A sporeless oyster mushroom strain and its breeding method and application

Abstract

The present invention discloses a sporeless Pleurotus ostreatus strain 3H02F79 and a breeding method thereof, relating to the fields of edible fungi and molecular marker-assisted breeding technology. The 3H02F79 strain, deposited with CCTCC NO: M 2025718, exhibits superior agronomic traits to its sporeless parent, QHP315. Its spore production is sporeless, resulting in an 18.18% increase in yield compared to its sporeless parent, QHP315. Compared to its commercial spore-forming parent, P2101, it eliminates the harmful effects of spore release and exhibits no significant differences in mycelial growth rate or yield. Compared to its two parent strains, the 3H02F79 strain has the lowest contamination rate and the shortest tide-turning time. Furthermore, through plot and expanded trials, the 3H02F79 strain has demonstrated a 100% fruiting rate, stable properties, and highly consistent phenotypes across different plots, making it a highly promising sporeless cultivar for industrial cultivation.

Description

Technical Field

[0001] The present invention relates to the technical field of edible fungi and molecular marker-assisted breeding, and in particular to an amorphous oyster mushroom strain and a breeding method and application thereof. Background Art

[0002] As one of the most widely cultivated edible mushrooms worldwide, Pleurotus ostreatus holds a crucial position in the agricultural industry due to its unique biological characteristics and economic value. Its thick, tender flesh, rich nutrition, and delicious flavor make it a valuable food and medicinal herb. Long-term consumption of Pleurotus ostreatus can enhance the body's defenses and regulate metabolism and blood pressure.

[0003] Despite the large scale of the oyster mushroom industry, its variety breeding still faces severe challenges: (1) Narrow genetic background: The genetic similarity of the main cultivated varieties is >80%, with serious homogeneity and limited room for improvement in stress resistance and adaptability; (2) Hazards caused by spore release: Traditional varieties release a huge amount of spores (a single fruiting body releases about 1.5 million spores per minute), which leads to health risks for mushroom farmers and production environment problems; (3) Current cultivated varieties face problems such as loss of genetic ability, strain degeneration and weakened stress resistance; (4) The cost of importing strains is high.

[0004] Breeding spore-free varieties of Pleurotus ostreatus can reduce spore release, significantly lowering the incidence of occupational diseases, improving the cultivation environment, and eliminating spore erosion on ventilation ducts and refrigeration equipment. Furthermore, the spore-free trait reduces the risk of strain degeneration caused by spore contamination, making it suitable for factory-based, intensive production models. High-quality seed sources are a key constraint to industrial development. To address the challenges facing the Pleurotus ostreatus industry, breeding strains with superior quality, productivity, and adaptability has become a top priority. Summary of the Invention

[0005] The present invention provides an asporus oyster mushroom strain 3H02F79 and a breeding method and application thereof.

[0006] The present invention adopts the following technical solutions:

[0007] A sporeless oyster mushroom strain 3H02F79, which was deposited in the China Center for Type Culture Collection on April 7, 2025, with a preservation address in Wuhan, China, with a preservation number of CCTCC NO: M 2025718, and a classification name of Pleurotus ostreatus 3H02F79.

[0008] Another object of the present invention is to provide a mycelium and / or fruiting body of Pleurotus ostreatus obtained by growth and development of the above-mentioned Pleurotus ostreatus strain 3H02F79.

[0009] Another object of the present invention is to provide a use of the above-mentioned Pleurotus ostreatus strain, or the above-mentioned mycelium and / or fruiting body, wherein the use is at least one of the following:

[0010] A. Application as a parent in hybrid breeding;

[0011] B. Strain propagation;

[0012] C. Fruiting body production;

[0013] D. Food processing.

[0014] Another object of the present invention is to provide a primer combination for detecting different karyotypes of the protoplasts of the Pleurotus ostreatus strain, wherein the primer combination includes the sequences shown in SEQ ID NO.1-SEQ ID NO.4.

[0015] Another object of the present invention is to provide a primer combination for detecting the relative mating type of the Pleurotus ostreatus strain, wherein the primer combination includes the sequences shown in SEQ ID NO.7 to SEQ ID NO.10.

[0016] Another object of the present invention is to provide the use of the above primer combination in the identification of Pleurotus ostreatus varieties and / or Pleurotus ostreatus breeding.

