 2-1), the time point for collecting the fermentation broth for the first time is more than 6 hours of cultivation.

[0061] In some embodiments, in step 2-1), the mixture of each candidate strain, lactose and culture medium is independently prepared into the form of droplets by a Drem cell device.

[0062] In some embodiments, in step 2-1), the mixture of each candidate strain, lactose, kanamycin, IPTG and culture medium is independently prepared into the form of droplets by a Drem cell device.

[0063] In the third aspect of the present invention, the present invention provides the use of 10-hydroxybenzo[h]quinoline and pyridine-3-boronic acid as fluorescent indicators for sorting cellobiose epimerase mutants or sorting strains expressing cellobiose epimerase mutants.

[0064] Beneficial Effects

[0065] 1. The screening method of the present invention can still accurately detect lactulose and its concentration in a reaction system in which lactose and the like exist. The method has good specificity and high sensitivity.

[0066] 2. The screening method of the present invention can perform high-throughput screening of CE enzyme mutants on a microfluidic high-throughput screening device, and is expected to screen out CE enzyme mutants with high lactulose production, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 The changes in fluorescence intensity of different enzyme strains over time are shown;

[0068] Figure 2 The changes in fluorescence intensity of the same enzyme over time are shown;

[0069] Figure 3 A schematic diagram of 96-well plate culture is shown;

[0070] Figure 4 It shows the changes in fluorescence intensity of different enzyme strains over time when cultured in 96-well plates;

[0071] Figure 5 The fluorescence signals detected by different enzyme strains during the on-machine test are shown;

[0072] Figure 6 A schematic diagram showing the sequencing results of the strains selected during the on-machine test. DETAILED DESCRIPTION

[0073] Embodiments of the present invention will be described in detail below in conjunction with the accompanying drawings and examples, but it will be appreciated by those skilled in the art that the following drawings and examples are only used to illustrate the present invention, rather than to limit the scope of the present invention. According to the following detailed description of the accompanying drawings and preferred embodiments, various objects and advantages of the present invention will become apparent to those skilled in the art. Unless otherwise specified, each raw material and reagent can be commercially available.

[0074] In addition, in the following examples, the screening method of the present application is exemplified by taking three CsCE strains, opt-Q371E, opt, and ori, as examples, and the enzyme activities of the CE enzyme mutants expressed therein are ranked as opt-Q371E≈3x opt≈10xori.

[0075] Among them, ori is a known enzyme, opt-Q371E and opt are new enzymes, and the gene sequences of the three enzymes are shown below. In addition, the strains mentioned in the following examples are enzyme genes cloned into expression vectors and then introduced into Escherichia coli for expression and detection. The key is that the enzyme genes are different.

[0076] The gene sequences of the three enzymes are as follows:

[0077] ori:

[0078] ATGGATATTACAAGGTTTAAGGAAGATTTAAAAGCTCATCTTG

[0079] AAGAAAAGATAATACATTTTGGCAAAGTTTAAAGGACGATGA

[0080] ATTTGGTGGCTACTATGGATATATGGACTTTAATCTTAACATTG

[0081] ACAGAAAAGCTCAAAAAGGTTGCATTTTGAACTCGAGGATAT

[0082] TGTGGTTTTTCTCAGCATGTTACAATGTGCTGAAAAGTGAAA

[0083] AATGCAAAGAGATGGCTTTTCATGCGTTTGAATTTTTAAAAAA

[0084] CAAGTTTTGGGACAAAGAGTATGAAGGACTTTTCTGGAGTGT

[0085] ATCCCACAAAGGTGTGCCCGTTGATGTGACAAAACATGTTTA

[0086] TGTTCAGGCTTTTGGCATATACGGGCTTTCTGAGTACTATGAA

[0087] GCATCCGGGGACGAAGAAGCTCTTCATATGGCTAAGAGGCTT

[0088] TTCGAGATTTTAGAGACAAAATGCAAAAGGGAAAATGGATAC

[0089] ACAGAACAGTTTGAGAGAAACTGGCAAGAAAAAGAAAACAG

[0090] GTTTTTGAGCGAAAATGGAGTAATTGCCTCAAAAACAATGAA

[0091] CACGCATCTTCATGTACTGGAGAGCTACACAAAACCTCTACAG

[0092] GCTTTTGAAGCTTGATGATGTGTATGAAGCGCTTTGAGTGGAT

[0093] TGTAAGACTCTTTGTTGACAAGATTTACAAAAAAGGAACAGG

[0094] TCACTTCAAGGTATTTTGCGATGATAACTGGAACGAACTTATA

[0095] AAAGCAGTATCATATGGACATGACATTGAAGCAAGCTGGCTTT

[0096] TAGACCAAGCTGCCAAGTATCTGAAGGATGAAAAGTTAAAAG

[0097] AGGAGGTTGAAAAGCTCGCATTAGAGGTTGCCCAGATAACTT

[0098] TAAAAGAAGCCTTTGATGGTCAAAGTCTTATAAATGATGAT

[0099] AGAAGATAGGATTGACAGGAGTAAAATCTGGTGGGTTGAAGC

[0100] AGAGACGGTTGTTGGATTTTCAATGCATATCAAAAGACAAA

[0101] AGAGGAAAAAATATTGATGCAGCCATCAAGACATGGGAGTT

[0102] CATAAAAGAGCATCTTGTTGACAGAAGAAAGAACTCTGAATG

[0103] GCTGTGGAAGGTAAATGAGGATTTAGAAGCTGTAAAATATGCC

[0104] AATTGTTGAGCAATGGAAGTGCCCATATCACAATGGCAGAATGTGTTTGGAGATAATAAAAAGGGTTGACTAG(SEQ ID NO:1)opt:

[0105] ATGGACATCACCCGCTTCCAAAGAAGATCTGAAAGCGCACCTG

[0106] GAAGAAAAAATTATCCCGTTCTGGCAGAGCCTGAAAGACGAT

[0107] GAGTTCGGCGGCTACTACGGCTACATGGATTTCAACCTGAAC

[0108] ATCGATCGTAAAGCTCAGAAAGGCTGTATCCTGAACTCTCGC

[0109] ATTCTGTGGTTTTTCAGCGCGTGCTACAACGTTCTGAAATCC

[0110] GAAAAATGTAAAGAAAATGGCGTTCCACGCGTTCGAATTTCTG

[0111] AAAAACAAATTCTGGGAATAAAGAATACGAAGGTCTGTTCTGG

[0112] AGCGTTAGCCCAAAAGGCGTTCCGGTTGACGTGACCAAACAC

[0113] GTGTACGTGCAGGCGTTCGGTATCTACGGCCTGAGCGAATAC

[0114] TATGAAGCGAGCGGCGATGAAGAAGCCCTGCACATGGCGAA

[0115] ACGTCTGTTCGAAATCCTGGAAACCAAATGCAAACGTGAAAA

[0116] CGGTTACACCGAACAGTTCGAACGTAACTGGCAGGAAAAAGA

[0117] AAACCGCTTCCTGTCCGAAAACGGTGTTATCGCGTCCAAAAC

[0118] CATGAACACCCACCTGCACGTGCTGGAAAGCTACACTAACCT

[0119] GTACCGCCTGCTGAAACTGGATGATGTTTACGAAGCTCTGGA

[0120] ATGGATCGTTCGCCTGTTCGTTGACAAAATCTACAAAAAAGG

[0121] CACCGGTCATTTCAAAGTTTTCTGCGATGATAACTGGAACGA

[0122] ACTGATTAAAGCTGTTTCTTACGGCCATGACATCGAAGCGTCT

[0123] TGGCTGCTGGATCAGGCGGCGAAATATCTGAAAGATGAAAAA

[0124] CTGAAAGAAGAAGTTGAAAAACTGGCTCTTGAAGTTGCGCAG

[0125] ATCACCCTGAAAGAAGCGTTTGACGGTCAGAGCCTGATCAAC

[0126] GAAATGATCGAAGATCGTATCGATCGTAGCAAAATCTGGTGG

[0127] GTTGAAGCGGAAACCGTGGTGGGTTTCTTCAACGCGTACCAG

[0128] AAAACTAAAGAAGAAAAATATCTGGATGCGGCGATCAAAACC

[0129] TGGGAGTTCATCAAAGAACACCTGGTTGACCGCCGTAAAAAC

[0130] TCCGAATGGCTGTGGAAAGTTAACGAAGATCTGGAAGCGGTG

[0131] AACATGCCGATCGTGGAAACAGTGGAAATGCCCGTACCACAACGGTCGCATTGCCTGGAAATCATCAAACGTGTTGACTAA(SEQ ID NO:2)

