InDel molecular marker closely linked to major qtl of fruit shape index of pumpkin fruit and application thereof

By applying InDel molecular markers to pumpkin fruits, the problem of low efficiency in judging pumpkin fruit shape index was solved, achieving efficient and accurate fruit shape judgment during the seedling stage and improving the efficiency of pumpkin breeding.

CN120099206BActive Publication Date: 2025-11-04FOSHAN UNIVERSITY +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510269380.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-07
Publication Date
2025-11-04
Estimated Expiration
2045-03-07

AI Technical Summary

Technical Problem

In existing technologies, determining the fruit shape index of pumpkin fruits relies on data measurement and visual description of mature fruits, resulting in high consumption of manpower and resources and low efficiency during the planting process.

Method used

An InDel molecular marker closely linked to the major QTL of pumpkin fruit shape index was developed and located in the 426937-526389 region on chromosome 14 of the Chinese pumpkin genome. The InDel molecular marker was detected by PCR and genotyping was performed using amplification primers F and R to achieve efficient determination of fruit shape at the seedling stage.

Benefits of technology

It improves the efficiency of breeding for the appearance quality of pumpkin fruits, reduces the consumption of manpower and material resources in the planting process, and the genotype judgment and phenotype consistency rate exceeds 80%, with high accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099206B_ABST
    Figure CN120099206B_ABST
Patent Text Reader

Abstract

The application discloses an InDel molecular marker closely linked with a main-effect QTL of a pumpkin fruit shape index and application thereof, wherein the nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO:1. DNA of a pumpkin to be detected is used as a template, and primers with sequences shown as SEQ ID NO:2 and SEQ ID NO:3 are used for PCR amplification; if the size of an amplified product band is 233bp, the pumpkin to be detected is flat; and if the size of the amplified product band is 205bp, the pumpkin to be detected is oval. The Indel molecular marker and the amplification primer thereof can be applied to detection of the pumpkin fruit shape index, the fruit shape index of the pumpkin can be efficiently and accurately judged, the efficiency of appearance quality selection and breeding of the pumpkin fruit is improved, and planting manpower, material resources and financial resources of non-target breeding resources are reduced.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of crop genetic breeding, and particularly relates to an InDel molecular marker closely linked to a major QTL of fruit shape index of pumpkin and application thereof. BACKGROUND

[0002] Pumpkin (Cucurbit moschata) is one of important melon crops of Cucurbitaceae, plays an important role in the dietary structure of residents, and has broad market prospects and important economic value.

[0003] As one of main appearance qualities of pumpkin, fruit shape is very rich in diversity, such as flat, flat round, oval, long tube, etc. Fruit shape index, i.e. the ratio of longitudinal diameter to transverse diameter of mature fruit, can be used to describe the shape characteristics of fruit, and the greater the fruit shape index, the more elongated the fruit, and the smaller the fruit shape index, the more flat the fruit.

[0004] In the past, the judgment of fruit shape needs to rely on the data measurement and visual description of mature fruit, and needs a large amount of planting area screening. Through genotype judgment, the fruit shape index can be efficiently judged at the seedling stage, and the subsequent human and material resources are reduced, and the efficiency is greatly improved.

[0005] Therefore, it is necessary to deeply mine and utilize the molecular marker closely linked to the major QTL of fruit shape index of pumpkin, and to accelerate the process of pumpkin molecular breeding. SUMMARY

[0006] Based on this, the purpose of the present application is to provide a molecular marker closely linked to the major QTL of fruit shape index of pumpkin.

[0007] The specific technical scheme for realizing the above-mentioned purpose of the application comprises the following.

[0008] In a first aspect, the present application provides an application of an InDel molecular marker closely linked to the major QTL of fruit shape index of pumpkin in detecting the fruit shape of pumpkin, wherein the InDel molecular marker is located in the segment of chromosome 14 of Cucurbita moschata genome 426937-526389, and the nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO: 1.

