Application of CTCF as marker in diagnosis or prognosis evaluation of chronic sinusitis with nasal polyp

Abstract

The invention discloses application of CTCF as a marker in diagnosis or prognosis evaluation of chronic sinusitis with nasal polyp, and relates to the technical field of biological medicine. Experiments prove that the expression quantity of the CTCF is closely related to the pathological process of CRSwNP, the change of the expression quantity of the CTCF can reflect the immune response state of a CRSwNP patient, and the CTCF is possibly expected to become an important marker for CRSwNP diagnosis and prognosis evaluation clinically by regulating the expression of immune factors and the activity of an NF-kB pathway; a research result shows that the CTCF plays a role in resisting inflammatory factors in the CRSwNP by inhibiting an NF-kappa B pathway; therefore, regulation of expression or activity of CTCF may become a therapeutic strategy for CRSwNP.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to the application of CTCF as a marker in the diagnosis or prognosis evaluation of chronic sinusitis with nasal polyps. Background Art

[0002] Chronic rhinosinusitis (CRS) is one of the most common chronic inflammatory diseases. It brings a heavy burden to patients, including various physical discomfort symptoms such as chronic nasal congestion, facial pain, decreased sense of smell, and increased medical burden. According to the results of endoscopic examination, the phenotype of CRS is divided into CRS with nasal polyps (CRSwNP) and CRS without nasal polyps (CRSsNP).

[0003] Related studies have shown that approximately 25-30% of CRS patients have CRSwNP, with a higher incidence in men compared with women. The differences in clinical outcomes in different regions of CRSwNP patients are attributed to the diversity of infiltrating nasal polyp cells. Tissue eosinophil infiltration is associated with a poor clinical prognosis. However, more than half of CRSwNP patients in East Asia, including China, exhibit non-eosinophilic inflammation. Due to the high heterogeneity of CRSwNP, its pathogenesis remains poorly understood.

[0004] At present, nasal endoscopy is one of the most commonly used methods for diagnosing CRSwNP, which is a mildly invasive examination. The examination method of nasal endoscopy is: inserting a thin and long endoscope into the nasal cavity, and the doctor uses the endoscope inserted into the nasal cavity to observe the changes in the nasal cavity, paranasal sinuses and nearby structures (including polyps, inflammation or other lesions). This method is of great significance for evaluating the size and location of nasal polyps and other related lesions.

[0005] In this regard, the inventors believe that the above-mentioned examination method for CRSwNP is an invasive examination, and local anesthesia is usually performed during the operation. Children, the elderly and other patients have a certain aversion to this type of examination, which makes children, the elderly and other patients less compliant during the examination, which will inevitably affect the timeliness of the examination.

[0006] Therefore, it is necessary to find new diagnostic markers that may be used in the diagnosis of CRSwNP, so as to achieve the non-invasiveness of CRSwNP examination and improve the compliance of children, the elderly and other patients during the examination.

[0007] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention and should not be regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the invention

[0008] In response to the above technical problems, an embodiment of the present invention provides the application of CTCF as a marker in the diagnosis or prognosis evaluation of chronic sinusitis with nasal polyps to solve the problems raised in the above background technology.

[0009] A reagent for detecting CTCF protein or its encoding gene is used in the preparation of a product for diagnosing or evaluating the prognosis of chronic sinusitis with nasal polyps.

[0010] Preferably, the CTCF protein or its encoding gene is used as a marker for the diagnosis of chronic sinusitis with nasal polyps or the prognosis assessment of chronic sinusitis with nasal polyps.

[0011] Preferably, CTCF protein expression is downregulated in patients with CRS.

[0012] Preferably, the product for diagnosis or prognosis assessment of chronic sinusitis with nasal polyps includes primers and probes for identifying the gene encoding the CTCF protein, and antibodies for recognizing the CTCF protein.

[0013] Preferably, the primers for identifying the CTCF protein encoding gene include: a front primer sequence as shown in SEQ ID NO.1, a rear primer sequence as shown in SEQ ID NO.2; or a front primer sequence as shown in SEQ ID NO.3, a rear primer sequence as shown in SEQ ID NO.4.

