Ganoderma lucidum transcription factor Zn-8 and derivative thereof, and application and method of ganoderma lucidum transcription factor Zn-8 in synthesis of ganoderic acid
By constructing the genes of Ganoderma lucidum transcription factors Zn-8, SQS and LSS into the recombinant vector and introducing them into cells, activate the expression of SQS and LSS genes, the problem of low increase in Ganoderma lucidum synthesis in the prior art was solved, and a significant increase in Ganoderma lucidum content was achieved.
Patent Information
- Application Number
- CN202510209540.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-25
- Publication Date
- 2025-06-10
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
In the prior art, the synthesis of Ganoderma lucidum transcription factor does not increase the amount of Ganoderma lucidum acid in Ganoderma lucidum, and it is difficult to effectively increase the content of Ganoderma lucidum in Ganoderma lucidum.
The Ganoderma lucidum transcription factor Zn-8 and its derivatives are provided, and their genes, Ganoderma lucidum SQS gene and Ganoderma lucidum LSS gene are constructed onto the recombinant vector, and introduced into cells to activate SQS and LSS gene expression and improve the synthesis of Ganoderma lucidum acid.
By enhancing the expression of SQS and LSS genes, the content of Ganoderma lucidum in Ganoderma lucidum has been significantly improved, and effective regulation of Ganoderma lucidum synthesis pathway has been achieved.
Smart Images

Figure CN120118922A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering, relates to Ganoderma lucidum transcription factors, and particularly relates to Ganoderma lucidum transcription factor Zn-8 and its derivatives and their applications and methods in ganoderic acid synthesis. Background Art
[0002] Ganoderma lucidum is a traditional large edible and medicinal fungus in China, with effects such as replenishing qi and calming the mind, relieving cough and asthma. Ganoderma lucidum contains a variety of bioactive components and has extremely high nutritional and health care value and economic development prospects. Triterpenoids are the main bioactive secondary metabolites in Ganoderma lucidum, among which ganoderic acids, abbreviated as GAs, are the core components of the medicinal efficacy of Ganoderma lucidum. Research shows that ganoderic acids play important roles in tumor treatment, antioxidant, inhibition of cholesterol synthesis, inhibition of angiotensin-converting enzyme activity, inhibition of histamine release, anti-HIV, etc.
[0003] However, the current main way to obtain ganoderic acids is to extract them from Ganoderma lucidum fruiting bodies and spores, and the content of ganoderic acids in Ganoderma lucidum is relatively low. Therefore, analyzing the biosynthetic pathway of ganoderic acids and its regulatory mechanism is of great significance for cultivating Ganoderma lucidum varieties with high yields of ganoderic acids.
[0004] Ganoderic acids are synthesized with acetyl-CoA as the precursor substance through the mevalonate pathway (MVA). In the MVA pathway, there are two important branches in the synthesis of ganoderic acids. One branch is from farnesyl pyrophosphate to geranylgeranyl pyrophosphate, and the other branch is from farnesyl pyrophosphate to lanosterol. The key genes cloned and reported in these two branches are FPS, MVD, AACT, LS, HMGR, HMGS, IDI, SQS, and OSC genes. These genes directly regulate the synthesis of ganoderic acids and are the key to the synthesis and accumulation of ganoderic acids. Among them, squalene synthase (SQS) is the first key enzyme that catalyzes the conversion of the MVA pathway to triterpenoid biosynthesis and is also a key enzyme involved in the synthesis and metabolism of ganoderic acids. Squalene synthase can catalyze the carbon flow in the isoprenoid pathway to triterpenoid biosynthesis. The activity of SQS is related to the yield of triterpenoid compounds such as squalene and is a key enzyme in the synthesis process of triterpenoid compounds such as squalene. In recent years, studies have cloned and constructed vectors for the SQS genes of different plants such as ginseng, rice, and Paris polyphylla, etc., achieving the exploration of the mechanism of triterpenoid compound synthesis in plants at the molecular level and the exploration of the optimal conditions for gene expression through gene transformation. Lanosterol synthase (LSS) is a key enzyme in the biosynthetic pathway of ganoderic acid compounds, catalyzing the conversion of (S)-2,3-epoxysqualene into lanosterol. Lanosterol is a precursor compound for the synthesis of ganoderic acids and catalyzes the synthesis of structurally diverse ganoderic acid compounds under the modification of different oxidases.