[0017] Another object of the present invention is to provide a method for cultivating the above-mentioned Pleurotus ostreatus strain 3H02F79, comprising the following steps:

[0018] S1: Activate and culture the strain 3H02F79 in PDA stock culture medium to prepare PDA stock;

[0019] S2: inoculating the PDA mother seed into the shoot stock culture medium to prepare the shoot stock;

[0020] S3: Inoculate the branch stock into the culture medium in the cultivation bag, place it in a dark place at 25℃, with a relative humidity of 60%-70% and a carbon dioxide concentration below 0.3%, and wait for the mycelium to fill the bag and then produce mushrooms;

[0021] The fruiting temperature is 8-16℃, the relative humidity is above 95%, the light intensity is 100-300 lx, and the carbon dioxide concentration is less than 0.1%.

[0022] Preferably, the PDA mother culture medium is: 200 g potato, 20 g glucose, 1 L water, natural pH;

[0023] The branch stock culture medium is: 89% wood branches, 10% bran, 1% gypsum, and a water content of 60% to 65%;

[0024] The cultivation bag culture material comprises: 30% cottonseed hulls, 48% corn cobs, 18% bran, 2% soybean meal, 1% gypsum, 1% lime, and has a water content of 63%.

[0025] Another object of the present invention is to provide a method for breeding the aforementioned Pleurotus ostreatus strain, comprising the following steps:

[0026] S1: Prepare protoplast monokaryotes from the spore-forming parent P2101 and the asporous parent QHP315, and use the primer combination for detecting different karyotypes of the protoplasts of the above-mentioned Pleurotus ostreatus strains to distinguish the different karyotypes of the parent protoplasts, and obtain two protoplast monokaryotes of each;

[0027] S2: Perform complete diallel hybridization on the obtained monokaryons, infer the relative mating type between the two parents based on whether they are compatible, and use the above-mentioned primer combination for detecting the relative mating type of Pleurotus ostreatus strains to distinguish the relative mating type between the two parents;

[0028] S3: hybridizing one of the parent QHP315 with the two protoplast monokaryotes of the parent P2101 that are compatible, obtaining two hybrids, cultivating the two hybrids to produce mushrooms, and collecting spores;

[0029] S4: performing single spore separation on the spores collected in step S3, removing dikaryon strains with lock-like unions by microscopic examination, then removing monokaryon strains that do not carry the a-spore site using the primer combination shown in SEQ ID NO.13-SEQ ID NO.15, and finally performing mating type identification on all monokaryon strains carrying the a-spore site using the primer combination shown in SEQ ID NO.7-SEQ ID NO.10, thereby obtaining two spore monokaryon populations that carry the a-spore site and have a mating type identical to that of the P2101 protoplast;

[0030] S5: The two spore mononuclear populations are hybridized for the second time to obtain a hybrid population carrying a homozygous aspore-free site that is closest to P2101. This population is screened for fruiting to obtain a spore-free and high-yielding Pleurotus ostreatus strain.

[0031] Beneficial effects:

[0032] Compared with traditional breeding, the breeding method of this spore-free Pleurotus ostreatus strain can identify the spore-free genotype early based on InDel markers, and the screening efficiency is improved by at least 50%, avoiding the blindness of phenotypic screening; through molecular marker-assisted hybridization, the cycle of introducing the spore-free trait into excellent varieties is shortened from 4-6 years to 2-3 years; in addition, the identification of monokaryons is usually determined by microscopic examination to confirm the presence of a lock-like union, and the identification of the mating type of monokaryons requires a large amount of pairing and microscopic examination, and the workload increases with the increase in the number of monokaryon groups. Multiple rounds of mating usually take about 2 months and are prone to false detection due to human factors. The mating type molecular markers greatly accelerate this process and can select multiple spore-free Pleurotus ostreatus strains with excellent agronomic traits.

[0033] The present invention provides a sporeless Pleurotus ostreatus strain 3H02F79 and a breeding method thereof. The 3H02F79 strain exhibits superior agronomic traits to its sporeless parent, QHP315. Its spore production is sporeless, and its yield is 18.18% higher than that of its sporeless parent, QHP315. Compared with the commercial spore-bearing parent, P2101, the strain eliminates the harmful effects of spore release and exhibits no significant differences in mycelial growth rate or yield. Compared with its two parents, the 3H02F79 strain has the lowest contamination rate and the shortest tidal change time. Furthermore, plot and expanded trials have demonstrated that the 3H02F79 strain has a 100% fruiting rate, stable properties, and highly consistent phenotypes across different plots. This strain is a highly promising, industrialized sporeless cultivar. This invention is of great significance for enriching the edible fungi market, improving the competitiveness of edible fungi companies, and promoting the development of the edible fungi industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is the breeding roadmap for the Pleurotus ostreatus strain 3H02F79.