[0014] Specifically, the sequence of SEQ ID NO.1 is: 5'-AAGCCACACTGATGAGAGAC-3'; the sequence of SEQ ID NO.2 is: 5'-TAACGACGATGCCGAACC-3';

[0015] The sequence of SEQ ID NO.3 is: 5'-GACTGAAGTAATGGAGGGCACA-3'; the sequence of SEQ ID NO.4 is: 5'TTCAGGCAAAGGTAGGGTGT-3'.

[0016] A biomarker for diagnosis or prognosis assessment of chronic sinusitis with nasal polyps, comprising CTCF protein or a gene encoding it.

[0017] Preferably, the kit is used to detect CTCF protein or its encoding gene.

[0018] Preferably, the kit comprises primers and probes for recognizing the gene encoding the CTCF protein, and antibodies for recognizing the CTCF protein.

[0019] Preferably, for CTCF examination of CRSwNP, the main sample sources may be: nasal neoplasms.

[0020] A preparation for overexpressing CTCF protein or its encoding gene is used in the preparation of a drug for treating chronic sinusitis with nasal polyps.

[0021] Preferably, the CTCF protein or its encoding gene has an anti-inflammatory effect.

[0022] The use of CTCF as a marker in the diagnosis or prognosis evaluation of chronic sinusitis with nasal polyps provided in the embodiments of the present invention has the following beneficial effects:

[0023] 1. The experiment confirmed that compared with normal nasal mucosa, the expression of CTCF in CRSwNP patients was significantly reduced, and the NF-κB pathway genes were upregulated in CRSwNP samples. Overexpression of CTCF in HNEpC human nasal epithelial cells led to decreased mRNA and protein levels of IL-5, IL-10 and IL-13. CTCF overexpression inhibited the nuclear entry of P65 and inhibited the activation of NF-κB. Downregulation of CTCF in HNEpC human nasal epithelial cells led to increased mRNA and protein levels of IL-5, IL-10 and IL-13. ChIP showed that CTCF could directly bind to the IL-5, IL-10 and IL-13 promoters. Dual luciferase reporter gene analysis showed that CTCF could inhibit the transcription of IL-5, IL-10 and IL-13.

[0024] 2. The present invention has confirmed through a series of experiments that the expression of CTCF is closely related to the pathological process of CRSwNP, and the change in CTCF expression can reflect the state of immune response in CRSwNP patients. CTCF may become an important marker for the diagnosis and prognosis evaluation of CRSwNP in clinical practice by regulating the expression of immune factors and the activity of the NF-κB pathway;

[0025] 3. In addition, our research results show that CTCF plays an anti-inflammatory factor in CRSwNP by inhibiting the NF-κB pathway; therefore, regulating the expression or activity of CTCF may become a therapeutic strategy for CRSwNP; these results emphasize that the CTCF / NF-κB pathway is a promising target for future research and treatment development of CRSwNP, which may provide new therapeutic strategies and theoretical basis for the prevention and treatment of chronic sinusitis with nasal polyps, and has important scientific significance and clinical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The expression results of CTCF in normal nasal mucosa and CRSwNP;

[0027] Figure 1 A shows the mRNA results of CTCF in normal nasal mucosa and CRSwNP;

[0028] Figure 1 B-1C shows the Western blot results of CTCF in normal nasal mucosa and CRSwNP;

[0029] Figure 1 D is the immunohistochemistry result;

[0030] Figure 2 qPCR data analysis results for CRSwNP patients;

[0031] Figure 2 A shows the CTCF mRNA expression results in males and females;

[0032] Figure 2 B-2C shows the CTCF mRNA expression results in female and male patients with mild, moderate, and severe CRSwNP;

[0033] Figure 2 DE are the CTCF mRNA expression results of Eos CRSwNP and non-Eos CRSwNP patients;

[0034] Figure 2 FG are the CTCF mRNA expression results of female and male patients with mild, moderate, and severe CRSwNP;

[0035] Figure 3 The results of immunohistochemical data analysis for patients with CRSwNP;

[0036] Figure 3 A is the immunohistochemical data expression results of CTCF in males and females;

[0037] Figure 3 B-3C shows the CTCF protein expression results of male and female patients with mild, moderate, and severe CRSwNP;

[0038] Figure 3 D-3E are the CTCF protein expression results of male and female patients with eosinophilic and non-eosinophilic CRSwNP;

[0039] Figure 3 F is the results of eosinophil ratio in sections of the control group and CRSwNP group;