[0005] The prior art CN119061025A discloses that the Ganoderma transcription factor C3H-2 can activate the expression of the Ganoderma SQS gene and LSS gene, increasing the content of ganoderic acids in Ganoderma. The disadvantage of this technology is that the increase in the synthesis of ganoderic acids is not high.
[0006] Tu Junliang et al. (Tu Junliang. Research on the Regulation of Ganoderic Acid Biosynthesis by the Calcineurin-responsive Zinc Finger Transcription Factor CRZ1 in Ganoderma lucidum [D]. Kunming University of Science and Technology, 2021.) constructed the crz1 gene-silenced and overexpressed engineering strains CRZ1SI and CRZ1OE, and carried out liquid static fermentation cultures on CRZ1SI, CRZ10E, and wild-type (WT) strains respectively. At 10 mM Ca 2+Under the conditions, the silencing of crz1 significantly reduced the content of ganoderic acid in static liquid fermentation culture, while the overexpression of crz1 significantly increased the content of ganoderic acid in static liquid fermentation culture. The results of fluorescence quantitative PCR showed that the transcriptional levels of farnesyl pyrophosphate synthase gene and squalene synthase gene in the CRZ1si strain were significantly lower than those in the WT strain; the transcriptional levels of fps and Is in the CRZ1OE strain were significantly higher than those in the WT strain throughout the static liquid fermentation culture. The above results indicate that the silencing and overexpression of crz1 significantly affect the accumulation of ganoderic acid and the transcriptional levels of genes related to ganoderic acid synthesis. The mechanism of crzl regulating ganoderic acid biosynthesis was studied, and the results showed that CRZ1 binds to the promoter of the ganoderic acid synthesis-related gene fps. The disadvantage of this technology is that the increase in ganoderic acid synthesis is not high. Summary of the Invention
[0007] The present invention aims at the problem that the improvement of ganoderic acid synthesis by Ganoderma transcription factors in the prior art is not high, and provides a Ganoderma transcription factor Zn-8, its derivatives, and their applications and methods in ganoderic acid synthesis. The nucleotide sequence of the Ganoderma transcription factor Zn-8 provided by the present invention is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO.2; constructing the Ganoderma transcription factor Zn-8 gene, the Ganoderma SQS gene, and the Ganoderma LSS gene into a recombinant vector and introducing it into cells can activate the expression of the Ganoderma SQS gene and the Ganoderma LSS gene and increase the content of ganoderic acid in Ganoderma.
[0008] To achieve the above object, the technical solution adopted by the present invention is as follows:
[0009] On the one hand, the present invention provides a Ganoderma transcription factor Zn-8, and the nucleotide sequence of the Ganoderma transcription factor Zn-8 is the sequence shown as SEQ ID NO.1.
[0010] In some embodiments, the nucleotide sequence of the Ganoderma transcription factor Zn-8 is a sequence having a sequence similarity of more than 80% with SEQ ID NO.1.
[0011] On the other hand, the present invention provides a recombinant vector, and the recombinant vector contains the above-mentioned Ganoderma transcription factor Zn-8.
[0012] Preferably, the recombinant vector includes a plasmid, a phage, or a virus.
[0013] Preferably, the recombinant vector is a plasmid.
[0014] Preferably, the plasmid includes pGADT7-AD or pGreenII 62-SK.
[0015] Preferably, when the plasmid is pGADT7-AD, the primers for amplifying Ganoderma lucidum transcription factor Zn-8 are shown in SEQ ID NO.5-6; when the plasmid is pGreenII 62-SK, the primers for amplifying Ganoderma lucidum transcription factor Zn-8 are shown in SEQ ID NO.7-8.
[0016] On the other hand, the present invention provides a cell comprising the above-mentioned Ganoderma lucidum transcription factor Zn-8 or the above-mentioned recombinant vector.
[0017] Preferably, the cell is a genetically engineered bacterium, and the genetically engineered bacterium includes Escherichia coli, yeast, Agrobacterium, actinomycetes or filamentous fungi.
[0018] On the other hand, the present invention provides the application of the above-mentioned Ganoderma lucidum transcription factor Zn-8 in regulating the expression of Ganoderma lucidum SQS gene or Ganoderma lucidum LSS gene.
[0019] On the other hand, the present invention provides a method for synthesizing ganoderic acid, and the method is biosynthesis by the above-mentioned Ganoderma lucidum transcription factor Zn-8, the above-mentioned recombinant vector or the above-mentioned cell.