[0035] Figure 2 The figure shows the results of different karyotype differentiation of parental protoplasts using molecular markers PO1A2 and PO1B2, where A is the PCR amplification result of molecular marker PO1A2, B is the PCR amplification result of molecular marker PO1B2, and M is the molecular weight MarkerDL2000. The molecular weights of the three bands shown in the figure are 100 bp, 250 bp, and 500 bp from bottom to top, respectively.

[0036] Figure 3Figure 5 shows the typing and identification results of the molecular markers PO2A1 and PO2B1 for the parents P2101 and QHP315, where A is the identification result of the molecular marker PO2A1 at the mating type A locus for the parents P2101 and QHP315; B is the identification result of the molecular marker PO2B1 at the mating type B locus for the parents P2101 and QHP315; M in the figure is the molecular weight marker DL2000, and the molecular weights of the two bands shown in the figure are 100 bp and 250 bp from bottom to top, respectively.

[0037] Figure 4 This is the fruiting body morphology of the asporous strain 3H02F79.

[0038] Figure 5 This is the fruiting body morphology of the spore-forming parent P2101.

[0039] Figure 6 This is the fruiting body morphology of the asporous parent QHP315. DETAILED DESCRIPTION

[0040] The following is a clear and complete description of the technical solution of the present invention in conjunction with the accompanying drawings. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0041] Example 1

[0042] Breeding of Pleurotus ostreatus strain 3H02F79 (see Figure 1 )

[0043] (1) Parent strains: spore-forming parent P2101 and asporous parent QHP315.

[0044] The strains 'P2101' and 'QHP315' are strains that have been publicly deposited in the patent document with publication number CN118460784B and invention name: A molecular marker-assisted breeding method for identifying spore-free sites of Pleurotus ostreatus.

[0045] (2) Breeding methods:

[0046] The following steps are involved:

[0047] ① Protoplast uninucleation and mating type identification

[0048] The test strains P2101 and QHP315 were activated and cultured using the 7-point inoculation method. They were enzymatically hydrolyzed with 2% lytic enzyme for 30 min, and a protoplast suspension was prepared with 0.6 M mannitol. After gradient dilution, the suspension was spread on a regeneration medium plate. After incubation at 25°C in the dark for a period of time, the protoplasts were regenerated, and single colonies were isolated and transferred to PDA solid medium plates. They were cultured in the dark at 25°C, and single colonies were picked out and purified.

[0049] The resequencing data of P2101 and QHP315 were aligned to the reference genome PC9.15 (GenBank: GCA_029852705.2). The mating type A locus was located approximately in the region CM057205.1: 2530114-2544754 based on the locations of the homeodomain genes hd1 and hd2, as well as the closely associated mip and beta-fg genes in the PC9.15 annotation information. The mating type B locus was located approximately in the region CM057213.1: 1818424-1865476 based on the locations of multiple pheromone receptor ste genes.

[0050] Mutation sites identified by alignment between the two parents within 50 kb upstream and downstream of the mating type A and B loci were screened. InDel variants within these sites were selected, and sites that were heterozygous in strains P2101 and QHP315, with insertions / deletions greater than or equal to 10 bp, were identified. Ultimately, one InDel variant was selected for the mating type A locus at CM057205.1: 2587186, and one for the mating type B locus at CM057213.1: 1852867. Primers were developed upstream and downstream of these two variant sites using Primer3, resulting in the identification of two mating type molecular markers, PO1A2 and PO1B2. Detection primers were designed: PO1A2-F (5'-AATACTGCCCAGACGCTCAG-3'; SEQ ID NO. 1) and PO1A2-R (5'-TCGAGCGGAGTCTTTGAGTC-3'; SEQ ID NO. 2), and PO1B2-F (5'-GCAGTCGGGTGGTCAAAT-3'; SEQ ID NO. 3) and PO1B2-R (5'-AGTCGTTAAGCGCTCGTC-3'; SEQ ID NO. 4). The predicted amplified fragment sizes for the two different genotypes of molecular marker PO1A2 were 155 bp and 127 bp, respectively; and the predicted amplified fragment sizes for the two different genotypes of molecular marker PO1B2 were 398 bp and 300 bp, respectively.