[0040] Figure 3 GH is the CTCF protein expression results of female and male patients with mild, moderate, and severe CRSwNP;

[0041] Figure 3 I is the gender distribution results of mild, moderate and severe cases;

[0042] Figure 4 The expression results of CTCF mRNA after LPS stimulation;

[0043] Figure 4 A is the expression results of CTCF mRNA after LPS stimulation at different time and concentration;

[0044] Figure 4 B-4D shows the expression results of IL-5, IL-10 and IL-13 after LPS stimulation;

[0045] Figure 5 This is the result of CTCF transfection;

[0046] Figure 5 A shows the mRNA expression results of each group after CTCF overexpression;

[0047] Figure 5 B-5D shows the mRNA expression results of IL-5, IL-10, and IL-13 after CTCF overexpression;

[0048] Figure 5 E-5G is the ELISA test result of IL-5, IL-10, and IL-13 proteins after CTCF transfection;

[0049] Figure 5 H-5J shows the protein expression results of IL-5, IL-10 and IL-13 after CTCF overexpression;

[0050] Figure 6 The expression results of IL-5, IL-10 and IL-13 after CTCF expression was downregulated;

[0051] Figure 6 AC shows the results of down-regulating CTCF expression by three synthetic siRNAs;

[0052] 6D-F are the results of mRNA expression of IL-5, IL-10, and IL-13 after downregulation of CTCF and LPS stimulation;

[0053] 6G-I is the result of down-regulating CTCF and LPS stimulation and the expression of IL-5, IL-10 and IL-13 in the cell supernatant;

[0054] Figure 7 Results of chromatin immunoprecipitation analysis and dual-luciferase reporter gene analysis;

[0055] Figure 7 AD are the results of chromatin immunoprecipitation analysis;

[0056] Figure 7 EG are the results of dual luciferase reporter gene analysis. DETAILED DESCRIPTION

[0057] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0058] In response to the above technical problems, an embodiment of the present invention provides the application of CTCF as a marker in the diagnosis or prognosis evaluation of chronic sinusitis with nasal polyps to solve the problems raised in the above background technology.

[0059] 1. Materials and Methods

[0060] 1. Experimental subjects

[0061] Subjects This study was approved by the Ethics Committee of Jiading District Central Hospital (approval number: 2020K07). Since the tissue samples used were discarded during the operation, the informed consent was waived, which had been approved by the Ethics Committee.

[0062] All specimens included in this study were obtained from patients undergoing functional endoscopic sinus surgery, nasal septum surgery, or nasal bone fracture surgery. Nasal polyp samples were obtained from patients with CRSwNP, while normal mucosa in the control group was obtained from the lateral mucosa of the middle turbinate in patients undergoing nasal septum surgery for nasal septal deviation and cystic middle turbinate, part of which required resection due to nasal stenosis caused by nasal bone fracture. The diagnosis of CRSwNP was based on current European and American guidelines. Eosinophilic CRSwNP was defined as a percentage of tissue eosinophils exceeding 10% of total infiltrating cells. Patients with cystic fibrosis, choanal polyps, odontogenic sinusitis, sinus fungal disease, immunodeficiency diseases, sinus tumors, acute upper respiratory tract infection within 4 weeks, and patients who had received antileukotrienes or immunotherapy were excluded from this study. Antileukotrienes, oral glucocorticoids, and intranasal steroid sprays were discontinued 2 weeks before surgery, respectively.

[0063] All patients in the study underwent CT scans, and their CT results were scored using the CT Lund-Mackay scoring system. The paranasal sinuses include the maxillary sinus, anterior ethmoid sinus, posterior ethmoid sinus, sphenoid sinus, frontal sinus, and ostiomeatal complex. Scoring criteria: 1) Paranasal sinuses: 0 = no abnormality, 1 = partial turbidity, 2 = complete turbidity; 2) Sinus-oronasal complex: 0 = no obstruction, 2 = obstruction; 3) 0-12 points for each side, 0-24 points in total. CRSwNP patients were divided into mild, moderate, and severe according to the CT score.

[0064] The visual analogue scale (VAS) is used for patients to subjectively assess the severity of their condition. Patients assess the severity of their symptoms with a corresponding score between 0 and 10 points (0 points for no discomfort and 10 points for severe discomfort). The severity level is: mild 0-3 points, moderate >3-7 points, severe >7-10 points. The VAS scale for chronic sinusitis includes four aspects: nasal congestion; runny nose, runny nose reflux; dizziness and headache; decreased sense of smell, and the score of each aspect is between 0 and 10.

