MFS gene mutant, recombinant vector, recombinant bacteria and their applications

By performing site-directed mutation of the MFS gene to construct recombinant vectors and transforming Corynebacterium glutamate, the problem of low L-arginine yield in microbial fermentation was solved, and efficient production and cost savings were achieved.

CN120118923BActive Publication Date: 2025-08-08ZHUCHENG DONGXIAO BIOTECH CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510602136.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-12
Publication Date
2025-08-08
Estimated Expiration
2045-05-12

AI Technical Summary

Technical Problem

The existing strains produced by L-arginine by microbial fermentation methods have low acid production levels and unstable fermentation performance, making it difficult to effectively increase the production of L-arginine.

Method used

By performing site-directed mutation of the MFS gene, A at position 686 of the nucleotide sequence is mutated into C, recombinant vector is constructed and Corynebacterium glutamate is transformed to form an engineered strain expressing MFS gene mutants, and the production of L-arginine is increased using homologous recombination technology.

Benefits of technology

It significantly increases the production of L-arginine, saves fermentation time and cost, and reduces the chance of bacterial infection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120118923B_ABST
    Figure CN120118923B_ABST
Patent Text Reader

Abstract

The present invention provides a MFS Gene mutants, recombinant vectors, recombinant bacteria and their applications belong to the field of bioengineering technology. MFS Gene mutants, MFS The gene was subjected to site mutation, and the nucleotide A at position 686 of the nucleotide molecule was mutated to C. The nucleotide sequence after site-directed mutagenesis is shown in SEQ ID NO.1. The present invention constructed a mutant expressing MFS A686C Gene recombinant bacteria containing MFS The recombinant bacteria of the gene mutant can significantly increase the production of L-arginine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology and specifically relates to a MFS Gene mutants, recombinant vectors, recombinant bacteria and their applications. Background Art

[0002] L-arginine is a conditionally essential amino acid, but it is essential for birds, carnivores, and young mammals, which lack the ability to synthesize it. L-arginine is widely involved in cellular metabolism and is closely related to body functions such as hormone secretion, circulatory regulation, immune control, wound healing, and maintenance of the intestinal mucosal barrier.

[0003] The main methods for producing L-arginine are hydrolysis and microbial fermentation. The hydrolysis method is to hydrolyze some animal protein raw materials rich in L-arginine, such as hair, animal blood and pig skin, with acid (usually hydrochloric acid) and then separate and purify them to obtain L-arginine. However, this method requires the use of a large amount of hydrochloric acid, which poses a serious risk of pollution. Microbial fermentation is currently the main method for producing L-arginine. It can be divided into direct fermentation and fermentation with added precursors. Both use microorganisms to convert common cheap industrial raw materials into target products. Compared with the hydrolysis method, the microbial fermentation method not only has a relatively simple production process and a relatively small impact on the environment, but also the separation and purification of fermentation products is easier than the hydrolysis method. However, for the production of L-arginine by fermentation, it is still a key research project due to the low acid production level of the strain and unstable fermentation performance. Promoter superfamily ( MFS ) is the largest known superfamily of secondary active transporters. MFS There are no reports on the application of gene mutation in improving L-arginine fermentation production. Summary of the Invention

[0004] In view of this, the object of the present invention is to provide a MFS Gene mutants, recombinant vectors, recombinant bacteria and their applications, containing MFS The gene mutant strain can significantly increase the production of L-arginine.

[0005] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0006] The present invention provides a MFS Gene mutants, MFS The nucleotide sequence of the gene mutant is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2. MFS Compared with the gene MFS The A at position 686 of the gene mutant mutated to C.

[0007] The present invention providesMFS The protein encoded by the gene mutant has an amino acid sequence as shown in SEQ ID NO.13.

[0008] The present invention provides a recombinant vector, which contains MFS Gene mutants.

[0009] Preferably, the preparation of the recombinant vector comprises the following steps: using the recombinant plasmid PK18mobsacB- MFS For template amplification, mutation sites were introduced to obtain the recombinant vector PK18mobsacB- MFS A686C .

[0010] Preferably, the primers used to introduce the mutation site are MFS A686C -F and MFS A686C -R, the nucleotide sequences are shown in SEQ ID NO.11 and SEQ ID NO.12 respectively.

[0011] The present invention provides a recombinant bacterium, wherein the recombinant bacterium contains MFS Gene mutant or the recombinant vector.