[0051] The predicted amplified fragment sequence of PO1A2 is as follows:

[0052] AATACTGCCCAGACGCTCAGTCAGGACTCCGCAGACTGTCTGCGTTGAAGAGGACCAAAGAAAG AGGA ATGACCAAATTGCTCTTCAGTCTG GATGCCTCCTGGCTTCAGTCACGTGGTCTGTGGAGCCTAATGTGACTCAAAGACTCCGCTCGA, SEQ ID NO.5;

[0053] Among them, the underlined sequence is a deleted fragment with a length of 28 bp. Therefore, PO1A2 predicts that the full length of the amplified non-deleted sequence is 155 bp and the deleted sequence is 127 bp. The actual amplification results are as follows Figure 2 Shown in A is the PCR amplification result of the molecular marker PO1A2. The actual amplified fragment size is basically consistent with the prediction.

[0054] The predicted amplified fragment sequence of PO1B2 is as follows:

[0055] GCAGTCGGGTGGTCAAATCAAAAGACTCATATTTCATGGGCTTCTTCCGAGGTGTCAGACATTGGCGACACCGTATTGTCTTCGTTGTGAAACGTGTTCCTCCATTGCCCACTCCGAATTAGTCCCCTTTTCCCCATGTCTCGAGT CATTATATCAGACCCTCCTA CTAGTTTGTCCAAGAAAATAAGCATACTTGGTTTGAACGTTACTATGTATATTGATCAGAAGCCACTCTAACTGAAGTTTGAGATAGGAATGTTGTGCTTAAGGACGCGAGGGCGAGGTGGGGGAAAC G GCATAGAAGCGGGACAAGGACGTCGGCCAATCCCATGGTACGAACGGGGGAGGGATGTTGTCCCCTCACGTGTCTC C TTGCGTCGACGAGCGCTTAACGACT, SEQ ID NO.6;

[0056] The two underlined sequences are deletion fragments, which are 20 bp and 78 bp long respectively. The full length of the non-deleted sequence amplified by PO1B2 is 398 bp, and the length of the deleted sequence is 300 bp. The actual amplification results are shown in Figure 2. Figure 2Figure B shows the PCR amplification result of the molecular marker PO1B2. The missing band (less than 250 bp) in the actual amplified fragment is smaller than the predicted length (300 bp). Due to the presence of a large number of repetitive sequences at the mating B site, some reads will be incorrectly aligned when the resequencing data are aligned, resulting in the presence of aligned sequences at the originally missing fragment, causing the predicted length to be longer and the actual amplification result to be shorter. However, there is indeed an InDel variation at the marker development site. Although the amplification result is different from the predicted length, the amplification result does not affect the judgment of the genotype.

[0057] Figure 2 In the figure, lanes 1 and 2 are the protoplast monokaryotes '3015pm-2' and '3015pm-302' of two different karyotypes of strain P2101, lane 3 is P2101, lane 4 is QHP315, lanes 5 and 6 are the protoplast monokaryotes 'HPpm-1' and 'HPpm-93' of two different karyotypes of strain QHP315, respectively. It can be seen that the mating type molecular markers PO1A2 and PO1B2 can be used to distinguish the mating types of protoplast monokaryotes with different karyotypes within strains P2101 and QHP315, but cannot distinguish the mating types between strains because the amplified fragments of the two mating type sites of parents A and B are the same size, as shown in Figure 5. Figure 2 In A, strains 1 and 5 are the same size, but strains 1 and 5 are not necessarily of the same mating type.

[0058] ②Dialel hybridization and relative mating type identification between strains

[0059] Two protoplast mononuclear populations of each parent were subjected to complete diallel hybridization, and the pairing affinity results are shown in Table 1.