[0065] 2. Quantitative PCR method

[0066] Total RNA for quantitative RT-PCR was extracted from paraffin sections of nasal tissues, CRSwNP, and HNEpC using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). RNA was reverse transcribed into cDNA using PrimeScript RT kit (TakaRa Biotechnology, Dalian, China). Quantitative PCR was performed using four primers on ABI StepOne PLUS (Applied Biosystems) using SYBR Premix Ex Taq kit (Applied Biosystems, Foster City, CA, USA). Primer information is as follows: ACTB (F) 5'-GCGTGACATTAAGGAGAAGC-3' (R) 5'-CCACGTCACACTTCATGATGG-3' (for tissue samples), CTCF (F) 5'-AAGCCACACTGATGAGAGAC-3' (R) 5'-TAACGACGATGCCGAACC-3' (for tissue samples), ACTB (F) 5'-TGGAACGGTGAAGGTGACAG-3' (R) 5'

[0067] -AACAACGCATCTCATATTTGGAA-3' (for cell culture), CTCF (F) 5'-GACTGAAGTAATGGAGGGCACA-3' (R) 5'TTCAGGCAAAGGTAGGGTGT-3' (for cell culture), IL-10 (F) 5'-CGAGATGCCTTCAGCAGAGT-3' (R) 5'-AGGCATTCTTCACCTGCTCC-3' (for cell culture), IL-13 (F) 5'-CTAGAGCACACTGTAGCATT-3' (R) 5'-CTAGAGCACACTGTAGC ATT-3' (for cell culture), IL-5 (F) 5'-GCAAGGGGGTACTGTGGAAA-3' (R) 5'-TTGGCCCTCATTCTCACTGC-3' (for cell culture), GAPDH (F) 5'-CACCATCTTCCAGGAGCGAG-3' (R) 5'-TGATGACCCTTTTGGCTCCC-3' (for CTCF siRNA experiments), IL-10 (F) 5'-CTCCGAGATGCCTTCAGCAG-3' (R) 5'-GGCAACCCAGGTAACCCTTAAA-3' (for CTCF siRNA experiments), IL-13 (F) 5'-TTTGTTGACCACGGTCATTGC-3' (R) 5'-GCTGCACAGTACATGCCA-3' (for CTCF siRNA experiments), IL-5 (F) 5'-TACGTGTATGCCATCCCCAC-3' (R) 5'-.TCAGTGCACAGTTGGTGATTT-3' (for CTCF siRNA experiments), IL-5 (F). 5'-UACUACACCCUGGUCACAGUUC-3' (R) 5'-GGCACCTTTCCCATTGAG-3' (for ChIP), IL-10 (F)

[0068] 5'-CCCGCCUGUACGUAGGAAG-3'(R)5'-CCCAACCTGGGATGAATACC-3'(for ChIP), IL-13(F)5'-UGAUCCUGCAGAGACUGGUGAG-3'(R)5'CCAGAGTGGCTGGAAGTAGTG 3'(for ChIP).

[0069] The annealing temperature was 60°C. The amplification process was as follows: 50°C for 2 minutes and 95°C for 2 minutes. This was followed by 40 cycles of 95°C for 3 seconds and 60°C for 30 seconds. Finally, the melting process included 95°C for 15 seconds, 60°C for 1 minute, and 95°C for 15 seconds. The relative gene expression was calculated using the 2(-Delta-Delta-CT) method. Normal middle turbinate mucosa samples and control cell culture samples were used as calibrators for tissue samples and cell culture samples, respectively. ACTB and GAPDH were used as housekeeping genes for normalization of gene expression.

[0070] 3. Western blot method

[0071] Western blot method includes sample collection (tissue and cell samples), protein extraction, SDS-PAGE, transmembrane, antibody hybridization, and immunocolorimetry. The first antibody and internal reference gene are as follows.

