Kit for detecting prostate

Abstract

The invention relates to a kit for detecting prostate, the kit for detecting prostate comprises an RT-RAA amplification system, the RT-RAA amplification system comprises an RT-RAA amplification stock solution and an RNA sample, the RT-RAA amplification system comprises T7RNA polymerase with the concentration of 2-6 U / [mu] L, and the T7RNA polymerase is used for being mixed with the RNA sample from a sample to be detected to prepare an RNA product; the primer pair and the probe are used for preparing an RNA product; the fluorescent test strip comprises three positions, namely a PCA3 detection line, a PSA detection line and a negative sample quality control line, the PSA detection line is coated with an anti-PSA rabbit-derived antibody and is used for being combined with PSA protein in a sample to be detected, the PCA3 detection line is coated with an anti-FITC rabbit-derived antibody marked by fluorescent microspheres and is used for being combined with target RNA in an RNA product, and the PCA3 detection line is used for being combined with the target RNA in the sample to be detected. And the negative sample quality control line is coated with a ligand Avidin of Biotin, can be combined with an antibody in the combination pad, and is used for judging whether the chromatography process is smooth or not. The kit for detecting the prostate has good sensitivity and accuracy.

Description

Technical Field

[0001] The present application relates to the field of biological and medical detection technology, and in particular to a kit for detecting prostate. Background Art

[0002] Prostatic cancer (PCa) is a common malignant tumor in the male urinary and reproductive systems. As a major global public health issue that seriously endangers male health and socioeconomic development, in-depth research on its pathogenesis, prevention and treatment is urgently needed.

[0003] Currently, the methods used for prostate cancer screening include prostate biopsy, magnetic resonance imaging, and prostate-specific antigen testing, but these methods are costly, risky, and low specificity, and require specific expensive equipment and professional operators. Therefore, it is urgent to develop biomarkers that are highly specific, low-cost, easy to obtain, stable, and reliable, and to establish new non-invasive screening and diagnostic methods for prostate cancer based on these biomarkers.

[0004] The present invention utilizes recombinase-mediated isothermal amplification (RT-RAA) and fluorescent lateral flow technology to achieve co-detection of PCA3 RNA fragments and PSA protein, and can provide a method with both specificity and sensitivity for clinical diagnosis of prostate cancer. Summary of the invention

[0005] The embodiment of the present application provides a kit for detecting the prostate, which solves the problems of low sensitivity and large detection limit of the immunoturbidimetric platform. The kit has high detection sensitivity, fast speed, strong specificity, high stability, and can realize mobile detection and home self-service detection.

[0006] The first aspect of the present application provides a kit for detecting the prostate, including a kit for detecting the prostate, comprising:

[0007] The RT-RAA amplification system includes: an RT-RAA amplification stock solution and an RNA sample, the RT-RAA amplification system includes a T7 RNA polymerase at a concentration of 2-6 U / μL, which is used to mix with the RNA sample from the sample to be tested to prepare an RNA product;

[0008] Primer pairs and probes for preparing RNA products;

[0009] A fluorescent test strip, comprising three positions on the fluorescent test strip: a PCA3 test line, a PSA test line and a negative sample quality control line, wherein the PSA test line is coated with an anti-PSA rabbit antibody for binding to the PSA protein in the sample to be tested, the PCA3 test line is coated with an anti-FITC rabbit antibody labeled with fluorescent microspheres for binding to the target RNA in the RNA product, and the negative sample quality control line is coated with a ligand of Biotin, Avidin, which can bind to the antibody in the binding pad and is used to determine whether the chromatography process is smooth;

[0010] In some embodiments the primer pair comprises:

[0011] PSA3-RAA-F:5'-ACCGTTTAGTATGACCAGTG-3';

[0012] PSA3-RAA-R:5'-ACATCATTGGCAGTCATAG-3'.

[0013] In some embodiments, the probe comprises PSA3-RAA-P:FITC-ATAGAGTTGA AACTCTACAC-Biotin-Spacer3.

[0014] In some embodiments, the fluorescent test strip includes a conjugate pad and a chromatographic membrane arranged in a stacked manner, wherein the conjugate pad contains a rabbit-derived anti-FITC antibody and a rabbit-derived anti-PSA antibody labeled with fluorescent microspheres, which are used to bind to the target RNA in the RNA product and to bind to the PSA protein in the sample to be tested, respectively. When the rabbit-derived anti-FITC antibody and the rabbit-derived anti-PSA antibody labeled with fluorescent microspheres bind to the target RNA in the RNA product, the PCA3 detection line of the chromatographic membrane develops color; when the rabbit-derived anti-PSA antibody binds to the PSA protein in the sample to be tested, the PSA detection line of the chromatographic membrane develops color;

[0015] In some embodiments, the concentration of the T7 RNA polymerase in the RT-RAA amplification system is 5 U / μL.

[0016] In some embodiments, the kit further comprises a cell lysis buffer; the cell lysis buffer comprises: Tris HCl: 40-60 mM; MNaCl: 120-180 mM; EDTA: 0.8-1.5 mM; EGTA: 0.8-1.5 mM; IGEPAL CA-630: 0.8%-1.5%; pH: 7-8.

[0017] The beneficial effects of this application are:

[0018] The kit provided in the present application detects the PCA3 gene and the PSA protein at the same time, thereby avoiding the inaccurate positive detection rate of a single PSA protein or PCA3 gene, improving the sensitivity, speed, specificity, and stability of the detection, and enabling mobile detection and home self-service detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The features, advantages and technical effects of exemplary embodiments of the present application will be described below with reference to the accompanying drawings.