[0012] Preferably, the starting strain of the recombinant bacteria includes Corynebacterium glutamicum.

[0013] Preferably, the Corynebacterium glutamicum includes Corynebacterium glutamicum ATCC 13032 or Corynebacterium glutamicum CICC 23604.

[0014] The present invention provides the MFS Application of the gene mutant, the protein, the recombinant vector or the recombinant bacteria in increasing the production of L-arginine.

[0015] The present invention also provides a method for producing L-arginine by fermentation, comprising the following steps: fermenting the recombinant bacteria, collecting the fermentation liquid, and obtaining L-arginine.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention is MFS The gene was subjected to site mutation, and the base A at position 686 in the nucleotide sequence was mutated to C. The nucleotide sequence obtained by site-directed mutagenesis was as shown in SEQ ID NO.1. MFS Gene mutants. The present invention constructs expression MFS The genetically modified Corynebacterium glutamicum engineered bacteria. Experimental results show that compared with the original strain, MFSThe engineered bacteria of Corynebacterium glutamicum with gene mutations can significantly increase the production of L-arginine, while also saving fermentation time and cost, and reducing the chance of contamination. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The agarose gel electrophoresis diagram of positive bacteria. MFS Gene amplification fragment.

[0019] Figure 2 The figure shows the sequencing verification of positive clones. DETAILED DESCRIPTION

[0020] The present invention provides a MFS Gene mutants, MFS The nucleotide sequence of the gene mutant is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2. MFS Compared with the gene MFS The A at position 686 of the gene mutant is mutated to C. MFS The amino acid sequence of the protein encoded by the gene mutant is shown in SEQ ID NO.13.

[0021] The present invention also provides a recombinant vector, which contains the MFS The preparation of the recombinant vector of the present invention comprises the following steps: using the recombinant plasmid PK18mobsacB- MFS For template amplification, mutation sites were introduced to obtain the recombinant vector PK18mobsacB- MFS A686C The primers used to introduce mutation sites in the present invention are MFS A686C -F and MFS A686C -R, the nucleotide sequences are shown in SEQ ID NO.11 and SEQ ID NO.12 respectively.

[0022] In the present invention, the recombinant plasmid PK18mobsacB- MFS Seamless cloning kit MFS The gene fragment is connected with the upstream homologous fragment and the downstream homologous fragment and inserted into the linearized vector. MFS The gene fragment was generated using the genomic DNA of Corynebacterium glutamicum as template and MFS -F, MFS -R is a primer, which is obtained by PCR amplification; MFS -F and MFS-R's nucleotide sequence is shown in SEQ ID NO.9 and SEQ ID NO.10. The upstream homologous fragment of the present invention was obtained by PCR amplification using genomic DNA of Corynebacterium glutamicum as a template and primers UP-F and UP-R; the nucleotide sequences of UP-F and UP-R are shown in SEQ ID NO.5 and SEQ ID NO.6. The downstream homologous fragment of the present invention was obtained by PCR amplification using genomic DNA of Corynebacterium glutamicum as a template and primers DOWN-F and DOWN-R; the nucleotide sequences of DOWN-F and DOWN-R are shown in SEQ ID NO.7 and SEQ ID NO.8. The linearized vector of the present invention is PK18mobsacB.

[0023] The present invention also provides a recombinant bacterium, wherein the recombinant bacterium contains MFS Gene mutant or the recombinant vector. The starting strain of the recombinant bacteria of the present invention includes Corynebacterium glutamicum. The Corynebacterium glutamicum of the present invention preferably includes Corynebacterium glutamicum ATCC 13032 or Corynebacterium glutamicum CICC 23604. The present invention transforms the recombinant vector PK18mobsacB- MFS A686C Transformed into the original Corynebacterium glutamicum and cultured, positively screened out the engineered Corynebacterium glutamicum C.glu - MFS A686C .

[0024] The present invention also provides the MFS Application of the gene mutant, the protein, the recombinant vector or the recombinant strain in increasing the production of L-arginine.

[0025] The present invention also provides a method for producing L-arginine by fermentation, comprising the following steps: fermenting the recombinant bacteria, collecting the fermentation liquid, and obtaining L-arginine.

[0026] In the present invention, unless otherwise specified, all components, reagents, or culture media are commercially available products well known to those skilled in the art.

[0027] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0028] The Corynebacterium glutamicum used in the embodiment of the present invention ( Corynebacterium glutamicum) from the American Type Culture Collection, strain number ATCC 13032; Corynebacterium glutamicum ( Corynebacterium glutamicum ) is from China Industrial Culture Collection Center, strain number CICC 23604.