[0009] In a second aspect, the present application provides a kit for detecting the fruit shape of pumpkin, comprising reagents for detecting the InDel molecular marker closely linked to the major QTL of fruit shape index of pumpkin, and the nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO: 1.

[0010] In a third aspect of the present application, a method for detecting the shape of a pumpkin fruit is provided, comprising: detecting an InDel molecular marker linked to the major QTL of the fruit shape index of the pumpkin fruit as shown in SEQ ID NO: 1.

[0011] The inventors of the present application crossbred a pumpkin resource with flat fruits and a pumpkin resource with oval fruits as parents to obtain F1, self-crossed F1 to create a F2 genetic separation population, combined the genotypes and phenotypes of the parents and F2 single plants, located the major QTL of the fruit shape index on the 14th chromosome of Chinese pumpkin within a 99.452 kb (426937-526389) segment, and screened an InDel site within the locating interval. The genotype and phenotype coincidence rate was more than 80% by detecting the InDel site in the two parents, F2, and 30 Chinese pumpkin type germplasm resources. Therefore, the Indel molecular marker and its amplification primer can be applied to the detection of the fruit shape index of the pumpkin fruit, can efficiently and accurately judge the fruit shape index of the pumpkin fruit, improve the efficiency of the appearance quality selection of the pumpkin fruit, and reduce the planting manpower, material resources and financial resources of non-target breeding resources. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 Fig. 1 is a diagram of the fruits of the two parents of the present application, wherein the left diagram is the female parent P1 and the right diagram is the male parent P2.

[0013] Figure 2 Fig. 1 is a diagram of the fruits of the two parents of the present application, wherein the left diagram is the female parent P1 and the right diagram is the male parent P2.

[0014] Figure 3 Fig. 4 is a polyacrylamide gel electrophoresis diagram of genotype detection of the two parents and F1 using the amplification primer of the InDel molecular marker in Example 1 of the present application; wherein the first lane is a marker, the second lane is the female parent P1, the third lane is the male parent P2, and the fourth lane is F1.

[0015] Figure 4 Fig. 5 is a polyacrylamide gel electrophoresis diagram of part of the F2 single plants in Example 2 of the present application.

[0016] Figure 5 Fig. 6 is a polyacrylamide gel electrophoresis diagram of genotype detection of 30 Chinese pumpkin germplasm resources using the amplification primer of the InDel molecular marker in Example 3 of the present application; wherein the first lane is a marker, and the last three lanes from left to right are the female parent P1, the male parent P2, and F1, and the middle lanes are different Chinese pumpkin germplasm resources. DETAILED DESCRIPTION

[0017] For the purposes of the present invention, a more complete description of the application will be presented. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, the purpose of providing these embodiments is to make the disclosure of the present invention more thorough and comprehensive.

[0018] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used in this description, the term "and / or" includes any and all combinations of one or more of the associated listed items.

[0019] Unless otherwise indicated, the examples were performed according to routine experimental conditions, such as Sambrook et al. Molecular Cloning: A Laboratory Manual (2013), or according to the conditions recommended by the manufacturer's instructions.

[0020] In the present invention, by using pumpkin resources with flat fruits and pumpkin resources with oval fruits as parents to cross to obtain F1, F1 is selfed to create F2 genetic segregation population, a high-density linkage genetic map is constructed, and the fruit shape index major QTL is located on the 14th chromosome of Chinese pumpkin within the 99.452 kb (426937-526389) segment, the phenotypic contribution rate of the QTL is 31.439%. Further according to the genome resequencing information of the two parents, an InDel site is screened within the positioning interval, the site is AGTTGCATTTCCATTTAGATGATAAAAGTT in flat (fruit shape index less than 0.5) pumpkin resources, the amplification band size is 233 bp; in oval (fruit shape index greater than 1) pumpkin resources, it is A, the amplification band size is 205 bp; in F1, 205 bp and 233 bp bands are amplified at the same time. According to the InDel site, primers are designed and amplification analysis is carried out in two parents and F2, in 113 F2 single plants, the genotypes of 93 single plants are consistent with the fruit shape index phenotype values, and the accuracy of genotype judging phenotype is about 82.3%. Using the primers designed according to the InDel site, the genotypes of 30 Chinese pumpkin germplasm resources at the seedling stage are detected, and the subsequent fruit shape index values are statistically analyzed, and the coincidence rate of phenotype and genotype is 90%. Therefore, the Indel molecular marker and its amplification primer can be applied to the detection of pumpkin fruit shape index.