[0020] Figure 1 It shows the accuracy of the kit under different T7 RNA polymerase addition amounts provided in the examples of the present application;

[0021] Figure 2 A flow chart of adding samples to be tested and a schematic diagram of test results are shown in the embodiment of the present application;

[0022] Figure 3 The PSA accuracy test results in the embodiment of the present application are shown;

[0023] Figure 4 The results of the minimum detection limit of PSA in the examples of the present application are shown;

[0024] Figure 5 The PSA linearity test results in the embodiment of the present application are shown;

[0025] Figure 6 The PSA repeatability test results in the examples of the present application are shown;

[0026] Figure 7-10 The results of the verification tests of the specificity of PSA and PCA3 and the necessity of the test strip components in the examples of the present application are shown;

[0027] Fig.11 The test results of the embodiment of the present application are shown. DETAILED DESCRIPTION

[0028] The following detailed description and drawings of the embodiments of the present application are used to illustrate the principles of the present application, but cannot be used to limit the scope of the present application, that is, the present application is not limited to the described embodiments.

[0029] The prostate cancer markers discovered so far are mainly prostate-specific antigen (PSA), which is the most mature in clinical application. However, its specificity is low, and using PSA alone as a tumor marker for diagnosing prostate cancer will lead to overdiagnosis and overtreatment of patients with low-risk diseases. PCA3 is a long non-coding RNA, and its sequence is SEQ ID NO.1:

[0030] ATGGTAGAATTTTGGTCAAATAATGACCGTGGGTATCGCATTAGATTGTGGATTGACCAAGTTGGGCAGA

[0031] ATGTTCAAAATAATACGAGCGATGTCCGTATTCGCTTGGCATTGCTTAATCAATGGTGGACGTTCGCAAG

[0032] TTATCAATGTTATGGCTATGTCGATGGGTTTGGTCAACGGCTTGAATATTCAGGAAGTCCTTCAATGCTG

[0033] TCCACAAATTCAGAAATACAGCTTATTGATCGCACGATTACCGTTAGCCATGCAGATGACGGAACTGGTG

[0034] TTTTTGGCGTAACCGCTCACTTCAATGGTTCGGGTGGATACAGTCCAGGGAATCTAGATATTGGTAACCA

[0035] AAGTATAACACTGACGACGATTCCAAGAGGGAGCACAGTAAGTGTTACGGATGGGGTTATTGGAAATCAA

[0036] GTAGATATCACTATTAACCGAAAACTAGGCGGAGCTACGCACACATTACGTTATTCTTGGTACAACAAAC

[0037] AAGGTGAAATTGCTAACAACGTAGGGACATCTTACAAATGGACAATCCCAGCAGATTTTGCTGATGACAT

[0038] ACCAAGATCTACCTCTGGCCGAGGTACTATATACGTTGATACCTACATTGGTGGCAGGTTAATTCAGACA

[0039] CAATCGACCACGTTAACGGCAAGCGTTAACGCAGACAGTCTGAAACCGTACTTCACAGGATTTACTTTAA

[0040] CGGACGCAAATGCAACGACTCAAAGGATAATTCCAGAGCCAACACATTTCGTGTCCATAATGTCGCTTGT

[0041] GAAAGTTACATTCAACGGAGCGCAGCCCCGAAACGGGGCTACAATAGATGGGTACTATGCTGAAATCGTT

[0042] AGGGCAAATAATTCTATTACAGAAAACGGCGGGGTGTTGCGTGAGGTATCTGTCAATAAAGACACTCAAA

[0043] TGACATTAAGAGGGAGAGTTCAAGACTCTCGTGGGATTTGGTCTGATTGGAAAGAGGTTAAAATAACTTT

[0044] TCTATTTTATTTCAGCCCAAATCTAAGCTTTGAAGTTACCAGAAGTGGCTCAAAGTCGGACACACTAACG

[0045] ATTAAGAGATACGCTAAAATAGCCCCGCTAGTTGTCAATGGTTCTCAAAGGAATATCATGAAACTTACTT

[0046] TTTCAACTGTTAAAGTTGGAATGGATAACTTTGTTGTTGACAACGGGCAGGCAGGCGGTGTATGGTCAAG

[0047] TATTTCAGAGTTTAACGCATCTAGTGCTAATCTAGGAAACACATACCCAGCCGATACTTCTTACATAGTC

[0048] AAAGGAAAACTAGAAGATAGTTTTTCAAGCACAGAGTTTCAGGACACAGTACCAACTGATAGGGTTGTTA

[0049] TGACCTATGATAAAAGCGGTGTCGGCATTGGGAAATATAGAGAGAATGGAGCGCTTGACGTCAACGGTGA

[0050] CATTTATGCTAATAATAGCCCAATCCAGCAGTACCAGCTAACTAGTAATAATGGATCTGCGAAATGGGTA

[0051] ACCAATGCAAATACCATACAAGACGCTGGACAATATTACCTATTCCCAGATGCCCCAGGAAACCCCAACA

[0052] AACAGTGGGGTCATCTATTCCATCACAGCAACTATGGAAAAGGTAGCATGTATAAAGAAGCTATTCAGAT

[0053] TTTTTGGGGGAACAACGGCCAACTATTCTTCAGGCATCACCGATGGTCGATGATAATTGACGATTGGGAG

[0054] CCGTGGAAGGAATTTGCAAGAAACGATAATCAAAATCTAATTAACACGGGCTGGCAACCAGCAGGATATG

[0055] AAGGCAGCTTTTACAAGCGCGTTGGAGATGTTCTGACAGTTAAATATAATTTTACGGGGGATGGGGGTAG

[0056] TATTGCCTTTGCAACGATACCGAAAGAAATCTTTACAGCCCCACAAGATTACATGTTTACCATTTCTGGT

[0057] TGGTCTATCTTTAACGATACTGACACTCACGCTCAAATTAACGATGGAAATAGCTCTATTTGGGCAGTTG

[0058] GTGCTAAAAACGGTGTTATATATCGAGGTCAACTAACAATTATGCTATAG can be found in the NCBIProtein database accession number. As a prostate cancer-specific biomarker, it has the characteristics of high sensitivity and strong specificity, avoiding overdiagnosis and overtreatment.

[0059] The first aspect of the present application provides a kit for detecting prostate, comprising:

[0060] The RT-RAA amplification system includes: an RT-RAA amplification stock solution and an RNA sample, the RT-RAA amplification system includes a T7 RNA polymerase at a concentration of 2-6 U / μL, which is used to mix with the RNA sample from the sample to be tested to prepare an RNA product;

[0061] Primer pairs and probes for preparing RNA products;

[0062] A fluorescent test strip, comprising three positions on the fluorescent test strip: a PCA3 test line, a PSA test line and a negative sample quality control line, wherein the PSA test line is coated with anti-PSA rabbit antibodies for binding to the PSA protein in the sample to be tested, the PCA3 test line is coated with anti-FITC rabbit antibodies labeled with fluorescent microspheres for binding to the target RNA in the RNA product, and the negative sample quality control line is coated with a Biotin ligand for binding to the antibody in the binding pad to determine whether the chromatography process is smooth.

[0063] Among them, the rabbit antibody against PSA can be sourced from: Thermo Fisher Scientific, catalog number: PA5-120742. The rabbit antibody against FITC labeled with fluorescent microspheres coated with PCA3 detection line can be sourced from: Sangon Biotech (Shanghai) Co., Ltd., catalog number: D110003-0100. The ligand Avidin of Biotin can be sourced from: Sangon Biotech (Shanghai) Co., Ltd., catalog number: A610068-0005.

[0064] The kit according to the embodiment of the present application is based on the recombinase mediated amplification (RT-RAA) technology. Primers and probes are designed for the conserved region of the PCA3 gene, and isothermal amplification technology is combined to develop a diagnostic kit that has both qPCR nucleic acid detection (gold standard) performance and antigen-antibody immunological detection that can be read by the naked eye, which is suitable for clinical testing and scientific research applications.

[0065] The RT-RAA extension system of the present application adopts a recombinase-mediated strand displacement nucleic acid amplification technology, which can perform specific exponential amplification of trace target DNA fragments under isothermal conditions. Under normal temperature, the recombinase and primer form a protein / single-stranded nucleotide complex; the complex invades the double-stranded DNA template with the help of auxiliary proteins and single-stranded binding proteins; a D-loop region is formed at the invasion site, and the DNA double strand begins to be scanned; when the primer searches for a complementary sequence that completely matches it on the template, the complex Rec / ssDNA disintegrates, and at the same time, the polymerase also binds to the 3' end of the primer to start chain extension. The synthesized new chain can be used as a template, and the final amplification product grows exponentially to complete the amplification of the target gene.

[0066] In addition, RAA amplification is performed on the sample to be tested, the PCA3 gene amplification sequence and PSA protein recognition are performed on the fluorescent test strip, and the fluorescent microspheres are labeled with antibodies against the FITC fluorescent group and anti-PSA antibodies; the C line is coated on the NC membrane with antibodies against FITC and anti-PSA antibodies; the T1 line is anti-biotin antibody, and the T2 line is anti-PSA antibody, so that a positive complex of anti-biotin antibody / biotin-target series-FITC / anti-FITC antibody-fluorescent microspheres will be formed on the T1 line, and a fluorescent microsphere-labeled antibody-PSA antigen-T line antibody complex will be formed on the T2 line.

[0067] The fluorescently labeled probe binds to the amplification product. When the probe is cleaved by the nuclease, it is amplified together with the biotin-labeled primer to form a fragment with fluorescent and biotin labels at both ends. At this time, it can be read using a fluorescent test strip.

[0068] In some embodiments, the RT-RAA amplification system comprises:

[0069]

[0070] In this embodiment, the T7 RNA polymerase in the RT-RAA amplification system is a DNA-dependent 5'→3' RNA polymerase that highly specifically recognizes the T7 promoter sequence. The high specificity of T7 RNA polymerase determines that it will only transcribe the DNA or DNA replica located downstream of the T7 promoter in the T7 phage. T7 RNA polymerase can selectively activate the transcription of the T7 phage promoter, and its speed of synthesizing mRNA is about 5 times faster than that of the RNA polymerase of ordinary Escherichia coli. Too little T7 RNA polymerase may result in low yield of transcription products, because insufficient enzyme may not be able to fully catalyze the reaction; if the transcription start fragment is short, the reaction may be inhibited, resulting in a transcription product shorter than the expected length. Excessive T7 RNA polymerase may result in too many transcription products, which is not easy for subsequent experimental operations and processing; in certain cases, such as the presence of a termination sequence similar to T7 RNA polymerase in the template, excessive enzyme may accelerate transcription termination, resulting in a transcription product length shorter than expected.