[0029] Example 1: Engineered Corynebacterium glutamicum C.glu - MFS A686C Construction

[0030] 1. Amplification of the upstream homology arm UP: PCR amplification was performed using genomic DNA from Corynebacterium glutamicum as a template and primers UP-F and UP-R to obtain the nucleotide sequence of the upstream homology arm UP as shown in SEQ ID NO. 3. The nucleotide sequences of the PCR amplification primers are: UP-F: CTATGACATGATTACGAATTCAATTCCTCCTCGATGGAAACCA (SEQ ID NO. 5); UP-R: GGCATGTTGGAAATTTCCGGTAAGTGTCCTTAATCTTGAGAGAAAACG (SEQ ID NO. 6). The reaction system for PCR amplification was as follows: total system 50 μL: 2×Phanta Max Master Mix 25 μL, UP-F (10 μmol / L) 2 μL, UP-R (10 μmol / L) 2 μL, template 2 μL, ddH2O 19 μL; PCR amplification program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 56°C for 15 sec, extension at 72°C for 30 sec, 32 cycles; extension at 72°C for 5 min, and storage at 4°C.

[0031] 2. Amplification of the downstream homology arm DOWN: PCR amplification was performed using genomic DNA from Corynebacterium glutamicum as a template and primers DOWN-F and DOWN-R. The nucleotide sequence of the downstream homology arm DOWN was obtained as shown in SEQ ID NO. 4. The nucleotide sequences of the PCR amplification primers are: DOWN-F: CATCGAGGAGGAATTCGGAAATTTCCAACATGCCT (SEQ ID NO. 7), DOWN-R: TCACTCGACGACGCAGCGATGT (SEQ ID NO. 8). The PCR amplification system and procedure were the same as in step 1, except for the different primers.

[0032] 3. MFS Gene fragment acquisition: Using the genomic DNA of Corynebacterium glutamicum as a template, MFS -F and MFS -R is a primer, PCR amplification is performed to obtain MFSThe nucleotide sequences of the gene fragment and PCR amplification primers are: MFS -F:ATCGCTGCGTCGTCGAGTGACCCCACCCGCTCGC (SEQ ID NO.9), MFS -R:CTTGCATGCCTGCAGGTCGACTCACAGTTGGACCACCTTGTATAAG (SEQ ID NO. 10). The PCR amplification system and amplification procedure were the same as step 1 except for the different primers.

[0033] 4. Recombinant plasmid PK18mobsacB- MFS Build

[0034] Seamless cloning kit MFS The gene fragment was connected with the upstream homology arm UP and the downstream homology arm DOWN and inserted into the linearized vector to obtain the recombinant plasmid PK18mobsacB- MFS .

[0035] Among them, the multi-fragment seamless cloning system is: the total system is 10μL: linearized vector PK18mobsacB (Miaoling Bio) 2μL, upstream homology arm UP 1μL, downstream homology arm DOWN 1μL, MFS 1 μL of gene fragment and 5 μL of 2×ClonExpress Mix; the multi-fragment seamless cloning procedure is as follows: multi-fragment recombination reaction, 50°C, 15 min; then cool to 4°C or immediately place on ice to cool.

[0036] 5. Recombinant vector PK18mobsacB- MFS A686C Acquisition

[0037] Mutation primer design: PK18mobsacB- MFS As the starting vector, according to the principle of reverse overlap extension PCR, a mutation site was introduced through a one-step method, and a pair of mutation primers MFS were designed. A686C -F and MFS A686C -R, where the lowercase letters in the primers are the mutation sites, corresponding to the 686th DNA sequence. The primers are as follows: MFS A686C -F:AGCTAGTCACCGCTCTTCGTGATGGCGTGGAG (SEQ ID NO.11), MFS A686C -R:AAGAGCGGTGACTAGCTTATTGGTTGCTTCACC (SEQ ID NO. 12).

[0038] PCR amplification: The recombinant plasmid PK18mobsacB constructed in step 4 was used. MFS PCR amplification was performed using the designed mutation site primers as templates. The PCR amplification reaction system was as follows: 50 μL total system: 2×Phanta Max Master Mix 25 μL, MFS A686C -F (10 μmol / L) 2 μL, MFS A686C -R (10 μmol / L) 2 μL, template 2 μL, dNTP Mix (10 mM) 1 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL and ddH2O 17 μL; PCR amplification program was as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 sec, 56°C annealing for 15 sec, 72°C extension for 3 min, 32 cycles; 72°C extension for 5 min, and storage at 4°C.