[0132] opt-Q371E:

[0133] ATGGACATCACCCGCTTCCAAAGAAGATCTGAAAGCGCACCTG

[0134] GAAGAAAAAATTATCCCGTTCTGGCAGAGCCTGAAAGACGAT

[0135] GAGTTCGGCGGCTACTACGGCTACATGGATTTCAACCTGAAC

[0136] ATCGATCGTAAAGCTCAGAAAGGCTGTATCCTGAACTCTCGC

[0137] ATTCTGTGGTTTTTCAGCGCGTGCTACAACGTTCTGAAATCC

[0138] GAAAAATGTAAAGAAAATGGCGTTCCACGCGTTCGAATTTCTG

[0139] AAAAACAAATTCTGGGAATAAAGAATACGAAGGTCTGTTCTGG

[0140] AGCGTTAGCCCAAAAGGCGTTCCGGTTGACGTGACCAAACAC

[0141] GTGTACGTGCAGGCGTTCGGTATCTACGGCCTGAGCGAATAC

[0142] TATGAAGCGAGCGGCGATGAAGAAGCCCTGCACATGGCGAA

[0143] ACGTCTGTTCGAAATCCTGGAAACCAAATGCAAACGTGAAAA

[0144] CGGTTACACCGAACAGTTCGAACGTAACTGGCAGGAAAAAGA

[0145] AAACCGCTTCCTGTCCGAAAACGGTGTTATCGCGTCCAAAAC

[0146] CATGAACACCCACCTGCACGTGCTGGAAAGCTACACTAACCT

[0147] GTACCGCCTGCTGAAACTGGATGATGTTTACGAAGCTCTGGA

[0148] ATGGATCGTTCGCCTGTTCGTTGACAAAATCTACAAAAAAGG

[0149] CACCGGTCATTTCAAAGTTTTCTGCGATGATAACTGGAACGA

[0150] ACTGATTAAAGCTGTTTCTTACGGCCATGACATCGAAGCGTCT

[0151] TGGCTGCTGGATCAGGCGGCGAAATATCTGAAAGATGAAAAA

[0152] CTGAAAGAAGAAGTTGAAAAACTGGCTCTTGAAGTTGCGCAG

[0153] ATCACCCTGAAAGAAGCGTTTGACGGTCAGAGCCTGATCAAC

[0154] GAAATGATCGAAGATCGTATCGATCGTAGCAAAATCTGGTGG

[0155] GTTGAAGCGGAAACCGTGGTGGGTTTCTTCAACGCGTACCAG

[0156] AAAACTAAAGAAGAAAAATATCTGGATGCGGCGATCAAAACC

[0157] TGGGAGTTCATCAAAGAACACCTGGTTGACCGCCGTAAAAAC

[0158] TCCGAATGGCTGTGGAAAGTTAACGAAGATCTGGAAGCGGTG

[0159] AACATGCCGATCGTGGAAGAATGGAAATGCCCGTACCACAACGGTCGCATGTGCCTGGAAATCATCAAACGTGTTGACTAA(SEQ ID NO:3)

[0160] Example 1: Establishment of screening method

[0161] Experimental operation:

[0162] ① Three CsCE strains with different enzyme activities were selected as evaluation examples of the screening method. The difference in enzyme activities among the three strains was: opt-Q371E≈3×opt≈10×ori;