[0071] In some embodiments, the primer pair comprises:

[0072] PSA3-RAA-F (SEQ ID NO.2):5'-ACCGTTTAGTATGACCAGTG-3';

[0073] PSA3-RAA-R (SEQ ID NO. 3): 5'-ACATCATTGGCAGTCATAG-3'.

[0074] In this embodiment, biotin is labeled at the 5' end of the primer. Designing primers and probes in the conserved region of the PCA3 gene can effectively reduce the operation steps and time, improve the detection accuracy and efficiency, and facilitate on-site visual detection of prostate cancer.

[0075] The design requirements of primer probes are: no consecutive identical bases, such as TTT, GGG; no mismatch at the 3' end; GC% is between 40% and 60%; 3' cannot end with A, etc. Due to the differences in gene sequences themselves, it is generally difficult to adjust to meet all the principles, but the first few pairs of primers given by the system can be adjusted to meet the above principles as much as possible.

[0076] In some embodiments, the probe comprises PSA3-RAA-P (SEQ ID NO. 4): FITC-ATAGAGTTGAAACTCTACAC-Biotin-Spacer3.

[0077] According to the embodiment of the present application, the THF site on the probe can be cleaved by a nuclease, the 5' end carries a fluorescent group (FITC), and the 3' end is modified with a quencher (Biotin) so that it cannot be extended; when the probe is paired with a target DNA product amplified by a primer labeled with biotin at the 5' end, the nuclease cleaves the probe to form a free 3'-OH, which can be used as a primer to continue to extend and synthesize a daughter target DNA sequence; thus, the daughter target DNA sequence will carry both the FITC fluorescent group and biotin. Therefore, the daughter target sequence will carry both the FITC fluorescent group and biotin.

[0078] The fluorescent marker is an antibody with an anti-FITC fluorescent group; the C line coated on the NC membrane is an anti-FITC antibody; the T line is an anti-biotin antibody, so that a positive complex of anti-biotin antibody / biotin-target series-FITC / anti-FITC antibody-fluorescent microspheres will be formed on the T line. Fluorescein isothiocyanate (FITC) has a relatively high activity. Generally speaking, it is easier to introduce this fluorescent group than other fluorescent groups during solid phase synthesis, and no activation reagent is required during the reaction. In this reaction system, FITC will be used instead of the conventional FAM fluorescent group.

[0079] In some embodiments, the fluorescent test strip includes a conjugate pad and a chromatographic membrane arranged in a stacked manner, wherein the conjugate pad contains a rabbit-derived anti-FITC antibody and a rabbit-derived anti-PSA antibody labeled with fluorescent microspheres, which are used to bind to the target RNA in the RNA product and to bind to the PSA protein in the sample to be tested, respectively. When the rabbit-derived anti-FITC antibody and the rabbit-derived anti-PSA antibody labeled with fluorescent microspheres bind to the target RNA in the RNA product, the PCA3 detection line of the chromatographic membrane develops color; when the rabbit-derived anti-PSA antibody binds to the PSA protein in the sample to be tested, the PSA detection line of the chromatographic membrane develops color;

[0080] In some embodiments, the fluorescent test strip comprises: a bottom plate, a sample pad, a conjugation pad, a chromatography membrane and a water absorbent pad, wherein the sample pad, the conjugation pad, the chromatography membrane and the water absorbent pad are fixed on the bottom plate in sequence.

[0081] In some embodiments, the preparation process of the fluorescent detection test strip includes:

[0082] 1. Microsphere coupling: Wash the microspheres: Take 50 μL (concentration: 1 μmol / L, particle size: 110 nm) of microspheres and add them to a centrifuge tube containing 500 μL of activation buffer. After thorough mixing, centrifuge to remove the supernatant (centrifugation conditions: 4°C, 12000r, 20min). Avoid light during the operation.

[0083] 2. Activate the microspheres: add 500 μL activation buffer. Mix thoroughly. If agglomeration is found, perform ultrasonic treatment for 5 minutes. Then add 2 μL of EDC mother solution and Sulfo-NHS mother solution respectively. After thorough mixing, slowly tilt and rotate at room temperature to incubate the reaction for 15 minutes, and remove the supernatant by centrifugation (centrifugation conditions: 4°C, 12000r, 20min). The activation buffer in the microsphere coupling process is 20mM MES buffer, pH=6.5. Crosslinker mother solution: prepare 20mg / ml EDC and Sulfo-NHS respectively with activation buffer (prepared and used immediately). The crosslinking / washing buffer is 20mM boric acid buffer, pH=7.0, the blocking agent is 10% (w / v) BSA dissolved in 20mM boric acid buffer, pH=7.0, and the storage buffer is 20mM boric acid buffer, pH=8.0, containing 0.1% (w / v) BSA and 0.1% Tween 20.