[0072] CTCF (rabbit, 1:1000, ab128873, Abcam, Cambridge, UK), CTCF (rabbit, 1:1000; #2899, Cell Signaling Technology, Boston, USA), p-IκB-α (rabbit, 1:1000, AF1870, Beyotime, Shanghai, China), IκB (rabbit, 1:1000, AF1282, Beyotime), P65 (rabbit, 1:15000, AF5243, Beyotome), p-P65 (rabbit: 1:1000, AF5875, Beyotame), β-actin (mouse, 1:8000, sc-69879, Santa Cruz, TX, USA), GAPDH (mouse, 1:30000, #60004-1-Ig, Proteintech, Chicago, USA).

[0073] 4. Histology, Immunohistochemistry and Immunofluorescence Methods

[0074] Table 1 summarizes the characteristics details of the subjects in immunohistochemistry. In addition, tissue samples were fixed in 4% formaldehyde solution and embedded in paraffin. Paraffin sections were cut into 4 μm thickness. After dewaxing of paraffin sections, antigen retrieval and peroxidase blocking were performed, followed by incubation with the primary antibody (CTCF, immunohistochemistry, Rabbit, 1:1000, ab128873, Abcam, Cambridge, UK) (p65, immunofluorescence, Rabbi, 1:50, Sg0750, Sego, Shanghai, China) and the secondary antibody (Maxvision HRP Rabbit, 1:100, KIT-5020, Maixin, Fuzhou, China). Finally, DAB color development and hematoxylin counterstaining were performed.

[0075] The steps of cell immunofluorescence assay included cell fixation, cell membrane disruption, BSA blocking, addition of primary antibody, addition of secondary antibody (cy3 sheep anti-rabbit, 1:300, Sego Biology, Sg511), and DAPI re-staining of cell nuclei.

[0076] The staining results were semi-quantitatively analyzed by combining the staining intensity with the percentage of positive cells. Positive cell markers in tissue sections are pale yellow to brown cytoplasmic staining. The staining intensity was scored according to the staining characteristics presented by most cells (the contrast between the staining depth and the background color): no staining was 0 points, pale yellow was 1 point, brownish yellow was 2 points, and brownish brown was 3 points. The percentage of positive cells refers to the average number of positive cells of a certain type of cell in 5 fields of view (100 such cells were counted per 400-fold high-power field of view): 0-5% was 0 points, 6%-25% was 1 point, 26%-50% was 2 points, 51%-75% was 3 points, and >75% was 4 points. A 5400-fold area was randomly selected for each section, and the staining intensity and positive cell percentage of each area were scored. The product of the staining intensity and the percentage of positive cells is: 0 is negative (-), 1-4 is weakly positive (+), 5-8 is moderately positive (++), and 9-12 is strongly positive (+++). This part of the results was obtained manually.

[0077] Table 1. Immunohistochemical characteristics of subjects

[0078]

[0079] 5. ELISA method

[0080] ELISA IL-5, IL-10, and IL-13 levels in cell culture supernatants were measured using ELISA kits (Yifei Biotechnology, Shanghai, China) according to the manufacturer's instructions.

[0081] 6. Cell culture method

[0082] HNEpC human nasal epithelial cells (cell line, #CP-H252, Punosai Life Technology, Wuhan, China) were cultured in RPMI1640 medium containing 10% FBS, 1% double antibody and 1% sodium pyruvate at 37°C and 5% CO2 in a constant temperature and humidity cell culture incubator. HNEpC grew 80% to 90% on the surface of the culture dish, digested with trypsin, centrifuged, added with fresh culture medium, and transferred to a new culture dish channel. The digested cells were centrifuged, the supernatant was discarded, and the cryopreservation solution (10% DMSO + 50% FBS + 40% culture medium) was added and placed in a programmed cryopreservation box for cryopreservation.

[0083] CTCF overexpression experiment: The cells were divided into four groups, including normal cell group (no intervention factor, PBS group), normal cell + LPS group (LPS group), and CTCF empty body + LPS group. Each group was stimulated with LPS at the same concentration and time. The cell supernatant was collected and IL-5, IL-10, and IL-13 were detected by ELISA. The cells were collected, IL-5, IL-10, IL-13, and CTCF were detected by qPCR, and phosphorylated IκB-α was detected by western blot. After climbing the cells, confocal microscopy was used to detect nuclear penetration of immunofluorescence staining P65.

[0084] CTCF downregulation experiment: The cells were divided into 8 groups, including control group, LPS group, siNC group, siCTCF-1 group, siCTSF-2 group, siNC+LPS group, siCTCF-1+LPS group and siCTCF-2+LPS group. The concentration and time of LPS were 1 μg / ml for 48 hours. The cell supernatant was collected and IL-5, IL-10 and IL-13 were detected by ELISA. The cells were collected and IL-5, IL-10, IL-13 and CTCF were detected by qPCR.