[0060] Table 1 Diallel hybridization results and mating type inference between parental protoplast monokaryons

[0061]

[0062] In naming the relative mating types of two strains, the two different karyotypes of one of the strains are usually named A1B1 and A2B2. Here, 'HPpm-1' is named A1B1 mating type, and 'HPpm-93' is named A2B2 mating type. Since '3015pm-302' is compatible with both 'HPpm-1' and 'HPpm-93', the mating type of '3015pm-302' can be named A3B3. '3015pm-2' is only compatible with 'HPpm-1' and not with 'HPpm-93', indicating that one of the A and B sites of the mating type of '3015pm-2' is the same as that of 'HPpm-93'. Therefore, the mating type of '3015pm-2' is A2B4 or A4B2. Figure 2The amplification results showed that the B site amplification results of '3015pm-2' and 'HPpm-93' were the same, but the A site amplification results were different, so it was speculated that the mating type of '3015pm-2' was more likely to be A4B2.

[0063] After determining the relative mating types of the strains, it was discovered that the molecular marker PO1A2 could not distinguish between A1 and A4, or A2 and A3, and that PO1B2 could not distinguish between B1 and B3. Therefore, an additional pair of molecular markers was developed to distinguish between hybrid offspring. Similar to the development methods for PO1A2 and PO1B2, variant sites identified by alignment of the two parents within 50 kb upstream and downstream of the mating type A and B loci on the genome were listed. Similarly, inDel variants within these variant sites were selected, but sites where both P2101 and QHP315 were homozygous and where P2101 and QHP315 had relative genotypes were selected. Insertions / deletions (IDs) were also 10 bp or greater. Finally, two inDel variants were selected: one at CM057205.1: 2566488 for mating type A and one at CM057213.1: 1829569 for mating type B. Primers were developed upstream and downstream of these two variants using Primer3, resulting in two molecular markers, PO2A1 and PO2B1. The predicted amplified fragment sizes for the two different genotypes of PO2A1 were 175 bp and 165 bp, respectively; and the predicted amplified fragment sizes for the two different genotypes of PO2B1 were 161 bp and 134 bp, respectively.

[0064] Detection primers for PO2A1:

[0065] PO2A1-F: 5'-CCCAATCTACATGCTGGGCT-3'; SEQ ID NO.7;

[0066] PO2A1-R: 5'-ATGGTGGCTTGCGAAGTGTA-3'; SEQ ID NO. 8.

[0067] Detection primers for PO2B1:

[0068] PO2B1-F: 5'-CAACCAAGCCTGAGCCAACT-3'; SEQ ID NO.9;

[0069] PO2B1-R: 5'-TAGGAGATGCGATGGAGCGT-3'; SEQ ID NO. 10.

[0070] The predicted amplified fragment sequence of PO2A1 is as follows:

[0071] CCCAATCTACATGCTGGGCTTGAGCTGGGCTAGAGGGTAGAACTCCGTGGATTTCTTTGGTG CAGGCG CTGG CCCAAATGCGGTCGTGCCTGTGACTGTCACGTGATGTGATGGCACGCGATTGTGACTAATTGTGGCGCCTGACTTGCCTTTGTACACTTCGCAAGCCACCAT, SEQ ID NO.11;

[0072] Among them, the underlined sequence is a deleted fragment with a length of 10 bp. Therefore, PO2A1 predicts that the full length of the amplified non-deleted sequence is 175 bp and the deleted sequence is 165 bp. The actual amplification results are as follows Figure 3 Shown in middle A is the PCR amplification result of the molecular marker PO2A1. The actual amplified fragment size is basically consistent with the prediction.

[0073] The predicted amplified fragment sequence of PO2B1 is as follows:

[0074] CAACCAAGCCTGAGCCAACTTGCAACACACGCCCCCAACTGGTCCGTCTCATCATACTACTAACTAGCTAGTACTACGGAC GTCGTCGAGCCTGGCGAAGGTCTTGCT CCTCTGAGTCTGCACCTTTCTCCCGTCACGCGCACGCTCCATCGCATCTCCTA, SEQ ID NO.12;

[0075] The underlined sequence is a missing fragment with a length of 27 bp. The full length of the non-missing sequence amplified by PO2B1 is 161 bp, and the missing sequence is 134 bp long. The actual amplification results are shown in Figure 2. Figure 3 Shown in B is the PCR amplification result of the molecular marker PO2B1. The actual amplified fragment size is basically consistent with the prediction.

