Marker for differential diagnosis of tuberculosis patients and application thereof
By studying the expression profile of circRNAs in PBMCs of tuberculosis patients, it was found that hsa_circ_0052124, as a biomarker, can effectively distinguish between tuberculosis patients and healthy people, solve the problem of insufficient sensitivity and specificity of existing diagnostic techniques, and achieve rapid and accurate tuberculosis diagnosis.
Patent Information
- Application Number
- CN202510227321.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-27
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2045-02-27
AI Technical Summary
The existing tuberculosis diagnosis technology has insufficient sensitivity and specificity, complex detection process and time-consuming, especially in areas with limited resources, which is difficult to implement effectively, and cannot meet the needs of early active screening.
By studying the expression profile of circRNAs in PBMCs of tuberculosis patients, it was found that the relative expression of hsa_circ_0052124 in tuberculosis patients was significantly reduced, and this circRNA was developed as a biomarker for differential diagnosis of tuberculosis patients.
The detection method of this biomarker is simple and fast. It only requires peripheral blood samples. The report results are fast and accurate. It can effectively distinguish between tuberculosis patients and healthy people. It has a sensitivity of 90% and a specificity of 100%.
Smart Images

Figure BDA0005290461010000071 
Figure BDA0005290461010000081 
Figure BDA0005290461010000091
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and specifically relates to a marker for differential diagnosis of tuberculosis patients and an application thereof. Background Art
[0002] Tuberculosis is an infectious disease caused by Mycobacterium tuberculosis (M.tb) that seriously endangers human health and is a major threat to the global public health system. The 2024 Global Tuberculosis Report shows that in 2023, there will be 10.8 million new cases of tuberculosis, 8.2 million confirmed cases, and 1.25 million deaths worldwide. The situation of tuberculosis prevention and control remains severe. The diagnosis of tuberculosis currently relies mainly on bacteriology and molecular biology detection technologies (Industry Guidelines for Diagnosis of Pulmonary Tuberculosis, WS-288-2017). In countries with a high burden of tuberculosis, smear microscopy is widely used, but it is labor-intensive, has low sensitivity, and cannot rule out nontuberculous mycobacterial infection (Zhang Wei et al., Research Progress in Laboratory Diagnostic Methods and Detection Technologies for Mycobacterium tuberculosis Infection, International Journal of Respiratory Diseases, 2019, 39: 1586-1591); sputum culture is the gold standard for diagnosing tuberculosis. Even if a relatively rapid liquid culture method (such as modified Roche medium) is used to culture Mycobacterium tuberculosis, a positive result takes at least 2 weeks to obtain, and a negative result takes about 45 days to report, thus affecting the efficiency of early diagnosis and treatment (Pai M, Schito M. Tuberculosis diagnostics in 2015: landscape, priorities, needs, and prospects [J]. J Infect Dis, 2015, 211 (Suppl 2): S2l-S28.); in recent years, molecular biology technology has developed rapidly, and GeneXpert MTB / RIF technology has the advantage of rapid diagnosis (Nathakorn Pongpeeradech, Yuthichai Kasetchareo et al. "Evaluation of the use of GeneXpertMTB / RIF in a zone with high burden of tuberculosis in Thailand." PLoS ONE (2022).), and its detection sensitivity and specificity are better than traditional bacteriological detection methods, but this technology has high requirements for the quality of sputum specimens and the biosafety of infrastructure and detection environment, and its popularity in primary hospitals and general hospitals is limited. Other immunological tests, such as tuberculosis antigen or antibody tests, have limited detection capabilities. In addition, the results of the tuberculin test and the gamma-interferon release experiment cannot distinguish between active tuberculosis and latent infection. Imaging technology-assisted diagnosis of tuberculosis is similar to the imaging manifestations of other lung diseases and has low specificity. In order to control the spread of tuberculosis, the World Health Organization (WHO) also recommends early active screening of suspected tuberculosis patients, but existing diagnostic technologies are far from meeting clinical needs.