[0084] 2. Microsphere-antibody coupling: Add 500μL cross-linking / washing buffer. Mix thoroughly. If agglomeration is found, ultrasonic treatment can be performed for 5 minutes. Add 20μg antibody, mix thoroughly, and slowly tilt and rotate at room temperature for 2 hours. Block microspheres: Add 55μL blocking agent, mix thoroughly, and slowly tilt and rotate at room temperature for 30 minutes. Centrifuge to remove the supernatant (centrifugation conditions: 4℃, 12000r, 20min). Wash the conjugate: Add 500μL cross-linking / washing buffer. Mix thoroughly. If agglomeration is found, ultrasonic treatment can be performed for 5 minutes. Centrifuge to remove the supernatant (centrifugation conditions: 4℃, 12000r, 20min). Repeat the washing three times. This step is combined with anti-FITC rabbit antibody and anti-PSA rabbit antibody, and then sprayed onto the conjugate pad using a membrane sprayer.

[0085] 3. Conjugate storage: Add 50 μL storage buffer. Store at 4°C, usually avoid freezing.

[0086] 4. Preparation of reaction membrane: Prepare reaction membrane streaking liquid, which is 25mM phosphate buffer pH=7.4, containing 1% sucrose and 0.85% NaCl; C line 1mg / mL, T1 line and T2 line 1.5mg / mL respectively, use streaking sprayer to prepare reaction membrane, set relevant parameters (spraying volume: 0.1μL / mm), leave at room temperature until the streaking liquid on the NC membrane disappears, and then put it in a blast drying oven at 37±2℃ for 24 hours;

[0087] 5. Preparation of binding pad: Take a blank glass fiber and put it into the soaking tray, and pour the binding pad pretreatment solution at a dosage of 50 mL / sheet. During the preparation of the binding pad, the binding pad pretreatment solution is 0.2 mM BB buffer pH = 7.4, containing 10% BSA, 40% sucrose and 10% Tween 20; the amount of sample pad pretreatment solution can be adjusted according to the size of the glass fiber to ensure that the glass fiber is completely immersed in the liquid, and use a tweezer to gently push away the bubbles so that it is evenly spread left and right and up and down. After each sample pad is evenly spread, soak it for 1 minute and then take it out. The glass fiber treated with the treatment solution is transferred to a drying oven for forced drying at 37±3℃ for more than 4 hours, and then transferred to an aluminum foil bag or a desiccator at room temperature for storage. Cut the corresponding amount of glass fiber (8mm*30cm / strip), place the cut glass fiber on the steel mesh, use the spray film marking instrument to spray the film, put the sprayed bonding pad in a blast drying oven at 37±2℃ to dry for 4-6 hours or put it in a vacuum drying oven at 37±2℃ to dry for 3 hours;

[0088] 6. Sample pad preparation: Take a blank glass fiber and put it into the soaking tray, and pour the sample pad pretreatment solution at a dosage of 50mL / sheet. During the sample pad preparation process, the sample pad pretreatment solution is: 25mM Tris-HCl buffer pH=8.0; the amount of sample pad pretreatment solution can be adjusted according to the size of the glass fiber to ensure that the glass fiber is completely immersed in the liquid, and use a tweezer to gently push away the bubbles so that it is evenly spread left and right and up and down. After each sample pad is evenly spread, soak it for 1 minute and then take it out. Transfer the glass fiber treated with the treatment solution to a drying oven for forced drying at 37±3℃ for more than 4 hours (the drying time is related to the amount of the sample pad), and store it in an aluminum foil bag or a desiccator at room temperature.

[0089] In some embodiments, the concentration of the T7 RNA polymerase in the RT-RAA amplification system is 5 U / μL.

[0090] In some embodiments, the kit further comprises a cell lysis buffer; the cell lysis buffer comprises: Tris HCl: 40-60 mM; MNaCl: 120-180 mM; EDTA: 0.8-1.5 mM; EGTA: 0.8-1.5 mM; IGEPAL CA-630: 0.8%-1.5%; pH: 7-8.

[0091] Method of using the kit of this application:

[0092] Step 1, configuration of RT-RAA amplification system, adding loading buffer, re-dissolving the freeze-dried microspheres for use; the loading buffer includes 10-50mM Tris-HCl buffer (pH8.0-8.5), 5-10mM MgCl2, and 0.1-0.5mg / mL BSA in terms of mass percentage.

[0093] Step 2, extract genomic RNA from the blood sample to be tested: collect 2 mL of blood using a BD tube (the capacity of the BD tube is 2.5 mL) and store it. The operation method is described in the instructions of the extraction kit. For example, the Fanzhi Biological Whole Blood Total RNA Extraction Kit can be used. Mix the sample and cell lysis buffer in a ratio of 1:1 and incubate at room temperature for 10 minutes;

[0094] Step 3, amplification and detection of samples: using the RNA obtained in the above step as a template and the RT-RAA designed in step 1 as a primer pair for isothermal amplification, 100 μL of RNA was dripped into the reaction system and reacted at 35°C for 15 minutes to obtain the RT-RAA amplification product, also known as the RNA product;

[0095] Alternatively, steps 1-3 may use a direct amplification technique of the blood sample to be tested without extraction, such as the amplification technology of Fanzhi Biotechnology.

[0096] Step 4, add 200ul of RT-RAA product to the fluorescent test strip for chromatography; test under ultraviolet light or using an immunofluorescence analyzer, if red strips appear on the PCA3 test line on the fluorescent test strip and red strips appear on the PSA test line, and red strips appear at the negative sample quality control line position, it indicates that the sample to be tested is positive++; if red strips appear on the PCA3 test line on the fluorescent test strip and red strips appear on the PSA test line, and red strips appear at the negative sample quality control line position, it indicates that the sample to be tested is positive+.