[0020] On the other hand, the present invention provides the application of the above-mentioned Ganoderma lucidum transcription factor Zn-8, the above-mentioned recombinant vector, the above-mentioned cell or the above-mentioned method in the synthesis of ganoderic acid.
[0021] Compared with the prior art, the present invention has the following beneficial effects:
[0022] 1. The present invention constructs the Ganoderma lucidum transcription factor Zn-8 gene, Ganoderma lucidum SQS gene and Ganoderma lucidum LSS gene onto a recombinant vector and introduces them into cells, which can enhance the expression of Ganoderma lucidum SQS gene and Ganoderma lucidum LSS gene and increase the content of ganoderic acid in Ganoderma lucidum.
[0023] 2. Ganoderma lucidum transcription factor Zn-8 can regulate the key enzyme genes involved in the synthesis and metabolism of ganoderic acid, thereby realizing the regulation of the content of ganoderic acid in Ganoderma lucidum. Description of the Drawings
[0024] Figure 1 Heat map of Zn-8 gene expression level.
[0025] Figure 2 Map of recombinant vector pGADT7-Zn-8.
[0026] Figure 3 Map of recombinant vector pGreenII-62sk-Zn-8.
[0027] Figure 4Results of yeast one-hybrid assay. Among them, A: In the control group, the recombinant vector pAbAi-SQS and the empty vector pGADT7-AD were co-transformed into yeast competent cells; in the experimental group, the recombinant vector pAbAi-SQS and the recombinant vector pGADT7-Zn-8 were co-transformed into yeast competent cells. B: In the control group, the recombinant vector pAbAi-LSS and the empty vector pGADT7-AD were co-transformed into yeast competent cells; in the experimental group, the recombinant vector pAbAi-LSS and the recombinant vector pGADT7-Zn-8 were co-transformed into yeast competent cells.
[0028] Figure 5 Results of dual-luciferase reporter assay; A shows the results of dual-luciferase reporter assay. ** indicates a significant difference between the 62SK + SQS group and the Zn-8 + SQS group (p value < 0.01), and *** indicates a highly significant difference between the 62SK + LSS group and the Zn-8 + LSS group (p value < 0.001); B shows the fluorescence imaging results, where Znclus-8 is Zn-8. Specific implementation manners
[0029] The technical solutions in the embodiments of the present invention will be clearly and completely described below; obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0030] The Zn-8, SQS and LSS genes in the present invention are all derived from Ganoderma lucidum.
[0031] Example 1: Screening of key genes for ganoderic acid synthesis regulation based on transcriptome
[0032] 1) Mass spectrometry imaging was used to detect the content of ganoderic acid in tissue parts such as the shell layer, cuticle layer and flesh layer of Ganoderma lucidum.
[0033] 2) Based on single-cell transcriptome data, gene family members related to ganoderic acid synthesis in Ganoderma lucidum were identified, and the key enzyme protein sequences catalyzing the formation of ganoderic acid from lanosterol in the ganoderic acid biosynthesis pathway were preliminarily screened.
[0034] 3) Based on the transcriptome data of different tissue parts of Ganoderma lucidum, through gene expression difference analysis, the key genes catalyzing the formation of ganoderic acid from lanosterol in the ganoderic acid biosynthesis pathway in Ganoderma lucidum were further screened.
[0035] 4) Perform a correlation analysis between the second-generation transcriptome data and the genes in the ganoderic acid biosynthetic pathway, and screen out the gene Zn-8 that promotes ganoderic acid synthesis; the nucleotide sequence of the Ganoderma lucidum transcription factor Zn-8 is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2. The heat map of its gene expression level is shown in Figure 1 , and it can be seen that the expression level of Zn-8 in the mycelium is the highest.