[0021] In some embodiments of the present application, an application of an InDel molecular marker closely linked to a major QTL of fruit shape index of pumpkin in detecting fruit shape of pumpkin is disclosed, the InDel molecular marker is located in a segment of chromosome 14 of C. moschata genome, 426937-526389, and the nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO: 1.

[0022] In some other embodiments of the present application, a kit for detecting fruit shape of pumpkin is disclosed, comprising reagents for detecting an InDel molecular marker closely linked to a major QTL of fruit shape index of pumpkin, and the nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO: 1.

[0023] In some embodiments, the reagents comprise primers with sequences shown as SEQ ID NO: 2 and SEQ ID NO: 3.

[0024] In some other embodiments of the present application, a method for detecting fruit shape of pumpkin is disclosed, comprising: detecting an InDel molecular marker closely linked to a major QTL of fruit shape index of pumpkin, and the nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO: 1.

[0025] In some embodiments, the detection is performed by PCR.

[0026] In some embodiments, the primers used in the PCR have sequences shown as SEQ ID NO: 2 and SEQ ID NO: 3.

[0027] In some embodiments, the method for detecting fruit shape of pumpkin comprises the following steps:

[0028] (1) extracting DNA of the pumpkin to be tested;

[0029] (2) using the DNA extracted in step (1) as a template, and performing PCR amplification with primers having sequences shown as SEQ ID NO: 2 and SEQ ID NO: 3;

[0030] (3) gel electrophoresis detection: if the size of the amplified product band is 233 bp, the pumpkin to be tested is flat, and if the size of the amplified product band is 205 bp, the pumpkin to be tested is oval.

[0031] In some embodiments, the reaction system of the PCR comprises Taq HiFi PCR MIX, template DNA, and primers with sequences shown as SEQ ID NO: 2 and SEQ ID NO: 3.

[0032] In some embodiments, the reaction system of the PCR method comprises 9-11 μL Taq HiFi PCR MIX, 0.9-1.1 μL primer, 1.5-2.5 μL DNA template, and ddH2O to 20 μL.

[0033] In some embodiments, the reaction procedure of the PCR method comprises 95℃, 3 min; 94℃, 25 s, 54.7℃, 25 s, 72℃, 15 s, 35 cycles; 72℃, 5 min.

[0034] The application will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0035] Example 1: Positioning of major QTL of fruit shape index of pumpkin fruit and development of InDel molecular marker

[0036] The fruit flat pumpkin resource (female parent P1) and the fruit oval pumpkin resource (male parent P2) selected and preserved by the Vegetable Research Institute of Guangdong Academy of Agricultural Sciences were used as parents (P1 x P2) to obtain F1 by hybridization, and F2 segregation population was obtained by selfing of F1. Figure 1

[0037] In 2023, SNP markers were developed by whole-genome resequencing of two parents and 200 F2 individuals to construct a high-density genetic linkage map. The final map had a total map distance of 2538.269 cM and contained 20 linkage groups. Phenotypic identification of fruit shape index was performed on 128 F2 individuals. Based on the high-density genetic map and the phenotypic identification results of F2 individuals, the major QTL controlling fruit shape index was located on the 99.452 kb (426937-526389) segment of chromosome 14 of Cucurbita moschata (http: / / cucurbitgenomics.org / ftp / genome / Cucurbita_moschata / v1 / ), and the phenotypic contribution rate of the QTL was 31.439% (http: / / cucurbitgenomics.org / ftp / genome / Cucurbita_moschata / v1 / ). Figure 2

[0038] Whole-genome resequencing was performed on two parents to obtain InDel sites within the whole genome. Within the major QTL positioning interval, a polymorphic InDel molecular marker site (located at 452908) was screened, and the nucleotide sequence of the site in the female parent P1 was AGTTGCATTTCCATTAGATGATAAAAGTT, and the site in the male parent P2 was A.