[0097] If no red strip appears on the PCA3 test line or the PSA test line on the fluorescent test strip, that is, no red strip appears on both test lines, and a red strip appears at the negative sample quality control line, it means that the sample to be tested is negative;

[0098] Furthermore, a grayscale meter may be used to perform quantitative detection on the test result of step 4.

[0099] According to the reaction system, a reaction mixture containing water, upstream primers, downstream primers, probes, T7 RNA Polymerase, and NTP Buffer Mix is ​​prepared, mixed evenly, and added to the detection unit tube containing nucleic acid amplification reagents. The tissue fluid of the sample to be tested is used as a template, and RAA amplification is performed on it using RT-RAA amplification primers to obtain RAA amplification products. After the reaction is completed, the reaction system liquid is diluted with sterile water or PBS and detected using a fluorescent detection test strip. The expression of the target gene in the tissue fluid can be quickly determined by immunofluorescence detection.

[0100] In summary, the kit for detecting prostate of the present application has the following advantages:

[0101] The beneficial effects of the present invention are as follows: (1) The detection kit of this project is based on the characteristics of portability of immunological detection; the method has the advantages of short detection time, higher detection precision, high sensitivity, low cost and short time consumption, so that the detection method is further optimized, and accurate and rapid large-scale gene screening can be carried out, which brings great convenience to medical staff and patients;

[0102] (2) The detection of the present invention adopts an isothermal reaction at 35°C. Compared with the PCR technology required for conventional nucleic acid detection, the isothermal condition enables the RT-RAA reaction to get rid of the dependence on heating-related instruments and equipment such as PCR instruments, and complete the nucleic acid amplification reaction in a short time, which has the characteristics of simple operation and rapidity; Rapid reaction: RT-RAA technology can achieve specific binding of primers and templates under constant temperature conditions, thereby achieving amplification of target sequences, and this technology greatly shortens the time required for the amplification process, meeting the requirements of rapid detection;

[0103] (3) Through the lateral flow test strip method, visual detection can be achieved, which is convenient, fast, accurate and reliable. If a red strip appears on the PCA3 test line or the test line, the PSA test line, or both the test line and the negative sample quality control line on the fluorescent test strip: the test sample contains a high copy number of the PCA3 gene and the PSA antigen, indicating a high risk of prostate cancer;

[0104] (4) The detection method of the present invention does not require large-scale instruments and equipment, and can react at a constant temperature. The results can be read by the naked eye and are suitable for large-scale screening.

[0105] The following examples more specifically describe the disclosure of the present application, which are intended for illustrative purposes only, as it will be apparent to those skilled in the art that various modifications and variations are possible within the scope of the disclosure of the present application. Unless otherwise stated, all parts, percentages, and ratios reported in the following examples are by weight, and all reagents used in the examples are commercially available or synthesized according to conventional methods and can be used directly without further processing, and the instruments used in the examples are commercially available.

[0106] Example 1

[0107] This embodiment provides a kit for detecting prostate, comprising:

[0108] The RT-RAA amplification system includes: an RT-RAA amplification stock solution and an RNA sample, the RT-RAA amplification system includes a T7 RNA polymerase at a concentration of 2-6 U / μL, which is used to mix with the RNA sample from the sample to be tested to prepare an RNA product;

[0109] Primer pairs and probes for preparing RNA products;

[0110] A fluorescent test strip, comprising three positions on the fluorescent test strip: a PCA3 test line, a PSA test line and a negative sample quality control line, wherein the PSA test line is coated with an anti-PSA rabbit antibody (source: Thermo Fisher Scientific, catalog number: PA5-120742), which is used to bind to the PSA protein in the sample to be tested, the PCA3 test line is coated with an anti-FITC rabbit antibody labeled with fluorescent microspheres (source: Sangon Biotech (Shanghai) Co., Ltd., catalog number: D110003-0100), which is used to bind to the target RNA in the RNA product, and the negative sample quality control line is coated with a ligand of Biotin, Avidin (source: Sangon Biotech (Shanghai) Co., Ltd., catalog number: A610068-0005), which can bind to the antibody in the binding pad and is used to determine whether the chromatography process is smooth;

[0111] Primers and probe: PSA3-RAA-F: 5'-ACCGTTTAGTATAGACCAGTG-3'; PSA3-RAA-R: 5'-ACTTATTACCCAGTTTCTC-3'; PSA3-RAA-P: FITC-ATAGAGTTGAAACTCTACACA(THF)A-Biotin-Spacer3.

[0112] Materials: Blood samples to be tested, PCA3 RNA+PSA protein fluorescent test strips, quality control products prepared with pure PSA protein, quality control products prepared with PCA3 plasmid, and identified samples.

[0113] How to use the prostate kit:

[0114] Extract genomic RNA from the sample to be tested: Collect 2 mL of blood (BD tube capacity is 2.5 mL) using a BD tube (whole blood RNA tube) and store it. For the operation method, refer to the product manual. Mix the sample and cell lysis buffer in a 1:1 ratio and incubate at room temperature for 10 minutes.

[0115] Isothermal amplification reaction: According to the reaction quantity, a reaction mixture containing water, upstream primers, downstream primers, probes, T7 RNA Polymerase, and NTP Buffer Mix is ​​prepared according to the reaction system. After mixing evenly, it is added to the detection unit tube containing nucleic acid amplification reagents. The tissue fluid of the sample to be tested is used as a template. RAA amplification is performed at 35°C using RT-RAA amplification primers to obtain RAA amplification products.