[0163] ② The plasmids of the three strains (which contain genes that can express enzyme mutants) were transformed into Escherichia coli BL21 (DE3) cells respectively, and the bacterial solution was spread on LB solid culture medium containing kanamycin (50 mg / ml), and inverted cultured at 37°C for 12-16h. Transfer a single colony to a culture flask (50ml) containing LB liquid culture medium (5ml) containing kanamycin (50mg / ml), and culture at 37°C, 200rpm for 12-16h. Transfer 1mL of seed solution to a culture flask (250ml) containing LB liquid culture medium (100ml) containing kanamycin (50mg / ml), and culture at 37°C, 200rpm. When the OD600 of the culture reaches 0.6-0.8, add 0.2mM IPTG and 10g / L lactose, and culture at 25°C, 200rpm;

[0164] ③ Take 1 mL of the fermentation liquid at 6, 12, 18 and 24 h of culture and store it in a refrigerator at 4 °C;

[0165] ④ Prepare 5 mM HBQ-DMSO solution, 5 mM PDBA-DMSO solution and 25.3 mM PBS (pH 7.4) solution, mix them evenly in a ratio of 1:1:3 (v:v:v), and let stand for 10 min for later use;

[0166] ⑤ Take 1 mL of fluorescent indicator and add it dropwise to 1 mL of fermentation liquid. Vortex to mix well and place in a 37°C incubator for 10 min.

[0167] ⑥ Use a fluorescence spectrophotometer to measure the fluorescence intensity at Ex405nm / Em505nm.

[0168] Experimental results:

[0169] like Figure 1 As shown in the figure, at different sampling time points, the fluorescence intensity of the fluorescent indicator is negatively correlated with the enzyme activity of the CsCE enzyme, that is, the higher the enzyme activity, the more significant the fluorescence quenching. Figure 2As shown, for the same enzyme (e.g., opt-Q371E), as the induction time increases, the production of lactulose in the system gradually increases, and the fluorescence value of the detected fluorescent indicator becomes lower, which also indirectly confirms that this fluorescent indicator is accurate and sensitive in recognizing lactulose, and can be used in a strict enzyme activity screening system.

[0170] Example 2: 96-well plate system validation of the screening method

[0171] Experimental operation:

[0172] ① Transfer single colonies of opt-Q371E (high activity) and ori (low activity) into a culture bottle (50 ml) containing LB liquid medium (5 ml) containing kanamycin (50 mg / ml) and culture at 37°C and 200 rpm for 12-16 h;

[0173] ② Take 1 mL of bacterial solution and wash the bacteria twice with 50 mM PBS (pH 7.2);

[0174] ③ Dilute the cells to OD600 = 0.01 with LB liquid medium containing 50 mg / ml kanamycin, 10 g / L lactose and 0.01 mM IPTG;

[0175] ④ Take 6 sterile 96-well cell culture plates (such as Figure 3 As shown), the culture was transferred to a cell culture plate, 100 μL per well, 4 columns of each bacterial strain were inoculated, and a blank group (sterile) was added, and static culture was carried out at 30°C;

[0176] ⑤ After 14, 24, 38, 48, 62 and 72 hours of culture, take out one cell culture plate to measure the fluorescence value;

[0177] ⑥ Before the test, prepare 5 mM HBQ-DMSO solution, 5 mM PDBA-DMSO solution and 25.3 mM PBS (pH 7.4) solution, mix them evenly at a ratio of 1:1:3 (v:v:v), and let them stand for 10 min for later use;

[0178] ⑦ Transfer 50 μL of the culture in the cell culture plate to a new 96-well plate, add 50 μL of fluorescent indicator to each well, and place in a 37°C incubator for 10 minutes;

[0179] ⑧ Use a fluorescence microplate reader to measure the fluorescence intensity at Ex405nm / Em505nm.

[0180] Experimental results:

[0181] like Figure 4As shown in the figure, the blank group has a basic fluorescence value. When bacteria are present, the fluorescence value will increase, but it will not affect the overall fluorescence quenching trend. The fluorescence value of the strain (QE) group with high enzyme activity is lower than that of the strain (ori) group with low enzyme activity, and the fluorescence difference increases with the extension of culture time until it reaches the maximum value after 62 hours of culture. This result shows that in the micro-culture system, this fluorescent indicator still has the effect of accurately indicating the lactulose concentration, and can sensitively sort out strains with different enzyme activities, that is, the lower the fluorescence value, the higher the strain activity.