[0039] Digest the amplified product with Dpn I: Mix 50 μL of the amplified product with 1 μL of Dpn I, gently pipette to mix, and incubate at 37°C for 1-2 hours. Digest the amplified product with Dpn I to remove the methylated template plasmid.

[0040] Recombination reaction: The amplified product after Dpn I digestion can be efficiently recombined at the site to be mutated under the catalysis of Exnase II to achieve PK18mobsacB- MFS A686C In vitro cyclization was performed on ice. The following steps were performed: The reconstitution reaction system consisted of 20 μL of the following: 200 ng of Dpn I digestion product, 4 μL of 5× CE II Buffer, 2 μL of Exnase II, and 14 μL of ddH2O. Gently pipette to mix, then briefly centrifuge to collect the reaction mixture at the bottom of the tube. Incubate in a 37°C water bath for 30 minutes, then immediately cool on ice.

[0041] 6. Recombinant product PK18mobsacB- MFS A686C Transformation: Thaw the cloned DH5α competent cells on ice, take 10 μL of the recombinant product PK18mobsacB- MFS A686CAdd 100 μL of DH5α competent cells and gently tap the tube to mix (do not oscillate). Place on ice for 30 minutes. Heat shock in a 42°C water bath for 45 seconds, then immediately cool on ice for 2-3 minutes. Add 900 μL of LB liquid medium and shake at 37°C for 1 hour at 220 rpm. Preheat the LB solid medium plate in a 37°C incubator, centrifuge at 5000 rpm for 5 minutes, and discard 900 μL of supernatant. Resuspend the cells in the remaining medium and spread the plate onto the preheated LB solid medium plate in a 37°C incubator using a sterile spreader. Incubate inverted in a 37°C incubator for 12-16 hours.

[0042] 7. Extract the recombinant vector PK18mobsacB- MFS A686C : The positive colonies grown from the recombinant product in step 6 were transformed into PK18mobsacB- MFS A686C Plasmid extraction was performed using the Novozymes plasmid extraction kit.

[0043] 8. Engineered Corynebacterium glutamicum C.gLu - MFS A686C Acquisition

[0044] (1) Preparation and transformation of competent cells

[0045] (i) Pick a single colony of Corynebacterium glutamicum and culture it in a seed culture medium until the bacterial concentration OD 600 The concentration of the cells was 0.7-0.9, and the cells were placed on ice for cooling. After cooling, the cells were centrifuged and washed 3-5 times with pre-cooled electroporation buffer. The cells were resuspended in electroporation buffer to prepare competent cells.

[0046] (ii) The recombinant vector PK18mobsacB- MFS A686C The competent cells prepared in step (i) were transformed by high-voltage electric shock at 2200V for 5ms, and the cells were spread on a kanamycin-resistant seed culture medium plate and cultured at 28-32°C for 12-16h.

[0047] The seed culture medium consists of 8-12g of peptone, 4-6g of yeast extract, 8-12g of sodium chloride, 4-6g of glucose, and the balance water per liter. The electroporation buffer consists of 85-96g of sorbitol, 85-96g of mannitol, 95-105mL of glycerol, and the balance water per liter.

[0048] (2) Positive bacteria screening

[0049] The single colony growing on the kanamycin-resistant plate in step (1) is the strain that underwent the first homologous recombination. A single colony growing on the kanamycin-resistant plate is selected and cultured in a seed liquid medium for 1 day. The colony is then spread on an LB solid medium plate containing 10% sucrose. The single colony that grows is the strain that underwent the second homologous recombination.

[0050] Single colonies growing exclusively on LB solid medium plates containing 10% sucrose (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 10 g / L sucrose, 2 g / L agar powder, and the balance water) were selected. DNA from these colonies was used as a template for PCR amplification using primers UP-F (SEQ ID NO. 5) and DOWN-R (SEQ ID NO. 8). The amplified product was verified by agarose gel electrophoresis. The PCR amplification system consisted of 20 μL of 2× Phanta Max Master Mix, 10 μL of UP-F (10 μmol / L), 1 μL of DOWN-R (10 μmol / L), 1 μL of template, and 7 μL of ddH2O. PCR amplification program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 56°C for 15 sec, extension at 72°C for 1 min, 32 cycles; extension at 72°C for 5 min, and storage at 4°C.