[0003] Biomarkers can reflect disease status, risk of progression, biological effects after treatment, therapeutic effects and prognosis assessment, and play an important role in disease diagnosis, treatment and prevention, providing a key basis for the development of new anti-tuberculosis drugs and vaccines. In response to this situation, WHO has developed a target product profile (TPP), a set of standards for defining the key characteristics that an ideal diagnostic tool should have (Sarah C Charnaud, V. Moorthy et al. "WHO target product profiles to shape global research and development." Bulletin of the World Health Organization (2023).). According to the TPP standard, the sensitivity of smear-positive tuberculosis should be no less than 98%, and the sensitivity of smear-negative tuberculosis should be above 68%, while the specificity should be maintained above 98%. For tuberculosis diagnostic tools, WHO has set a target of 65% sensitivity and 98% specificity. In terms of tuberculosis screening performance, the sensitivity of active tuberculosis screening should be no less than 90% and the specificity should be no less than 70% (High-priority target product profiles for new tuberculosis diagnostics: report of a consensus meeting. Geneva: World Health Organization, 2014.; M. Correia-Neves, Gabrielle et al. "Biomarkers for tuberculosis: the case for lipoarabinomannan." ERJ Open Research (2019). TPP emphasizes the use of non-sputum samples for testing and requires that the detection method is simple and rapid, suitable for use in resource-limited areas. Therefore, finding new tuberculosis biomarkers that are stably expressed in non-sputum samples is of great significance for improving the existing diagnostic system and enhancing diagnostic efficiency.
[0004] Circular RNAs (circRNAs) are a new type of non-coding RNA that does not have a 5' end cap and a 3' end poly (A) tail, and forms a circular structure with covalent bonds. CircRNAs have tissue specificity and spatiotemporal specificity. The expression levels of circRNAs vary between different tissues. The expression levels of circRNAs in the same tissue or organ will also change at different growth stages. CircRNAs can regulate gene expression from multiple levels such as chromatin remodeling, transcriptional regulation, and post-transcriptional processing, and their mechanisms of action are diverse.
[0005] Unlike traditional non-coding RNAs, circular RNA molecules are closed circular structures and are more stable than linear RNAs because they are insensitive to nucleases (Zhongrong Zhang, Tingting Yang et al. "Circular RNAs: Promising Biomarkers for Human Diseases." EBioMedicine (2018).). This stability makes circular RNA easy to detect in body fluids (such as blood, urine, saliva, etc.), and has high reliability in disease diagnosis. Circular RNAs are significantly expressed in specific tissues or cell types (Sebastian Memczak, P. Papavasileiou et al. "Identification and Characterization of Circular RNAs As a New Class of Putative Biomarkers in Human Blood." PLoS ONE (2015).), show high conservation among different species, and can be detected through non-invasive samples such as peripheral blood (Souvick Roy, M. Kanda et al. "Diagnostic efficacy of circular RNAs as noninvasive, liquid biopsy biomarkers for early detection of gastric cancer." Molecular Cancer (2022).), which facilitates early diagnosis and real-time monitoring. Therefore, for tuberculosis, the development of suitable specific circRNAs as markers has important research and clinical significance in regulating gene transcription and as disease diagnostic markers. Summary of the invention
[0006] The present invention studied and analyzed the circRNAs expression profile of PBMC of tuberculosis patients, and found that the relative expression of hsa_circ_0052124 in tuberculosis patients was significantly lower than that in healthy people, which can effectively distinguish tuberculosis patients from healthy people. Based on this, the present invention was completed.
[0007] In a first aspect, the present invention provides a biomarker for differential diagnosis of tuberculosis patients, wherein the biomarker is hsa_circ_0052124, wherein the nucleotide sequence of hsa_circ_0052124 is as described in SEQ ID NO.1.
[0008] Furthermore, when the relative expression level of hsa_circ_0052124 in the subject's biological sample is ≤0.000783, the subject is a tuberculosis patient.
[0009] Furthermore, the biological sample of the subject is selected from blood.
[0010] Furthermore, the subject's blood sample is at least one of peripheral blood, plasma and / or serum.
[0011] In a second aspect, the present invention provides use of the marker described in the first aspect of the present invention in preparing a reagent for differential diagnosis of tuberculosis patients.