[0182] Example 3: On-machine testing of screening method

[0183] Experimental operation:

[0184] ① Transfer single colonies of opt-Q371E (high activity), opt (medium activity) and ori (low activity) into a culture bottle (50 ml) containing LB liquid medium (5 ml) containing kanamycin (50 mg / ml) and culture at 37°C and 200 rpm for 12-16 h;

[0185] ② Take 1 mL of bacterial solution and wash the bacteria twice with 50 mM PBS (pH 7.2);

[0186] ③ Dilute the cells to OD600 = 0.05 using LB liquid medium containing 50 mg / ml kanamycin, 10 g / L lactose and 0.01 mM IPTG;

[0187] ④ After the three diluted bacteria were mixed evenly, the water-in-oil droplets were generated by the liquid microfluidic chip of the Drem cell device. The droplets were collected in the Teflon tube WF and placed in a 30°C incubator for static culture for 24 hours;

[0188] ⑤ Prepare 5 mM HBQ-DMSO solution, 5 mM PDBA-DMSO solution and 25.3 mM PBS (pH 7.4) solution, mix them evenly at a ratio of 1:1:3 (v:v:v), and let stand for 10 min for later use;

[0189] ⑥ Take out the mixed bacterial droplets cultured in the Teflon tube, inject an equal volume of freshly prepared fluorescent indicator into the mixed bacterial droplets through the microinjection microfluidic chip of the Drem cell device, and then let it react at 37°C for 10 minutes;

[0190] ⑦ Take out the mixed bacterial droplets after the reaction and re-inject them into the sorting microfluidic chip, set the fluorescence parameters to Ex405nm / Em505nm, and set the cell sorting threshold to 6, and collect the two tubes of droplets above and below the threshold respectively;

[0191] ⑧ Use a demulsifier to break the droplet structure to release the bacteria, and then spread the bacteria on a solid LB medium containing kanamycin (50 mg / mL) after appropriate dilution, and invert and culture at 37°C for 12-16 hours;

[0192] ⑨Single colony sequencing.

[0193] Experimental results:

[0194] The fluorescent signal detected during cell sorting is as follows Figure 5 As shown, the cell encapsulation rate is 20%, and the signal value of 80% of the empty droplets is the lowest and evenly distributed in the bottom layer. The signal value of the bacterial droplets is higher than that of the empty droplets. Then, the strain activity is distinguished based on the difference in signal values. The sorting threshold is set to 6 this time.

[0195] The two types of strains selected grew well, and the sequencing results were as follows: Figure 6 As shown. 100% of the strains sequenced above the sorting threshold are low-activity strains (ori), and the strains below the sorting threshold include high-activity strains (opt-QE), medium-activity strains (opt) and low-activity strains (ori). Our goal is to screen out high-activity strains. Due to the high sorting threshold set in this screening, low-activity strains were sorted out, while high-activity strains were still in a mixed bacterial state. However, the results show that this high-throughput cell sorting method based on fluorescence quenching is correct.

[0196] In general, when applying this method for high-throughput screening of mutant libraries, the sorting threshold should be set to an extremely low level to ensure that the strains sorted are the most active strains in the system.

[0197] It should be understood that the invention described herein is not limited to specific methodology, experimental protocols or reagents, as these may vary. The discussion and examples provided herein are presented only to describe specific embodiments and are not intended to limit the scope of the invention, which is limited only by the claims.

Claims

1. A method for sorting cellobiose epimerase mutants, wherein include: 1-1) reacting equal concentrations of each candidate mutant with equal concentrations of substrate lactose, and independently sampling equal volumes at at least one reaction time point; 1-2) mixing and reacting the samples collected at each time point in step 1-1) with a fluorescent indicator, wherein the fluorescent indicator comprises 10-hydroxybenzo[h]quinoline and pyridine-3-boric acid, and the volume of the fluorescent indicator mixed with the samples at each time point is the same; 1-3) measuring the fluorescence intensity of each reaction solution obtained in step 1-2) at Ex405nm / Em505nm; 1-4) Cellobiose epimerase mutants with different enzyme activities are sorted according to the fluorescence intensity of each candidate mutant at each reaction time point.