[0076] The detection primers PO2A1 and PO2B1 were used to identify the parents P2101 and QHP315. The results are as follows: Figure 3As shown in the figure, A is the identification result of the molecular marker PO2A1 at the mating type A site for the parents P2101 and QHP315, 1 is the same band of the mating types A3 and A4 of P2101, and 2 is the same band of the mating types A1 and A2 of QHP315. Therefore, A1 and A4, as well as A2 and A3, can be distinguished by this marker; B is the identification result of the molecular marker PO2B1 at the mating type B site for the parents P2101 and QHP315, 1 is the same band of the mating types B2 and B3 of P2101, and 2 is the same band of B1 and B2 of QHP315. Therefore, B1 and B2, as well as B2 of P2101 and B3 of QHP315, can be distinguished by this marker; M is the molecular weight marker DL2000, and the molecular weights of the two bands shown in the figure are 100 bp and 250 bp from bottom to top, respectively. bp, and the size of the amplified band matched the predicted amplification product size of the two molecular markers PO2A1 and PO2B1. The mating type molecular markers PO1A2 and PO1B2 can be used to distinguish the mating type of the hybrid offspring of the two parents.

[0077] ③ Construction of first-generation hybrid strains

[0078] One of the protoplast monokaryons of QHP315, 'HPpm-1' (the monokaryon mating type A1B1 is compatible with both protoplast monokaryons of 'P2101') was hybridized with two protoplast monokaryons of P2101, respectively, to obtain hybrid offspring '3H01-1' ('HPpm-1' × '3015pm-2') and '3H01-2' ('HPpm-1' × '3015pm-302'). They were cultivated for fruiting and spores were collected.

[0079] ④ Isolation of spore monokaryons and identification of asporeless sites and mating type identification

[0080] Spores ejected from mature fruiting bodies of '3H01-1' and '3H01-2' were collected and prepared into spore suspensions with sterile water. After gradient dilution, spores were spread onto complete medium plates. After incubation at 25°C in the dark for a period of time, spores germinated. Mycelia from single spores were separated and transferred to PDA solid medium plates. They were incubated at 25°C in the dark, and single colonies were picked out.

[0081] First, the presence of a lock-like union was observed under a microscope, and dikaryon strains with a lock-like union were removed.

[0082] Then, the primer combination for identifying the aporia site of Pleurotus ostreatus strains described in Chinese invention patent CN202410927401.5 (sppo1: 5'-TAGATGTTGCACGGGAGAC-3'; SEQ ID NO. 13; sppo2: 5'-ATCCATTTAGTGCCACAATC-3'; SEQ ID NO. 14; sppo3: 5'-CAACTGAACACTCCCCAATA-3'; SEQ ID NO. 15) was used to identify whether the spore monokaryon carries the aporia site, and the monokaryon strains that do not carry the aporia site were removed.

[0083] Finally, the mating type molecular marker developed in step ② was used to identify the mating type of all monokaryotic strains carrying the asporulation site, thereby obtaining the mating type of the monokaryotic strains carrying the asporulation site. For '3H01-1', the spore-bearing monokaryotic strains with mating type A4B2 were retained, while for '3H01-2', the spore-bearing monokaryotic strains with mating type A3B3 were retained.

[0084] ⑤ Construction and screening of the second-generation hybrid population

[0085] The two asporeless, monokaryotic populations of mating types A4B2 and A3B3 obtained in the previous step were hybridized. Strains from each population were randomly selected, paired, and inoculated in the center of a PDA plate and incubated in a 25°C incubator. When the hyphae intermingled, the hyphae at the junction were removed and microscopically examined for the lock-like union structure, yielding a second-generation hybrid population. After purification, 47 hybrid offspring strains with stable growth and lock-like unions were obtained. Fifteen of the 47 strains produced normal mushrooms, all exhibiting the asporeless trait.

[0086] Table 2 shows the results of measuring and comparing the mycelial growth rate (HGS), conidiation characteristics (ST), bag filling time (PT), budding time (XT), single bag yield (YP), cap color (CC), cap shape (CS) and contamination rate (CR) of the 15 strains and their parents.

[0087] Mycelial growth rate: The mycelial growth on the 3rd to 5th day was measured by the cross-streaking method on a plate, and the average daily growth rate was calculated.

[0088] Spore production characteristics: Select the leaves of the oyster mushroom with fully expanded caps, place the fruiting body leaves on a black background, cover with a paper box and let it stand for 1 day, and take a spore print comparison picture.

[0089] Bag filling time: the number of days required for the mycelium to fill the entire bag after the spawn is inoculated into the bag.

[0090] Bud appearance time: the time from when the mushroom bags are put on the shelves to when the buds appear.