[0012] Furthermore, when the relative expression level of hsa_circ_0052124 in the subject's biological sample is ≤0.000783, the subject is a tuberculosis patient.
[0013] Furthermore, the biological sample of the subject is selected from blood.
[0014] Furthermore, the subject's blood sample is at least one of peripheral blood, plasma and / or serum.
[0015] In a third aspect, the present invention provides a kit for differential diagnosis of tuberculosis patients, wherein the kit contains a reagent for detecting the relative expression amount of the marker described in the first aspect.
[0016] Furthermore, when the relative expression level of hsa_circ_0052124 in the subject's biological sample is ≤0.000783, the subject is a tuberculosis patient.
[0017] Furthermore, the biological sample of the subject is selected from blood.
[0018] Furthermore, the subject's blood sample is at least one of peripheral blood, plasma and / or serum.
[0019] Furthermore, the kit may be one or more of a nucleic acid detection kit, an immunofluorescence kit, a gene chip detection kit, a molecular hybridization kit and / or an in situ hybridization staining kit.
[0020] Furthermore, the diagnostic method of the kit includes one or more of PCR method / qPCR method, linear probe method, high-resolution melting curve method and / or gene chip method.
[0021] Beneficial Effects
[0022] The biomarker applied in the present invention is easy to sample, only peripheral blood needs to be taken for detection, and the results are reported quickly. The biomarker applied in the present invention has high accuracy: the receiver operating characteristic curve (ROC) analysis shows that the area under the ROC curve is 0.976 (95% CI: 0.940-1.000, P < 0.0001), the sensitivity is 90% (95% CI: 73.5%-97.9%), and the specificity is 100% (95% CI: 88.4%-100.0%), which effectively distinguishes tuberculosis patients from healthy people. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 The diagnostic value of hsa_circ_0052124 in differential diagnosis of tuberculosis. DETAILED DESCRIPTION
[0024] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in the embodiments described below can be combined with each other as long as they do not conflict with each other.
[0025] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.
[0026] Explanation of terms
[0027] miRNeasy Mini Kit: It is a kit launched by Qiagen for extracting total RNA from various samples. miRNeasy Mini Kit is mainly used to extract total RNA, including miRNAs, mRNAs and rRNAs, from cells, tissues, plasma, serum and other samples. The main steps are: dissolve the sample in lysis buffer, add QIAzol Lysis Reagent for homogenization, and then separate RNA by centrifugation and ethanol precipitation; transfer RNA to a new column by vacuum filtration, and then obtain pure RNA through washing and elution steps.
[0028] Agilent expression profile chip: It is a high-throughput gene expression analysis platform that can detect gene expression levels across the entire genome. For example, the Agilent 4×44K chip can detect more than 41,000 probes, covering most regions of the human genome. In addition, Agilent also provides a variety of chip types, such as whole genome chips (such as SurePrint G3Human Gene Expression v2) and oligonucleotide chips (such as chips targeting specific genes or tissues) to meet different research needs.
[0029] Agilent Expression Array Kit: It is an important tool for gene expression analysis, with a wide range of applications, including cancer research, chronic stress research, inflammatory response analysis, and plant gene expression research.
[0030] Gene Expression Hybridization Kit: Mainly used for hybridization experiments of cDNA or RNA, and quantitative analysis of gene expression is achieved by combining with probes on microarray chips. For example, when studying human aging-related genes GCAT and SHMT2, the Gene Expression Hybridization Kit produced by Agilent Technologies was used for hybridization experiments, and combined with microarray scanning and data analysis tools (such as Agilent Feature Extraction software) for subsequent analysis.
[0031] Hybridization Oven: A device used in DNA hybridization experiments, mainly used to perform the binding reaction between DNA probes and target DNA or RNA at a specific temperature. This type of equipment usually has a constant temperature control function, which can maintain a stable temperature environment to ensure the efficient hybridization reaction.
[0032] Gene Expression Wash Buffer Kit: It is a kit used for the washing step in microarray experiments. Its main function is to wash the microarray chip after hybridization to remove unbound probes and other non-specifically bound molecules. Gene Expression Wash Buffer Kit contains two washing solutions: Gene Expression Wash Buffer 1 and Gene Expression Wash Buffer 2. These washing solutions usually contain a certain concentration of buffer and surfactant (such as Triton X-102) and are used to wash microarray chips at different stages.