2. The method according to claim 1, in, The method further has any one of the following technical features (i)-(ii): (i) In step 1-1), when sampling is performed at only one reaction time point, step 1-4) is performed as follows: 1-4-a) sorting cellobiose epimerase mutants with different enzyme activities according to the fluorescence intensity of each candidate mutant at the same time point; Preferably, in step 1-4-a), the lower the fluorescence intensity, the higher the enzyme activity of the candidate mutant, and / or, the higher the fluorescence intensity, the lower the enzyme activity of the candidate mutant; Preferably, step 1-4-a) is performed in the following manner: comparing the fluorescence intensity of each candidate mutant at the same reaction time point, and the candidate mutant with the lowest fluorescence intensity is the target cellobiose epimerase mutant; (ii) In step 1-1), when sampling is performed at more than one reaction time point, step 1-4) is performed as follows: 1-4-b) sorting cellobiose epimerase mutants with different enzyme activities according to the changes in fluorescence intensity of each candidate mutant at different time points; Preferably, in step 1-4-b), as time passes, the more obvious the fluorescence quenching is, the higher the enzyme activity of the candidate mutant is, and / or, the less obvious the fluorescence quenching is, the lower the enzyme activity of the candidate mutant is; Preferably, step 1-4-b) is performed in the following manner: comparing the changes in fluorescence intensity of each candidate mutant at different time points, and the candidate mutant with the most obvious fluorescence quenching as time goes by is the target cellobiose epimerase mutant.

3. A method for sorting strains expressing cellobiose epimerase mutants, wherein include: 2-1) culturing the candidate strains of equal density with equal concentrations of lactose in the presence of a culture medium, and independently collecting equal volumes of fermentation broth at at least one culture time point; 2-2) mixing and reacting the fermentation broth collected at each time point in step 2-1) with a fluorescent indicator, wherein the fluorescent indicator comprises 10-hydroxybenzo[h]quinoline and pyridine-3-boric acid, and the volume of the fluorescent indicator mixed with the fermentation broth collected at each time point is the same; 2-3) measuring the fluorescence intensity of each reaction solution obtained in step 2-2) at Ex405nm / Em505nm; 2-4) According to the fluorescence intensity of each candidate strain at each culture time point, strains expressing cellobiose epimerase mutants with different enzyme activities are sorted.

4. The method according to claim 3, in, The method further has any one of the following technical features (i)-(ii): (i) In step 2-1), when the fermentation broth is collected at only one culture time point, step 2-4) is performed as follows: 2-4-a) sorting strains expressing cellobiose epimerase mutants with different enzyme activities according to the fluorescence intensity of each candidate strain at the same time point; Preferably, in step 2-4-a), the lower the fluorescence intensity, the higher the enzyme activity of the cellobiose epimerase mutant expressed by the candidate strain, and / or, the higher the fluorescence intensity, the lower the enzyme activity of the cellobiose epimerase mutant expressed by the candidate strain; Preferably, step 2-4-a) is performed in the following manner: comparing the fluorescence intensity of each candidate strain at the same culture time point, and the candidate strain with the lowest fluorescence intensity is the target strain; (ii) In step 2-1), when the fermentation broth is collected at more than one culture time point, step 2-4) is performed as follows: 2-4-b) Sorting strains expressing cellobiose epimerase mutants with different enzyme activities according to the changes in fluorescence intensity of each candidate strain at different time points; Preferably, in step 2-4-b), as time passes, the more obvious the fluorescence quenching is, the higher the enzyme activity of the cellobiose epimerase mutant expressed by the candidate strain, and / or, the less obvious the fluorescence quenching is, the lower the enzyme activity of the cellobiose epimerase mutant expressed by the candidate strain; Preferably, step 2-4-b) is performed in the following manner: comparing the changes in fluorescence intensity of each candidate strain at different time points, and the candidate strain with the most obvious fluorescence quenching as time goes by is the target strain.