[0116] RT-RAA reaction system:

[0117] Reagent name Reagent concentration Upstream primer 10mol / L Downstream primer 10mol / L TaqMan Probes 50μmol / L T7 RNA Polymerase 5U / μL NTPBufferMix 23.5g / L RNA samples 50％

[0118] Add 200ul of RT-RAA product onto a fluorescent test strip and perform chromatography; test under ultraviolet light or using an immunofluorescence analyzer.

[0119] Example 2

[0120] The difference between this embodiment and embodiment 1 is that the types of primers and probes are different, specifically: PSA3-RAA-F (SEQ ID NO.5): 5'-TTGCTTCACATCCCAGGCTT-3'; PSA3-RAA-R (SEQ ID NO.6): 5'-TTTCATGGTGAGTGCGCTTT-3'; PSA3-RAA-P (SEQ ID NO.7): FITC-CCGTCCCTTGGAGTATCATAG(THF)A-Biotin-Spacer3.

[0121] Example 3

[0122] The difference between this embodiment and embodiment 1 is that the types of primers and probes are different, specifically: PSA3-RAA-F (SEQ ID NO.8): 5'-ACCGTTTAGTATGACCAGTG-3'; PSA3-RAA-R (SEQ ID NO.9): 5'-ACATCATTGGCAGCTCATAG-3'; PSA3-RAA-P (SEQ ID NO.10): FITC-ATAGAGTTGAAACTCTACA(THF)C-Biotin-Spacer3.

[0123] Primer detection:

[0124] Through the analysis of primers, the results shown in Table 1 were obtained.

[0125] Table 1

[0126]

[0127] The CG ratio of the upstream primer of the first primer is 45.0%, but the CG ratio of the downstream primer is 35.0%. The same bases appear in the primers, and the Tm values ​​are 53.7 / 50.2, which are quite different from 58. Although the GC% of the second primer is between 40% and 60%, and the Tm values ​​are 60.4 and 59.1, which are close to 58, there is a mismatch at the 3' end, and the same bases still appear in the primers. The upstream primer of the third primer has continuous identical bases, no mismatch at the 3' end, and does not end with A. The GC% is 45.0%, which is between 40% and 60%.

[0128] After testing, the relative deviations were all within 10%, and the test results were considered accurate. The detection accuracy of Example 1 was 83.1%, the detection accuracy of Example 2 was 74.3%, and the detection accuracy of Example 3 was 95.3%. The detection result of Example 3 was higher, and the primer set and probe of Example 3 had better effects.

[0129] Experimental Example 4

[0130] The difference between this embodiment and embodiment 1 is that the RT-RAA amplification system is different and the amount of T7 RNA Polymerase added is different.

[0131] The amount of T7 RNA polymerase was designed to be 2U / μL, 3U / μL, 4U / μL, 5U / μL, and 6U / μL. The experimental results are shown in Table 2 and Figure 1 shown.

[0132] Table 2

[0133]

[0134] from Figure 1 The results show that the amount of T7 RNA polymerase is insufficient below 5U / μL. As the amount of enzyme increases, the ability to synthesize long-fragment RNA is effectively improved. The synthesized RT-RAA amplification product is quantitatively detected by the test strip using a fluorescent quantitative detector, and the accuracy is getting closer and closer to the target value. However, when the amount of T7 RNA polymerase is greater than 5U / μL, the excess enzyme may cause competition for substrate NTP in the reaction system, affecting the transcription efficiency and product quality. Therefore, the accuracy deviates from the target value and shows a downward trend. In summary, the appropriate use of T7 RNA polymerase is crucial for obtaining high-quality RNA products. When the amount of RNA is sufficient and the temperature, time and other conditions are reasonable, the selection of 5U / μL T7 RNA polymerase can effectively improve the transcription efficiency and product quality.

[0135] Implementation 5

[0136] The difference between this embodiment and embodiment 1 is that the contents of the components of the cell lysate are different, as shown in Table 3.

[0137] Table 3

[0138]

[0139]

[0140] Implementation 6

[0141] The difference between this embodiment and embodiment 1 is that the contents of the components of the cell lysate are different, as shown in Table 4.

[0142] Table 4

[0143]

[0144] According to the experimental test, the detection accuracy of Example 5 is 93.5%, and the detection accuracy of Example 6 is 96.7%. The accuracy of Example 5 or Example 6 is better.

[0145] Kit performance test

[0146] 1. Accuracy determination: Using the kit of Example 1, YY_T 1163-2009 Total prostate specific antigen (t-psa) quantitative determination reagent (kit), PSA pure protein was diluted with physiological saline to a PSA concentration of 40 ng / mL and 100 ng / mL, and tested three times. The average values ​​obtained by the test were 41.5 and 104.2, and the relative deviations were within 10%, which met the requirements of the industry standard. Figure 3 shown.

[0147] 2. Determination of the minimum detection limit: dilute the low-concentration PSA pure protein with physiological saline and measure it 25 times. The result is LOD = 0.7, which is less than 1.0, which meets the requirements of the industry standard. Figure 4 shown.