[0033] Agilent Microarray Scanner: is a device used for microarray data analysis, widely used in gene expression analysis, miRNA analysis and other molecular biology research. It has multiple models, such as G2505B, G2506A and G2505C, which are widely used in different types of microarray experiments. Among them, the G2505B model is used for 4644K microarray scanning of Surescan technology; the G2506A model is used for scanning miRNA microarrays; and the G2505C model is used for a variety of experiments, including scanning miRNA microarrays and DNA microarrays.
[0034] Feature Extraction software 10.7 is a software developed by Agilent Technologies for microarray data analysis. This software is widely used for the extraction and analysis of gene expression data. FeatureExtraction software 10.7 is mainly used to extract data from microarray images. For example, in the analysis of circulating miRNAs, this software was used to extract raw data from images scanned by Agilent Microarray Scanner.
[0035] Quantile: It is an important concept in statistics used to describe the distribution characteristics of data. It divides the data into several equal parts in order of size, and each part is called a quantile interval. For example, quartiles divide the data into four equal parts, and the median can be regarded as a quantile (Q2). Quantile regression (QR) is a statistical modeling method based on quantiles. Unlike traditional mean regression (such as least squares method), it can characterize the impact of independent variables on dependent variables at different quantiles, thereby providing more comprehensive data analysis.
[0036] Agilent Human (4*180K) chip: one of the gene chip series produced by Agilent, mainly used to detect gene expression in the human genome or expression profile of miRNA. The chip adopts 4×180K probe design, which can cover a wide range of gene regions and is suitable for gene expression analysis of complex samples.
[0037] Receiver operator characteristic curve (ROC curve): A curve drawn with the true positive rate (sensitivity) as the ordinate and the false positive rate (1-specificity) as the abscissa. The area under the ROC curve (Area Under ROC Curve, AUC) is between 1.0-0.5. When AUC>0.5, the closer the AUC is to 1, the better the diagnostic effect. When AUC is between 0.5-0.7, it indicates a lower accuracy. When AUC is between 0.7 and 0.9, it indicates a certain accuracy. When AUC≥0.9, it indicates a higher accuracy. When AUC=0.5, it means that the diagnostic method is completely ineffective and has no diagnostic value. AUC<0.5 does not conform to the actual situation and rarely occurs in practice.
[0038] Example 1: Standards for elimination
[0039] A. Inclusion Criteria
[0040] 1) Tuberculosis patients: According to the industry standard "WS-288-2017 Diagnosis of Pulmonary Tuberculosis", patients with clinical symptoms of tuberculosis and chest imaging showing active pulmonary tuberculosis lesions are included, and one of the following conditions is met: positive sputum smear for Mycobacterium tuberculosis, positive culture for Mycobacterium tuberculosis, positive molecular biological detection for Mycobacterium tuberculosis, or positive histopathology is included.
[0041] 2) Healthy controls: no clinical symptoms of tuberculosis, no abnormal imaging examinations, negative tuberculosis-infected T cell tests, and no previous history of tuberculosis or contact with tuberculosis.
[0042] B. Exclusion criteria
[0043] Age <18 years, anti-TB treatment for more than 2 weeks.
[0044] C. Screening Queue
[0045] There were 9 healthy people who met the criteria; and 9 tuberculosis patients who met the criteria.
[0046] D. Verification Queue
[0047] There were 30 healthy people who met the criteria; and 30 tuberculosis patients who met the criteria.
[0048] Example 2 Screening Test
[0049] The screening cohort was selected for the screening trial.
[0050] (1) Experimental methods
[0051] A. Isolation of PBMCs from peripheral blood
[0052] Whole blood was collected, and the blood sample was diluted with culture medium after blood collection. After mixing, the sample density separation solution was added, and PBMCs were extracted by Ficoll density gradient centrifugation.
[0053] B. RNA extraction
[0054] According to the instructions of the miRNeasy Mini Kit, total RNA was extracted and the extracted total RNA was kept for later use after passing the electrophoresis quality inspection.