[0036] Example 2: Yeast one-hybrid experiment
[0037] To identify whether Zn-8 can directly regulate the SQS and LSS genes, first verify through a yeast one-hybrid experiment:
[0038] (1) Construct a recombinant vector
[0039] Using the gDNA of the Ganoderma lucidum variety Xianzhi No. 2 as a template, clone the promoter region of 2000 bp before the start codon ATG of the SQS gene (the nucleotide sequence is shown in SEQ ID NO.3), and construct it onto the pAbAi vector (manufacturer: Shanghai Zeye Biotechnology Co., Ltd.; product number: ZY8159; insertion site: HindIII, XmaI) to obtain the recombinant vector pAbAi-SQS. The primer sequences for amplifying the promoter region of the SQS gene are shown in SEQ ID NO.9-10:
[0040] SEQ ID NO.3:
[0041]
[0042] TTTCCAGGGGGGGTACGCTTTATGATCTACATTGAGAAGTACACAACGTGTCGGGGGC
[0043] GTACTGAAAATAGGAAACGGTGCAACCGCGGCCCGAGCTCCAGATCACTGGTATCGAC
[0044] TCGCTTGACCAGTCCAGTTGAGGTATGAACTACCTCGATGGGACGCAAGATAGCTCCT
[0045] CGCAAATAGTGGTGATCATACGACTCTTGAACGACTTGAATGCCGAATCTCACGTCAC
[0046] GACGCCCAGATAGCGACAAACGTGAGGCCACCGATGGTAGTCCGACGTGCAGACGCA
[0047] TGGTCTCTGTCTGAGGTGAGGTGATCAGTTGAAGGGTTCCATGAAACGATATGAAGGC
[0048] AGACCTCAGCTGGCTTGGGAATGTTCGTCATTTAGGGCATCTGCAAGCTTCTGCAATTG
[0049] GACGGAAGTGGTCGTCTCACCGCTGTTCTTGGCAAGGTTGCGAGTGCGGAAGCGATGG
[0050] AGAAAGCTGTCAAGACGTTTTTGGGCAACGTCGGACGAGATTTGCTGGACAGAGACGG
[0051] TTTGGAGACGGAGAGGCGGAGTCAAGGCGGCGTCGGACATGGCAGTATGGTGGCAGG
[0052] ATTGTGAAGGTTGAAGCAGTCGCGATGCCTGCTCGAGCAACGATTGAAAACTCTGCAT
[0053] GAGGCGGGCCGGTCACGTGCGGGTGGATGTGGTACGACCGCGAAATTCGGAATGACTG
[0054] AAAGGCGGTCGGTCGTCTCCCCGCGGTCTGCAGTCTCAGTCTCAGTCTCGCCAGCGTGT
[0055] CTCCCCCTGCTCACCGGCACCTCCAGGCCCTTCTTCCCCGCATCTCTATCTTTATTCTACTACCAACTCTTTCGTCATA;
[0056] F: 5'-TAGGGTCTGCTCGATTTTCG-3' (SEQ ID NO.9);
[0057] R: 5'-TATGACGAAAGAGTTGGTAG-3' (SEQ ID NO.10).
[0058] Using the gDNA of Ganoderma lucidum variety Xianzhi No. 2 as a template, the promoter region of 2000 bp before the start codon ATG of the LSS gene was cloned. The region from 788 bp to 1568 bp upstream of LSS was selected as the promoter region, and the sequence of LSS was obtained. The sequence of LSS is shown in SEQ ID NO.4. The primer sequences for amplifying the LSS sequence are shown in SEQ ID NO.11 - 12, and they were constructed onto the pAbAi vector (manufacturer: Shanghai Zeye Biotechnology Co., Ltd.; product number: ZY8159; insertion sites: HindIII, XmaI) to obtain the recombinant vector pAbAi-LSS.
[0059] SEQ ID NO.4:
[0060] CCCACGGAGCCGATGTCGGCATGGAAAGGGCAGTACGTGGTACCCGCCCTTGCAGGTCACCTTCCCAACCTCGAATCACTCTCCCTTCGCGTCAATTGGATGCAGTGCCCACCACATCCCTCAACTTTCGGGATGTTCTCTCAATTCACCTCTCTTCGTGAACTGCGATTGTGGACATGCCGCTTCCCGTCTTTCTCAACATTGCGGCGTATCCTCGTCTCCCTACCTGCGCTAGAGAGTTTGAGTTGTTCCCTCGACGAGTCGCCTTCTGCGCCTCAGGCCTCCATTTTGACTATCCCATCCAAGCGACCTGCATTGAAGGCCTTGAATATGGCTTTACATTGTCCCAGCTTTACGTTGGCCGTTTTGGAGTGGCTCATCCATACTCCGACACGTTCGATGCTCGTAGATTTAGACCTTCATCTTATCCAGTTTCCATCAGCGCATCGGAATACGCTCCCCAACCGGACACTCAACTACTATGCACAAACCTTTGCTCCTTCCCTCCGTAAGGCGACCTTCGGCTGGATTCAAAGCACGACATGTGGGTCAATATTTCCCTCGATCATGGCTCATGTTGAACTTTTCGCATCGTTCAGACA;
[0061] F: 5'-CCCACGGAGCCGATGTC-3'(SEQ ID NO.11);
[0062] R: 5'-TGTCTGAACGATGCG-3'(SEQ ID NO.12).