[0085] Specifically, LPS is a potent immunostimulatory factor. It is one of the main components of bacterial cell walls and is composed of lipid A, core polysaccharide and O antigen. LPS plays an important role in the immune system, activating innate immune responses and inducing the body to release inflammatory factors.

[0086] 7. ChIP (Chromatin Immunoprecipitation) method

[0087] First, cultured cells were prepared. Secondly, the prepared cells were subjected to nuclear preparation and chromatin fragmentation. Third, the obtained chromatin samples were subjected to chromatin immunoprecipitation. Fourth, the chromatin was washed off and untied from the CTCF antibody (1:25, Rabbit, CellSignaling Technology, #2899, Boston, USA). Then, the DNA was purified using a centrifugal column. Finally, the DNA was detected by qPCR. The experimental procedure of qPCR was the same as before.

[0088] 8. Dual luciferase reporter gene method

[0089] First, the reporter gene plasmid is constructed and transfected. Then, the cultured cells are lysed, and then the substrate is added and detected using a fluorescence luminescence analyzer.

[0090] 9. Statistical analysis

[0091] All data were analyzed using RStudio 2022.07.2Build 576. For quantitative data, normality (shapiro.test()) and variance (carpackage) tests were performed. If the data conformed to a normal distribution and the variance was homogeneous, a t-test (t.test()) was used; otherwise, a Wilcoxon test (wilco.test()) was performed. Qualitative data were analyzed using the χ 2 Test. If the sample size is > 40 and the theoretical frequency is > 5, chisq.test() is used; otherwise, fisher.test() is applied. All statistical analyses use a significance level of 0.05.

[0092] 2. Experimental Results

[0093] 1. Reduced CTCF expression in CRSwNP

[0094] exist Figure 1 In A, real-time PCR data show the mRNA levels of CTCF in nasal mucosa and CRSwNP. The results showed that the expression of CTCF in CRSwNP was decreased, which was statistically significant compared with the control group. Figure 1 In B, Western blot data showed that the expression of CTCF in CRSwNP was significantly lower than that in normal nasal mucosa. Figure 1 In C, the gray value of Western blot in the control group was higher than that in the CRSwNP group, which was statistically significant. Figure 1 D shows the negative control of CTCF in normal nasal mucosa, where CTCF expression is stronger than in CRSwNP.

[0095] 2. Gender differences in CTCF expression in CRSwNP

[0096] exist Figure 2 In A, qPCR data from CRSwNP patients showed that there was a statistical difference in CTCF mRNA expression between males and females. Figure 2 In B-2C, qPCR data from CRSwNP patients showed no statistically significant difference in CTCF mRNA expression between female and male patients with mild, moderate, and severe CRSwNP (grading of mild, moderate, and severe cases was based on the Lund-Mackay scoring system). Figure 2 In DE, qPCR data showed no statistically significant difference in CTCF mRNA expression between Eos CRSwNP and non-Eos CRSwNP patients. Figure 2 In FG, qPCR data of CRSwNP patients showed no statistical difference in CTCF mRNA expression between female and male patients with mild, moderate, and severe CRSwNP (grading of mild, moderate, and severe cases was based on nasal congestion VAS scores).

[0097] 3. Consistency between CTCF protein expression and mRNA expression

[0098] Immunohistochemical analysis confirmed that there was a significant difference in CTCF protein expression between male and female CRSwNP patients ( Figure 3 A), which is consistent with the mRNA results. There was no significant difference in CTCF protein expression between mild, moderate, and severe CRSwNP cases in the male and female groups (the grading of mild, moderate, and severe cases was based on the Lund-Mackay scoring system) ( Figure 3 In addition, there was no significant difference between eosinophilic and noneosinophilic CRSwNP in either sex ( Figure 3 D, 3E). Compared with the normal nasal mucosa, the eosinophil ratio in the tissue sections of the CRSwNP group was significantly higher ( Figure 3 F). There was no statistical difference in CTCF protein expression between female and male patients with mild, moderate, and severe CRSwNP (grading of mild, moderate, and severe cases was based on nasal congestion VAS score). No statistical difference was found in the gender distribution of mild, moderate, and severe cases using chi-square distribution plot (grading of mild, moderate, and severe cases was based on Lund-Mackay scoring system).