[0055] C.cRNA labeling
[0056] According to the instructions of the Agilent expression profile chip supporting kit, total RNA was amplified and labeled, and then the labeled cRNA was purified using the miRNeasy mini kit.
[0057] D. Chip hybridization
[0058] The hybridization was performed according to the standard hybridization procedure and kit provided by Agilent expression profile chip, Gene Expression Hybridization Kit instructions, in a rolling hybridization oven at 65°C, 10 rpm, for 17 hours, and the slides were washed in a washing tank using the Gene Expression Wash Buffer Kit.
[0059] E. Chip Scanning and Data Analysis
[0060] The hybridized chip was scanned by Agilent Microarray Scanner, and the software settings were Dye channel: Green, Scan resolution = 3 μm, PMT 100%, 20 bit. The data were read by Feature Extraction software 10.7, and finally normalized by limma package in R software, and the algorithm used was Quantile.
[0061] (2) Test results
[0062] Based on the microarray expression profile chip data, the top 25% of the expression profile data with higher median relative expression (including 21,880 circRNAs) were used for weighted gene co-expression network analysis (WGCNA) to establish a gene co-expression network and screen for gene modules significantly associated with tuberculosis. The genes in the module were further screened with module members (MM)>0.85 and gene significance (GS)>0.85 as screening conditions, and a total of 1,220 circRNAs were screened. Combined with the inter-group expression difference fold>4 or <0.25, inter-group difference P value<0.05, and the average relative expression of circRNA in any group>10 as screening criteria, a total of 9 significantly differentially expressed circRNAs were screened, including 8 down-regulated and 1 up-regulated circRNAs (Table 1).
[0063] Table 1. Analysis of 9 circRNA chip results
[0064]
[0065]
[0066] Note: P<0.05 is statistically significant. Fc, fold change
[0067] The sequence of hsa_circ_0052124 is as follows (SEQ ID NO.1):
[0068] hsa_circ_0052124|NM_018555:
[0069] GCCAGCATCCTTCAGAAAAAGCATCCCCGAGGAGGAAGACGAATCGTTAAACATCTGAAAGGGTCAGGCCAGCATCCTTCAGAAAAAGCATCCCGGAGGAGGAAGACGAATCGTTAAACATCTTAGGTCAG
[0070] Example 3 Verification Test
[0071] A validation cohort was selected for the validation trial.
[0072] (1) Test method
[0073] A. Design of primers for hsa_circ_0052124
[0074] The designed target primer sequences are as follows:
[0075] a. Upstream amplification primer: 5'-CGTTAAACATCTTAGGTCAGGCCA-3'
[0076] b. Downstream amplification primer: 5'-CCTTTCAGATGTTTAACGATTCGTC-3'
[0077] Reference gene for qPCR: GAPDH
[0078] circRNA chip: Agilent Human (4*180K) chip
[0079] First, the full-length sequence of circRNA was obtained through the circBase database, and the 3' end of the sequence was moved to the 5' end to include the splicing site information; then, Primer-BLAST was used to design primers to ensure that the primers spanned the splicing site, and the primer parameters were adjusted to meet the design requirements; finally, Primer-BLAST was used to verify the specificity of the primers to ensure that there was no nonspecific amplification, and optimization adjustments were made based on the verification results.
[0080] B. Isolation of PBMCs from peripheral blood
[0081] Whole blood was collected, and the blood sample was diluted with culture medium after blood collection. After mixing, the sample density separation solution was added, and PBMCs were extracted by Ficoll density gradient centrifugation.
[0082] C. RNA extraction
[0083] According to the instructions of the miRNeasy Mini Kit, total RNA was extracted and the extracted total RNA was kept for later use after passing the electrophoresis quality inspection.
[0084] D. Reverse transcription
[0085] 200 ng of RNA sample was reverse transcribed into cDNA using High Capacity cDNA Reverse Transcription Kits.
[0086] E.qPCR detection
[0087] Using PowerUp TM SYBR TM Green Master Mix was used for quantitative PCR with cDNA and primer mixture, and GAPDH was used as internal reference to calculate 2 -ΔCT , thereby determining the relative expression of genes.