[0063] Using the cDNA of Ganoderma lucidum variety Xianzhi 2 as a template, the full-length coding region of the Zn-8 gene was cloned (the sequence of Zn-8 is shown in SEQ ID NO.1), and the homologous recombination primer sequences used for amplifying Zn-8 are shown in SEQ ID NO.5 and SEQ ID NO.6 respectively. It was constructed into the pGADT7-AD vector to obtain the recombinant vector pGADT7-Zn-8 (the plasmid map is shown in Figure 2 ).
[0064] SEQ ID NO.5: CCATGGAGGCCAGTGAATTCATGGCCTTTCGTAGA;
[0065] SEQ ID NO.6: CGATTCATCTGCAGCTCGAGTCATCTTCTTGCGTAC。
[0066] (2) Transfect cells
[0067] The recombinant vectors pAbAi - SQS and pAbAi - LSS were co - transfected with the pGADT7 - AD empty vector into the yeast competent cell YIH (manufacturer: Shanghai Jingkang Biotechnology Co., Ltd.; product number: JK - G8044) as the control group, and the recombinant vectors pAbAi - SQS and pAbAi - LSS were co - transfected with pGADT7 - Zn - 8 into the yeast competent cell YIH as the experimental group. They were respectively spread on the (SD / -ura / -leu) defective medium and cultured at 30 °C for 3 - 4 d. More than 10 positive clone bacteria were picked, cultured in SD / -ura / -leu liquid medium on a shaker at 30 °C until OD600>1.5, centrifuged at 1000 rpm for 2 min, the supernatant was discarded, and the cells were resuspended with sterile water to OD600≈0.2. Then they were spotted at the original concentration, 1 / 10, 1 / 100, and 1 / 1000 on the SD - leu / -ura solid medium containing AbA (Aureo basidin A) and cultured at 30 °C for 2 - 3 d. The results showed that on the SD / -ura / -leu defective medium, by adding 100 ng / mL of AbA to inhibit the self - activation of the promoter, it was found that the growth ability of the combinations of Zn - 8 co - transfected with SQS and LSS respectively was significantly better than that of the control (see Figure 4 ), indicating that in yeast cells, Zn - 8 can directly bind to the SQS and LSS promoters.
[0068] Example 3: Dual - luciferase reporter assay
[0069] In this example, the dual - luciferase system was used in tobacco to analyze the effect of Zn - 8 protein on the transcriptional activities of SQS gene and LSS gene. Recombinant vectors of pGreenII - 62sk - Zn - 8, pGreenII - 0800 - SQS, and pGreenII - 0800 - LSS promoters were constructed (manufacturer: Shanghai Zeye Biotechnology Co., Ltd.; product number: ZY6124; insertion site: HindIII, XmaI). The plasmid map of pGreenII - 62sk - Zn - 8 is shown in Figure 3 ). The primer sequences used for amplifying Zn - 8 are shown in SEQ ID NO.7 - 8; for constructing pGreenII - 0800 - SQS, the primer sequences used for amplifying the SQS coding gene are shown in SEQ ID NO.13 - 14; for constructing pGreenII - 0800 - LSS, the primer sequences used for amplifying LSS are shown in SEQ ID NO.15 - 16.
[0070] SEQ ID NO.7: CTAGAACTAGTGGATCCATGGCCTTTCGTAGA;
[0071] SEQ ID NO.8: CGGTATCGATAAGCTTCATCTTCTTGCGTAC;
[0072] SEQ ID NO.13: CGATAAGCTTTAGGGTCTGCTCG;
[0073] SEQ ID NO.14: TCCCCCGGGTATGACG;
[0074] SEQ ID NO.15: CGATAAGCTTCGACTGGCTCC;
[0075] SEQ ID NO.16: TCCCCCGGGGTCCAAAATG.