[0099] 4. CTCF and inflammatory markers after LPS stimulation

[0100] The optimal condition for LPS stimulation was 1 μg / ml for 48 hours ( Figure 4 A). After LPS stimulation, the levels of IL-5, IL-10, and IL-13 in HNEpC human nasal epithelial cells increased significantly, as shown by ELISA ( Figure 4 B, 4C).

[0101] 5. CTCF overexpression and inflammation suppression

[0102] exist Figure 5 In A, qPCR data showed that after CTCF transfection, the CTCF mRNA in the LPS+OE group was significantly higher than that in the PBS group, with a P value less than 0.001. Figure 5 In B-5D, after CTCF transfection, IL-5, IL-10, and IL-13 mRNA were significantly lower than those in the PBS group and the LPS+NC group, and the results were statistically significant. Figure 5 In E-5G, ELISA data showed that after CTCF transfection, IL-5, IL-10, and IL-13 proteins were significantly lower than those in the PBS group and LPS+NC group, with P values ​​less than 0.001. Figure 5 In H, after transfection with CTCF, the entry of P65 into the nucleus was inhibited in the LPS+OE group. Red: Cy3-P65, blue: DAPI, bar: 20 μm. Figure 5 In I, Western blot results of cell samples showed that the expression of p-IκB-α protein in the CTCF transfection group (LPS+OE) was lower than that in the LPS+NC group. Figure 5 In J, Western blot of tissue samples showed that the expressions of p-p65, p65, p-IκB-α, and IκB proteins were higher in the CRSwNP group than in the control group.

[0103] The transfection efficiency was verified, showing that CTCF mRNA was significantly upregulated ( Figure 5 A). After CTCF overexpression, qPCR data showed that IL-5, IL-10 and IL-13 mRNA levels were significantly reduced ( Figure 5 B-5D). ELISA results confirmed these findings, showing decreased protein levels of IL-5, IL-10, and IL-13 ( Figure 5 E-5G).

[0104] 6. CTCF inhibits P65 nuclear translocation

[0105] Immunofluorescence data showed that LPS stimulation induced the nuclear translocation of P65, indicating the activation of the NF-κB pathway, while CTCF overexpression inhibited this translocation ( Figure 5 H). Western blot analysis showed that the level of p-IκB-α increased after LPS stimulation and decreased after CTCF overexpression ( Figure 5 I). Analysis of tissue samples showed that the expression of inflammatory markers p-p65, p65, p-IκB-α, and IκB was increased in the CRSwNP group ( Figure 5 J).

[0106] 7. CTCF expression is downregulated and inflammatory factors expression is increased

[0107] SiRNA targeting CTCF was synthesized and transfected into HNEpC human nasal epithelial cells. QPCR and western blot were used to detect the inhibition efficiency of siRNA, and the results showed that all three siRNAs could significantly downregulate the expression of CTCF. siCTCF-1 and siCTCF-2 were selected for subsequent experiments ( Figure 6 AC). After HNEpC were treated with 1ug / ml LPS for 48 hours, the expression levels of IL-5, IL-10, and IL-13 mRNA and protein in HNEpC were significantly increased, with statistical significance. Downregulation of CTCF and LPS stimulation further increased the expression levels of IL-5, IL-10, and IL-13 mRNA and protein in HNEpC, with statistical significance. The method used to detect mRNA was qPCR ( Figure 6 DF), the method used to detect protein is ELISA ( Figure 6 GI).

[0108] 8. CTCF can directly bind to the promoters of IL-5, IL-10, and IL-13 and inhibit their transcription

[0109] exist Figure 7 In AD, the results of chromatin immunoprecipitation analysis showed that CTCF can directly bind to the promoters of IL-5, IL-10, and IL-13. In addition, dual-luciferase reporter gene analysis showed that CTCF can inhibit the transcription of IL-5, IL-10, and IL-13, with statistical significance ( Figure 7 EG).