[0148] 3. Linear relationship: PSA pure protein was diluted with physiological saline, and the dilution multiples were H, 4H+1L, 3H+2L, 2H+3L, 1H+4L, and L, where H represents high-concentration PSA protein and L represents low-concentration PSA protein. The high and low concentrations were matched linearly. Each concentration was tested twice, and the linear correlation coefficient R=0.9992 was measured, which was greater than 0.9900 and met the industry standard requirements, as shown in Table 5 and Figure 5 The theoretical concentration d in Table 5 is in ng / ml.

[0149] Table 5

[0150] Theoretical concentration Dilution ratio 1 2 3 Mean 105.8 H 105.4 106.3 105.6 105.8 84.6 4H+1L 80.6 82.3 80.1 81.0 63.5 3H+2L 60.9 61.3 60.5 60.9 42.3 2H+3L 43.1 40.6 43.3 42.3 21.2 1H+4L 18.7 18.3 19.6 18.9 0.0 L 0.0 0.0 0.0 0.0

[0151] 4. Repeatability determination: Use physiological saline to dilute PSA pure protein to PSA concentration of 4.0ng / mL and 30.0ng / mL, test 10 times, the CV obtained from the test is 3.88% and 1.89% respectively, less than 10%, which meets the requirements of the industry standard. Figure 6 shown.

[0152] 5. Batch difference: The same quality control product was used to test 3 batches of test strips. The relative range of the test mean was 6.29%, which is less than 10% and meets the industry standard requirements.

[0153] 6. Specificity and necessity verification test of test strip components: Take ten PCA3 RNA + PSA protein fluorescent test strips to be tested, insert the sample end of the test strip into the PCA3 negative control and positive control products, PSA negative control and positive control products respectively to detect specificity, let it stand, and observe under ultraviolet light. Within 30 minutes, all the control lines of the test strips are positive, and the test lines are negative or positive. Figure 7-10 shown.

[0154] Figure 7 The test strip indicates that in the absence of PSA and PCA3, only the C line will appear on the test strip. Figure 8 , 9 The test strip indicates that when the amplified product of the PSA gene or the PCA3 gene is present, T-PSA or T-PCA3, respectively, will be visible on the test strip. Fig.10 The test strip indicates that both T-PSA and T-PCA3 are visible in the presence of both PSA and PCA3. The above results show that the test strip has sufficient specificity for detecting both PSA and PCA3 genes at the same time, so there will be no cross reaction.

[0155] The detection accuracy of the kit of Example 1 was verified by using samples that have been diagnosed with prostate cancer and samples from healthy people. First, 7 prostate cancer samples that were confirmed to express the PCA3 gene by RT-qPCR and 1 sample from a healthy person were selected. Then, the above samples were tested using the prostate cancer dual gene test strips. Fig.11 As shown, from left to right, there is 1 negative case, 6 weakly positive cases, and 1 positive case, which is consistent with the known results.

[0156] Although the present application has been described with reference to preferred embodiments, various modifications may be made thereto and parts thereof may be replaced with equivalents without departing from the scope of the present application. In particular, the various technical features mentioned in the various embodiments may be combined in any manner as long as there is no structural conflict. The present application is not limited to the specific embodiments disclosed herein, but includes all technical solutions falling within the scope of the claims.

Claims

1. A kit for detecting prostate, comprising: The RT-RAA amplification system includes: an RT-RAA amplification stock solution and an RNA sample, the RT-RAA amplification system includes a T7 RNA polymerase at a concentration of 2-6 U / μL, which is used to mix with the RNA sample from the sample to be tested to prepare an RNA product; Primer pairs and probes for preparing RNA products; A fluorescent test strip, comprising three positions on the fluorescent test strip: a PCA3 test line, a PSA test line and a negative sample quality control line, wherein the PSA test line is coated with an anti-PSA rabbit antibody for binding to the PSA protein in the sample to be tested; the PCA3 test line is coated with an anti-FITC rabbit antibody labeled with fluorescent microspheres for binding to the target RNA in the RNA product, and the negative sample quality control line is coated with Avidin, a ligand of Biotin, for judging whether the chromatography process is smooth.

2. The kit according to claim 1, characterized in that The primer pair comprises: PSA3-RAA-F:5'-ACCGTTTAGTATGACCAGTG-3'; PSA3-RAA-R:5'-ACATCATTGGCAGTCATAG-3'.

3. The kit according to claim 1, characterized in that The probe includes PSA3-RAA-P:FITC-ATAGAGTTGAAACTCTACAC-Biotin-Spacer3.

4. The kit according to claim 1, characterized in that The fluorescent test strip comprises a stacked binding pad and a chromatographic membrane, wherein the binding pad contains an anti-FITC rabbit antibody and an anti-PSA rabbit antibody labeled with fluorescent microspheres, which are respectively used to bind to the target RNA in the RNA product and to bind to the PSA protein in the sample to be detected. When binding to the target RNA in the RNA product, the PCA3 detection line of the chromatographic membrane develops color; when the anti-PSA rabbit antibody binds to the PSA protein in the sample to be detected, the PSA detection line of the chromatographic membrane develops color.

5. The kit according to any one of claims 1 to 4, characterized in that The concentration of the T7 RNA polymerase in the RT-RAA amplification system is 5 U / μL.

6. The kit according to claim 1, characterized in that The kit also includes a cell lysis buffer; the cell lysis buffer includes: Tris HCl: 40-60mM; MNaCl: 120-180mM; EDTA: 0.8-1.5mM; EGTA: 0.8-1.5mM; IGEPAL CA-630: 0.8%-1.5%; pH: 7-8.

Images