[0088] (2) Test results
[0089] A. Relative expression of hsa_circ_0052124
[0090] RT-qPCR detection and inter-group difference verification were performed on 9 candidate differentially expressed circRNAs in 30 tuberculosis patients (TB group) and 30 healthy controls (HC group). Among them, the average relative expression of hsa_circ_0052124 in 30 tuberculosis samples (0.000441) was significantly lower than that in 30 healthy samples (0.002375), and the difference was statistically significant (P<0.0001), and was consistent with the expression trend in the expression profile of circRNAs microarray chip (Table 2 and Figure 1 ). The other eight circRNAs could not be verified due to low expression abundance or lack of specific primers.
[0091] Table 2. qPCR detection raw data (relative expression of hsa_circ_0052124)
[0092]
[0093]
[0094] B. ROC Curve
[0095] The receiver operating characteristic (ROC) curve was used to analyze the differential circRNA hsa_circ_0052124 in 30 tuberculosis patient samples and 30 healthy control samples.
[0096] like Figure 1 As shown, the area under the ROC curve was 0.976 (95% CI: 0.940-1.000, P < 0.0001), the sensitivity was 90% (95% CI: 73.5%-97.9%), and the specificity was 100% (95% CI: 88.4%-100.0%), which can effectively distinguish tuberculosis patients from healthy controls. The threshold was further determined to be 0.000783. When the relative expression of hsa_circ_0052124 was ≤ 0.000783, the subject was a tuberculosis patient.
Claims
1. A biomarker for differential diagnosis of tuberculosis patients, wherein the biomarker is hsa_circ_0052124, wherein The nucleotide sequence of hsa_circ_0052124 is as shown in SEQ ID NO.
1.
2. The biomarker for differential diagnosis of tuberculosis patients according to claim 1, when the relative expression level of hsa_circ_0052124 in the biological sample of the subject is ≤0.000783, the subject is a tuberculosis patient.
3. The biomarker for differential diagnosis of tuberculosis patients according to claim 1, wherein the biological sample of the subject is selected from blood, and the blood sample of the subject is at least one of peripheral blood, plasma and / or serum.
4. Use of the biomarker as claimed in claim 1 in preparing a reagent for differential diagnosis of tuberculosis patients.
5. Use of the biomarker as claimed in claim 4 in the preparation of a reagent for differential diagnosis of tuberculosis patients, when the relative expression level of hsa_circ_0052124 in the biological sample of the subject is ≤0.000783, the subject is a tuberculosis patient.
6. Use of the biomarker as claimed in claim 4 in the preparation of a reagent for differential diagnosis of tuberculosis patients, wherein the biological sample of the subject is selected from blood, and the blood sample of the subject is at least one of peripheral blood, plasma and / or serum.
7. A kit for differential diagnosis of tuberculosis patients, the kit comprising a reagent for detecting the relative expression amount of the biomarker according to claim 1.
8. The kit for differential diagnosis of tuberculosis patients as claimed in claim 7, wherein when the relative expression level of hsa_circ_0052124 in the biological sample of the subject is ≤0.000783, the subject is a tuberculosis patient.
9. The kit for differential diagnosis of tuberculosis patients according to claim 7, wherein the biological sample of the subject is selected from blood, and the blood sample of the subject is at least one of peripheral blood, plasma and / or serum.
10. A kit for differential diagnosis of tuberculosis patients as claimed in claim 7, wherein the kit can be one or more of a nucleic acid detection kit, an immunofluorescence kit, a gene chip detection kit, a molecular hybridization kit and / or an in situ hybridization staining kit; and the diagnostic method of the kit includes one or more of a PCR method / qPCR method, a linear probe method, a high-resolution melting curve method and / or a gene chip method.
Citation Information
Patent Citations
LPA-associated protein and RNA expression
CN106573030A
Application of hsa_circ_0008961 as gout diagnostic marker
CN112522391A
Tuberculosis diagnosis circRNA marker, primer and application thereof
CN116732165A
Application of LLGL2 gene as biomarker in differential diagnosis of tuberculosis
CN116987779A
CircRNA for pulmonary tuberculosis diagnosis and application thereof
CN118531107A