[0039] ​​According to the InDel molecular marker site (AGTTGCATTTCCATTAGATGATAAAAGTT, SEQ ID NO: 1) upstream and downstream sequences, the primer (including upstream primer F and downstream primer R) was designed, and the two primers were used for PCR amplification for genotype detection of two parents and F1.

[0040] Upstream primer F (SEQ ID NO: 2): ACAATTCTGGACAATGGAGAGCG

[0041] Downstream primer R (SEQ ID NO: 3): ACCGGTAAAGTTTGAACACGTAA

[0042] PCR amplification system 20 μL: 2xTaq HiFi PCR MIX 10 μL, 0.5 μL upstream primer (10 μM), 0.5 μL downstream primer (10 μM), 2 μL DNA template, 7 μL ddH2O.

[0043] PCR amplification program: 95℃, 3min; 94℃, 25s, 54.7℃, 25s, 72℃, 15s, 35 cycles; 72℃, 5min.

[0044] Using polyacrylamide gel electrophoresis detection, the results are shown in Figure 3 From Figure 3 The results show that specific bands are present between the parents, the amplification band size in the female parent P1 flat pumpkin resource (fruit shape index less than 0.5) is 233bp; the amplification band size in the male parent P2 oval pumpkin resource (fruit shape index greater than 1) is 205bp (nucleotide sequence is A); two bands of 205bp and 233bp are amplified in F1.

[0045] Example 2 Verification of the InDel molecular marker of Example 1 in F2 population single plants

[0046] The amplification primers of the InDel molecular marker in Example 1 were used for genotype verification of 113 F2 population random single plants, and the genotype detection method was the same as that in Example 1. The detection results of some F2 single plants are shown in Figure 4

[0047] From Figure 4 It can be seen that the amplification band size of the female parent P1 is 233bp, the amplification band size of the male parent P2 is 205bp, the amplification band size of F1 is two bands of 205bp and 233bp, and the F2 population random single plants exist three types of P1, P2 and F1.

[0048] ​Further analysis found that, in 113 F2 population random single strains, the genotypes of 93 F2 single strains were consistent with the phenotype value of fruit shape index, therefore, the accuracy of judging the phenotype by genotype was about 82.3%. Among them, the single strains with 233bp amplification band were 17, which were consistent with the fruit shape index less than 0.5; the single strains with 205bp amplification band were 23, which were consistent with the fruit shape index greater than 1; the single strains with 205bp and 233bp amplification bands were 53, which were consistent with the fruit shape index of 0.5-1. It can be seen that the InDel molecular marker and its amplification primer of example 1 can well genotype the parent and genetic separation population single strain.

[0049] Example 3 Practical application of the InDel molecular marker of example 1

[0050] In autumn 2024, 30 Cucurbita pepo germplasm resources (different from the female parent P1 and the male parent P2) collected and preserved by the Vegetable Research Institute of Guangdong Academy of Agricultural Sciences were subjected to genotype detection using the InDel molecular marker amplification primer in example 1 to determine the fruit shape index of the C. pepo type germplasm resources. The specific method of genotype detection was the same as that in example 1. The results are shown in Table 2. Figure 5

[0051] Among the 30 germplasm resources, 11 were detected to have 233bp amplification band, 18 were detected to have 205bp amplification band, and 1 was detected to have 233bp and 205bp amplification bands. According to the subsequent value statistics of the fruit shape index of mature fruits, the genotypes of 27 germplasm resources were consistent with the phenotypes of fruit shape index, and the coincidence rate of phenotypes and genotypes was 90%.