[0091] Yield per bag: Harvest the first batch of oyster mushrooms when they are 80% mature, weigh the fresh weight of the fruiting bodies in each bag, and take the average value.

[0092] Cap color: 1: brown; 2: gray-brown

[0093] Cap shape: 1: trumpet-shaped; 2: spherical; 3: mixed; 4: fan-shaped

[0094] Contamination rate: the ratio of contaminated packages to the total number of vaccination packages.

[0095] Table 2 Comparison of agronomic traits of parents and second-generation hybrid populations

[0096]

[0097] Among the above strains, 3H02F79 has the closest agronomic characteristics to its parent, P2101. The strain's fruiting bodies are non-spore-forming; the fruiting bodies are clustered or superimposed; the cap is fan-shaped, gray-brown; the gills are regularly arranged; the yield is high, consistent, short, and rapid (see Figure 4 ). The fruiting body morphology of parent P2101 is as follows Figure 5 As shown, the fruiting body morphology of the parent QHP315 is as follows Figure 6 shown.

[0098] The strain 3H02F79 was deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: M2025718, the deposit address was Wuhan, China, the deposit date was April 7, 2025, and the classification name was Pleurotusostreatus 3H02F79.

[0099] Example 2

[0100] Comparison of agronomic traits between the Pleurotus ostreatus strain 3H02F79 and its parents

[0101] (1) Test strains: P2101, QHP315, and 3H02F79

[0102] (2) Experimental methods:

[0103] ①Strain cultivation and mushroom production management:

[0104] PDA mother culture medium: 200 g potatoes, 20 g glucose, 1 L water, natural pH, used for culturing plate / test tube mother cultures.

[0105] The formula of the branch original seed culture medium is: 89% of wood branches, 10% of bran, 1% of gypsum, and a water content of 60% to 65%; the wood branches are broad-leaved hard miscellaneous woods, φ4-6 mm, and 18-22 cm in length.

[0106] The culture medium formula of the cultivation bag is: 30% cottonseed hull, 48% corn cob, 18% bran, 2% soybean meal, 1% gypsum, 1% lime, and 63% water content.

[0107] The test strain was activated and cultured in PDA stock culture medium to prepare a PDA stock culture. This was then inoculated into the branch stock culture medium. Once the stock culture matured, it was inoculated into cultivation bags (the culture medium was placed in a blender according to the recipe, mixed evenly with water to a moisture content of 65%, and then filled using an automatic bagging machine and sealed with a matching plastic cap. The culture medium was placed into 6 cm × 18 cm high-pressure polypropylene bags, each containing 1400-1450 g of material. The bags were then sterilized by autoclaving at 121°C for 2 hours. After sterilization, the bags were moved to a pre-cooling room when the temperature dropped to 80°C. Once cooled to approximately 25°C, they were transferred via a conveyor to the inoculation room for sterile inoculation. Each bag was inoculated with one test tube seed / branch, with 250 bags inoculated for each variety. The bags were incubated indoors at 25°C in the dark, with a relative humidity below 60%-70% and a carbon dioxide concentration below 0.3%. Fruiting occurred after the mycelium filled the bags. Set up observation plots: Randomly select 24 spawn bags for each variety and place them adjacent to each other, creating two observation plots in different locations. The remaining spawn bags should be placed randomly. Fruiting temperature should be 8-16°C, relative humidity above 95%, light intensity 100-300 lx, and carbon dioxide concentration below 0.1%.

[0108] ② Determination of agronomic traits:

[0109] The mycelial growth rate (HGS), spore production (ST), bag filling time (PT), budding time (XT), single bag yield (YP), cap color (CC), cap shape (CS), contamination rate (CR), and tide turning time (TTT) of the mother strain were measured.

[0110] Growth rate of mother culture mycelium: The growth of mycelium on the 3rd to 5th day was measured by the cross-streaking method on the plate, and the average daily growth rate was calculated.

[0111] Spore production characteristics: Select the leaves of the oyster mushroom with fully expanded caps, place the fruiting body leaves on a black background, cover with a paper box and let it stand for 1 day, and take a spore print comparison picture.

[0112] Bag filling time: the number of days required for the mycelium to fill the entire bag after the spawn is inoculated into the bag.

[0113] Bud appearance time: the time from when the mushroom bags are put on the shelves to when the buds appear.