5. The method according to any one of claims 1 to 4, in, The fluorescent indicator is a mixture of 10-hydroxybenzo[h]quinoline, pyridine-3-boric acid, DMSO and PBS buffer; Preferably, in the fluorescent indicator, the concentration of the 10-hydroxybenzo[h]quinoline is the same as the concentration of the pyridine-3-boric acid; Preferably, the fluorescent indicator is obtained by mixing a first solution, a second solution and a PBS buffer, wherein the first solution is a DMSO solution of 10-hydroxybenzo[h]quinoline, and the second solution is a DMSO solution of pyridine-3-boric acid; Preferably, in the first solution, the concentration of 10-hydroxybenzo[h]quinoline is 0.5-5 mM, preferably 5 mM; Preferably, in the second solution, the concentration of pyridine-3-boric acid is 0.5-5 mM, preferably 5 mM; Preferably, the concentration of the 10-hydroxybenzo[h]quinoline in the first solution is the same as the concentration of the pyridine-3-boric acid in the second solution; Preferably, the concentration of the PBS buffer is 20-30 mM, preferably 25.3 mM; Preferably, the pH of the PBS buffer is 7.0-7.5, preferably 7.4; Preferably, the volume ratio of the second solution to the first solution is 1:1; Preferably, the volume ratio of the PBS buffer to the first solution is 1:1-10:1, preferably 3:

1.

6. The method according to any one of claims 1 to 2 and 5, in, The method further has one or more technical features selected from the following (i)-(v): ( i) the volume of the sample taken at each time point in step 1-1) is the same as the volume of the fluorescent indicator mixed with the sample at each time point in step 1-2); (ii) In step 1-1), the reaction temperature is 20-30°C, preferably 25°C or 30°C; (iii) In step 1-1), the reaction speed is 100-500 rpm, preferably 200 rpm; (iv) In step 1-2), the reaction is carried out in an incubator; preferably, the temperature of the incubator is 35-40°C, preferably 37°C; (v) In step 1-2), the reaction time is 7-15 min, preferably 10 min.

7. The method according to any one of claims 3 to 5, in, The method further has one or more technical features selected from the following (i)-(v): ( i) the volume of the fermentation broth collected at each time point in step 2-1) is the same as the volume of the fluorescent indicator mixed with the fermentation broth collected at each time point in step 2-2); (ii) in step 2-1), the culture temperature is 20-30°C, preferably 25°C or 30°C; (iii) in step 2-1), the culture speed is 100-500 rpm, preferably 200 rpm; (iv) in step 2-2), the reaction is carried out in an incubator; preferably, the temperature of the incubator is 35-40° C., preferably 37° C.; (v) In step 2-2), the reaction time is 7-15 min, preferably 10 min.

8. The method according to any one of claims 3 to 5 and 7, in, The method further has one or more technical features selected from the following (i)-(v): ( i) in step 2-1), the concentration of lactose is 5-20 g / L, preferably 10 g / L; (ii) in step 2-1), the OD600 of each candidate strain is 0.01-0.8 (e.g., 0.01, 0.05, 0.6, 0.8); (iii) in step 2-1), the culture medium is LB liquid culture medium; (iv) in step 2-1), equal densities of the candidate strains are cultured in the presence of a culture medium with equal concentrations of lactose, kanamycin and IPTG; Preferably, the concentration of kanamycin is 10-100 mg / mL, preferably 50 mg / mL; Preferably, the concentration of IPTG is 0.01-0.2 mM; (v) In step 2-1), the fermentation broth is first collected after culturing for more than 6 hours.

9. The method according to any one of claims 3-5 and 7-8, in, The method further has any one of the following technical features (i)-(ii): (i) In step 2-1), the mixture of each candidate strain, lactose and culture medium is independently prepared into droplets by a Drem cell device; (ii) In step 2-1), the mixture of each candidate strain, lactose, kanamycin, IPTG and culture medium is independently prepared into droplets by a Drem cell device.

10. Use of 10-hydroxybenzo[h]quinoline and pyridine-3-boronic acid as fluorescent indicators for sorting cellobiose epimerase mutants or sorting strains expressing cellobiose epimerase mutants.

Images