[0076] Transform the corresponding vectors of each group into the competent cells of Agrobacterium tumefaciens GV3101-pSoup-P19 (manufacturer: Shanghai Weidi Biotechnology Co., Ltd.; product number: AC1003M). Before use, streak and activate the Agrobacterium (pGreenII-62sk-Zn-8, pGreenII-0800-SQS, and pGreenII-0800-LSS promoters and bacterial liquid) stored at -80°C on an LB + 50 μg / mL kanamycin (Kan) + 25 μg / mL rifampicin (Rif) solid medium, then pick a single colony and inoculate it into 0.6 mL, and then inoculate it successively at a ratio of 1:100 into 5 mL and 20 mL of the above liquid medium and incubate overnight until the stationary phase OD600 > 2.0. Centrifuge at 5000 rpm for 10 min at room temperature, collect the cell pellet, resuspend it with 1×MMA solution and mix the bacterial liquid until the OD600 of the transcription factor and promoter is 0.5. Place it in the dark at room temperature for 3 h and then inject Nicotiana benthamiana. Select healthy Nicotiana benthamiana plants at 4 - 5 weeks old and keep them in the dark for 24 h. After injection, place them in the dark for 1 - 2 days, then place them in a 14 / 10 h light cycle for 3 - 4 days, and then select 0.5 cm 2The injection area was ground with 500 μL of Glo lysis buffer (manufacturer: Beijing Zhaosheng Laibo Trading Co., Ltd.; product number: 0000566337). After sufficient lysis, it was centrifuged at 12,000 rpm at 4 °C for 3 min. 50 μL of the supernatant was taken and reacted with 50 μL of the luciferin reaction substrate at room temperature for 10 min. The fluorescence value of firefly luciferase was measured with a microplate reader as a. Then, 50 μL of the stop solution was added and reacted for 10 min, and then the fluorescence value of Renilla luciferase was measured as b. Whether there is an interaction between the transcription factor and the promoter was calculated by the ratio of a / b. The results of the dual-luciferase reporter assay showed (see Figure 5 ), Zn-8 could activate the expression of SQS and LSS.
[0077] It should be understood that the various forms of the processes shown above can be used, steps can be reordered, added or deleted. For example, the steps described in the disclosure of the present invention can be executed in parallel, sequentially or in a different order, as long as the desired results of the technical solution disclosed in the present invention can be achieved, and no limitation is made herein.
Claims
1. A Ganoderma lucidum transcription factor Zn-8, characterized in that: The nucleotide sequence of the Ganoderma lucidum transcription factor Zn-8 is the sequence shown in SEQ ID NO.1, or a sequence having a sequence similarity of more than 80% with SEQ ID NO.
1.
2. A recombinant vector, characterized in that: The recombinant vector comprises the Ganoderma lucidum transcription factor Zn-8 described in claim 1.
3. The recombinant vector according to claim 2, characterized in that The recombinant vector includes plasmid, phage or virus.
4. The recombinant vector according to claim 3, characterized in that The recombinant vector is a plasmid, and the plasmid includes pGADT7-AD or pGreenII62-SK.
5. The recombinant vector according to claim 4, characterized in that When the plasmid is pGADT7-AD, the primers for amplifying the Ganoderma transcription factor Zn-8 are shown in SEQ ID NOs.5-6; when the plasmid is pGreenII62-SK, the primers for amplifying the Ganoderma transcription factor Zn-8 are shown in SEQ ID NOs.7-8.
6. A cell comprising the Ganoderma transcription factor Zn-8 according to claim 1 or the recombinant vector according to any one of claims 2 to 5.
7. The cell according to claim 6, characterized in that The cell is a genetically engineered bacterium, which includes Escherichia coli, yeast, Agrobacterium, actinomycetes or filamentous fungi.
8. Use of the Ganoderma lucidum transcription factor Zn-8 according to claim 1 in regulating the expression of Ganoderma lucidum SQS gene or Ganoderma lucidum LSS gene.
9. A method for synthesizing ganoderic acid, characterized in that: The method comprises carrying out biosynthesis through the Ganoderma transcription factor Zn-8 described in claim 1, the recombinant vector described in any one of claims 2 to 5, or the cell described in any one of claims 6 to 7.
10. Use of the Ganoderma transcription factor Zn-8 according to claim 1, the recombinant vector according to any one of claims 2 to 5, the cell according to any one of claims 6 to 7, or the method according to claim 9 in the synthesis of ganoderic acid.
Citation Information
Patent Citations
Phellinus baumii MADS-box transcription factor PbMADS1 as well as coding gene and application thereof
CN113429465A
Application of oyster mushroom MADS-box gene to improvement of multiple stress resistance of saccharomyces cerevisiae
CN117467676A
Ganoderma lucidum transcription factor C3H-2, and application and method thereof in ganoderic acid synthesis
CN119061025A
Regulated biocircuit systems
US20190192691A1
Methods for improving traits in plants
US20200115704A1