[0110] In summary, the present invention has confirmed for the first time through research that CTCF expression is dysregulated in CRSwNP. Compared with normal nasal mucosa, CTCF mRNA and protein levels in CRSwNP tissues were significantly reduced, indicating that CTCF may have the function of an anti-inflammatory gene. Interestingly, female CRSwNP patients showed higher CTCF expression than male patients, which may explain the higher incidence of CRSwNP in men. However, in CRSwNP patients, there was no significant correlation between CTCF expression, disease severity, and eosinophil ratio.

[0111] Further investigation of the relationship between inflammatory markers and CTCF expression showed that 1 μg / ml LPS stimulation for 48 hours resulted in minimal CTCF mRNA expression. ELISA measurements showed increased levels of IL-5, IL-10, and IL-13 after LPS stimulation. Overexpression of CTCF significantly reduced the mRNA and protein levels of these inflammatory markers, suggesting that CTCF may suppress inflammation.

[0112] Mechanistically, CTCF overexpression reduced p-IκB-α levels compared with the LPS-stimulated control group. Analysis of tissue samples showed that the expression of NF-κB pathway proteins was elevated in the CRSwNP group, and CTCF overexpression inhibited NF-κB activation. The inhibition of P65 nuclear translocation by CTCF further supported its role in regulating the NF-κB inflammatory pathway.

[0113] To further verify the function of CTCF, siRNA targeting CTCF was synthesized and transfected into HNEpC. QPCR and ELISA results showed that downregulation of CTCF after LPS stimulation further increased IL-5, IL-10, IL-13 mRNA and protein expression. This suggests that CTCF plays an anti-inflammatory role in HNEpC. In addition, the results of chromatin immunoprecipitation and dual luciferase reporter gene assays showed that CTCF could directly bind to IL-5, IL-10, and IL-13 promoters and inhibit their transcription, which further confirmed the rigor of our previous experiments.

[0114] The embodiments described above are only descriptions of the preferred implementation modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of a reagent for detecting CTCF protein or its encoding gene in the preparation of a product for diagnosis or prognosis evaluation of chronic sinusitis with nasal polyps.

2. The use of a reagent for detecting CTCF protein or its coding gene according to claim 1 in the preparation of a product for diagnosing or evaluating the prognosis of chronic sinusitis with nasal polyps, characterized in that: The CTCF protein or the gene encoding it is used as a marker for diagnosing chronic sinusitis with nasal polyps or evaluating the prognosis of chronic sinusitis with nasal polyps.

3. Use of the reagent for detecting CTCF protein or its coding gene according to claim 1 in the preparation of a product for diagnosing or evaluating the prognosis of chronic sinusitis with nasal polyps, characterized in that: CTCF protein expression is downregulated in patients with CRS.

4. The use of the reagent for detecting CTCF protein or its coding gene according to claim 1 in the preparation of a product for diagnosing or evaluating the prognosis of chronic sinusitis with nasal polyps, characterized in that: Products for the diagnosis or prognosis assessment of chronic sinusitis with nasal polyps include primers and probes for identifying the CTCF protein encoding gene, and antibodies for recognizing the CTCF protein.

5. Use of the reagent for detecting CTCF protein or its coding gene according to claim 1 in preparing a product for diagnosing or evaluating the prognosis of chronic sinusitis with nasal polyps, characterized in that: The primers for identifying the CTCF protein encoding gene include: a front primer sequence as shown in SEQ ID NO.1, a rear primer sequence as shown in SEQ ID NO.2; or a front primer sequence as shown in SEQ ID NO.3, a rear primer sequence as shown in SEQ ID NO.

4.

6. A biomarker for diagnosis or prognosis assessment of chronic sinusitis with nasal polyps, characterized in that: The biomarkers include CTCF protein or its encoding gene.

7. A kit for diagnosing or evaluating the prognosis of chronic sinusitis with nasal polyps, characterized in that: The kit is used to detect CTCF protein or its encoding gene.

8. The kit for diagnosing or evaluating the prognosis of chronic sinusitis with nasal polyps according to claim 7, characterized in that: The kit includes primers and probes for identifying the gene encoding the CTCF protein, and antibodies for identifying the CTCF protein.

9. Use of a preparation that overexpresses CTCF protein or its encoding gene in the preparation of a drug for treating chronic sinusitis with nasal polyps.

10. Use of the preparation of overexpressing CTCF protein or its encoding gene according to claim 9 in preparing a drug for treating chronic sinusitis with nasal polyps, characterized in that: CTCF protein or its encoding gene has the effect of inhibiting inflammation.

Images