[0114] Yield per bag: Harvest the first batch of oyster mushrooms when they are 80% mature, weigh the fresh weight of the fruiting bodies in each bag, and take the average value.

[0115] Cap color: 1: brown; 2: gray-brown

[0116] Cap shape: 1: trumpet-shaped; 2: spherical; 3: mixed; 4: fan-shaped

[0117] Contamination rate: the ratio of contaminated packages to the total number of vaccination packages.

[0118] Tide change time: the time from the end of the first tide of mushroom picking to the appearance of mushroom buds in the second tide.

[0119] ③Data Analysis:

[0120] Microsoft Excel 2016 and SPSS 17.0 were used for data processing and analysis (see Table 3).

[0121] Table 3 Comparison of agronomic traits of parental and offspring strains

[0122]

[0123] As shown in the plot and expanded trials, strain 3H02F79 outperformed its non-sporing parent, QHP315, in all agronomic traits. Its sporulation was non-sporing, resulting in an 18.18% increase in yield compared to its non-sporing parent, QHP315. Compared to the commercial sporulating parent, P2101, it eliminated the risk of spore release and showed no significant differences in mycelial growth rate or yield. Among the three tested varieties, strain 3H02F79 had the lowest contamination rate and the shortest tidal change time. Furthermore, in the plot and expanded trials, 3H02F79 demonstrated a 100% fruiting rate, stable properties, and highly consistent phenotypes across different plots.

[0124] In summary, strain 3H02F79 is a highly promising industrialized spore-free cultivar. The 3H02F79 strain and its breeding methods are of great significance for enriching the edible fungi market, improving the competitiveness of edible fungi enterprises, and promoting the development of the edible fungi industry.

Claims

1. A Pleurotus ostreatus strain 3H02F79, characterized in that The Pleurotus ostreatus strain 3H02F79 was deposited in the China Center for Type Culture Collection on April 7, 2025, with the deposit address in Wuhan, China, the deposit number is CCTCCNO: M2025718, and the classification name is Pleurotus ostreatus 3H02F79.

2. A mycelium and / or fruiting body of Pleurotus ostreatus, characterized in that: The product is obtained by growing and developing the Pleurotus ostreatus strain 3H02F79 as described in claim 1.

3. The use of the Pleurotus ostreatus strain according to claim 1, or the mycelium and / or fruiting body according to claim 2, characterized in that: The application is at least one of the following: A. Application as a parent in hybrid breeding; B. Strain propagation; C. Fruiting body production; D. Food processing.

4. A primer combination for detecting different karyotypes of the protoplasts of the Pleurotus ostreatus strain according to claim 1, characterized in that: The primer combination is the sequence shown in SEQ ID NO.1-SEQ ID NO.4 and the sequence shown in SEQ ID NO.7-SEQ ID NO.

10.

5. The use of the primer combination according to claim 4 in the identification of Pleurotus ostreatus varieties, characterized in that: The varieties of Pleurotus ostreatus are P2101, QHP315 and their progeny, the deposit number of P2101 is CCTCC NO: M 2024998, and the deposit number of QHP315 is CCTCC NO: M 2024997; The application is to identify different karyotypes of protoplasts of Pleurotus ostreatus strains.

6. The method for cultivating the Pleurotus ostreatus strain 3H02F79 according to claim 1, characterized in that: The following steps are involved: S1: Activate and culture the strain 3H02F79 in PDA mother culture medium to prepare PDA mother culture; S2: inoculating the PDA mother seed into the shoot stock culture medium to prepare the shoot stock; S3: Inoculate the branch stock into the culture medium in the cultivation bag, place it in the dark at 25℃, with a relative humidity of 60%-70%, and a carbon dioxide concentration below 0.3%. After the mycelium fills the bag, mushrooms will be produced. The fruiting temperature is 8-16℃, the relative humidity is above 95%, the light intensity is 100-300lx, and the carbon dioxide concentration is below 0.1%.

7. The cultivation method according to claim 6, characterized in that The PDA mother culture medium is: 200g potato, 20g glucose, 1L water, natural pH; The branch stock culture medium is: 89% wood branches, 10% bran, 1% gypsum, and a water content of 60%-65%; The cultivation bag culture material comprises: 30% cottonseed hulls, 48% corn cobs, 18% bran, 2% soybean meal, 1% gypsum, 1% lime, and has a water content of 63%.

Images