[0052] It can be seen that the InDel molecular marker of the application can efficiently and accurately determine the fruit shape index of pumpkin fruits, and improve the efficiency of appearance quality selection and breeding of pumpkin fruits.

[0053] The technical features of the above-described examples can be combined in any manner. To make the description concise, not all possible combinations of the technical features in the above-described examples are described, but as long as the combinations of the technical features do not conflict, they should be considered within the scope of the present disclosure.

[0054] The above-described examples only express several embodiments of the present application, and the description is more specific and detailed, but it should not be construed as limiting the scope of the patent. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are within the scope of the present application. Therefore, the protection scope of the present patent should be subject to the appended claims.​

Claims

1. The application of an InDel molecular marker tightly linked to a major QTL of pumpkin fruit shape index in the detection of pumpkin fruit shape, characterized in that, The InDel molecular marker is located in the 426937-526389 region on chromosome 14 of the Chinese pumpkin genome, and the nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO:

1.

2. A kit for detecting the shape of pumpkin fruits, characterized in that, The invention includes reagents for detecting InDel molecular markers that are closely linked to the major QTL of the pumpkin fruit shape index, the nucleotide sequence of which is shown in SEQ ID NO:

1.

3. The kit for detecting the shape of pumpkin fruits according to claim 2, characterized in that, The reagents include primers with sequences as shown in SEQ ID NO:2 and SEQ ID NO:

3.

4. A method for detecting the shape of a pumpkin fruit, characterized in that, include: Detection of the InDel molecular marker, which is closely linked to the major QTL of the pumpkin fruit shape index, as shown in SEQ ID NO:1, of the nucleotide sequence of claim 1.

5. The method for detecting the shape of pumpkin fruit according to claim 4, characterized in that, The detection method used was PCR.

6. The method for detecting the shape of pumpkin fruit according to claim 5, characterized in that, The sequences of the primers used in the PCR method are shown in SEQ ID NO:2 and SEQ ID NO:

3.

7. The method for detecting the shape of pumpkin fruit according to claim 6, characterized in that, Includes the following steps: (1) Extract DNA from the pumpkin to be tested; (2) Using the DNA extracted in step (1) as a template, PCR amplification was performed using primers with sequences as shown in SEQ ID NO:2 and SEQ ID NO:3; (3) Gel electrophoresis detection: If the amplification product band size is 233 bp, the pumpkin to be tested is a flat pumpkin; if the amplification product band size is 205 bp, the pumpkin to be tested is an oval pumpkin.

8. The method for detecting the shape of pumpkin fruit according to any one of claims 5 to 7, characterized in that, The PCR reaction system includes: Taq HiFi PCR MIX, template DNA, and primers with sequences as shown in SEQ ID NO:2 and SEQ ID NO:

3.

9. The method for detecting the shape of pumpkin fruit according to claim 8, characterized in that, The PCR reaction system comprises: 9 µL~11 µL Taq HiFi PCR MIX, 0.9 µL~1.1 µL primers, 1.5 µL~2.5 µL DNA template, and ddH2O added to a final volume of 20 µL.

10. The method for detecting the shape of pumpkin fruit according to any one of claims 5 to 7, characterized in that, The PCR reaction procedure includes: 95℃, 3 min; 94℃, 25 s, 54.7℃, 25 s, 72℃, 15 s, 35 cycles; 72℃, 5 min.

Citation Information

Patent Citations

  • SNP (single nucleotide polymorphism) molecular markers closely linked to pumpkin lutein content major QTL (quantitative trait loci) and application of SNP molecular markers

    CN107142315A

  • Molecular marker for distinguishing sizes of pumpkin fruits, identification method and application

    CN116162721A