[0051] Agarose gel electrophoresis was used to test the PCR product. The results showed that the primers UP-F and DOWN-R could amplify a specific gene band, which was close to the theoretical value of 1776bp. Then sequencing was performed, and the sequence was correct, indicating that MFS Gene replacement was successful, and engineered Corynebacterium glutamicum was obtained. C.glu - MFS A686C .

[0052] Example 2

[0053] The difference from Example 1 is that the Corynebacterium glutamicum is limited to Corynebacterium glutamicum ATCC 13032, and the engineered bacteria obtained are C . glu- ATCC-13032- MFS A686C The PCR products of positive bacteria were tested by agarose gel electrophoresis. The results showed that the primers UP-F and DOWN-R could amplify a specific gene band with a size of about 1700 bp. Figure 1 , which is close to the theoretical value of 1776bp. Then sequencing was performed, as shown in Figure 2 As shown, the sequence is correct, indicating MFS Gene replacement was successful, and engineered Corynebacterium glutamicum was obtained. C . glu- ATCC-13032-MFS A686C .

[0054] Example 3

[0055] The difference from Example 1 is that the Corynebacterium glutamicum is limited to Corynebacterium glutamicum CICC 23604, and the engineered bacteria obtained are C . glu- CICC-23604- MFS A686C .

[0056] Example 4 L-arginine fermentation experiment

[0057] The engineered Corynebacterium glutamicum bacteria prepared in Example 2 and Example 3 and their corresponding original bacteria were inoculated into 100 mL of LBG medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 5 g / L glucose and the balance water), respectively, and seed culture was carried out at 220 rpm and 30°C for 16 h. Thereafter, the inoculum was inoculated into 100 mL of fermentation medium (20 g / L glucose, 20 g / L (NH4)2SO4, 5 g / L urea, 2 g / L KH2PO4, 1.35 g / L MgSO4·7H2O, 0.02 g / L FeSO4·7H2O, 0.1 g / L MnSO4·H2O) at a volume percentage of 5%. The fermentation was carried out for 50 hours with a 5% flavonoid (0.04 g / L, 0.008 g / L nicotinamide, 0.001 g / L biotin, and the balance water). The fermentation broth was sampled and immediately centrifuged at 12,000 rpm for 2 minutes. The supernatant was then analyzed for L-arginine content using Agilent high-performance liquid chromatography (HPLC). The average of three fermentation measurements was used. The calculated L-arginine content is shown in Table 1.

[0058] Table 1 L-arginine production by engineered and original Corynebacterium glutamicum strains

[0059]

[0060] The results showed that compared with the original bacteria, the engineered Corynebacterium glutamicum C . glu- ATCC-13032- MFS A686C and C . -CICC-23604- glu A686C The content of L-arginine in the fermentation broth reached 2.35g / L and 2.14g / L respectively, while the content of L-arginine in the fermentation broth of the original bacteria was 1.02g / L and 0.99g / L respectively at 48h.C . ATCC-13032- MFS A686C and C . -CICC-23604- glu- A686C The L-arginine production of the two engineered strains increased by 56.6±0.2% and 53.7±0.2% respectively compared to the original strains; and compared to the original strains, the L-arginine production of the two engineered strains reached 1.56 and 1.48 g / L respectively in 24 hours, saving about 12 hours of fermentation time. This shows that Corynebacterium glutamicum MFS glu MFS MFS MFS After the gene is introduced, the acid production level of L-arginine fermentation by Corynebacterium glutamicum can be improved.

[0061] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A MFS A gene mutant, characterized in that described MFS The nucleotide sequence of the gene mutant is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.

2. MFS Compared with the gene MFS The A at position 686 of the gene mutant mutated to C.

2. According to claim 1 MFS The protein encoded by the gene mutant is characterized in that The amino acid sequence of the protein is shown in SEQ ID NO.

13.

3. A recombinant vector, characterized in that The recombinant vector contains the MFS Gene mutants.

4. A recombinant bacterium, characterized in that The recombinant bacteria contains the MFS A gene mutant or the recombinant vector according to claim 3; The starting strain of the recombinant bacteria is Corynebacterium glutamicum ATCC 13032 or Corynebacterium glutamicum CICC 23604.

5. As claimed in claim 1 MFS Use of the gene mutant, the protein according to claim 2, the recombinant vector according to claim 3, or the recombinant bacteria according to claim 4 in increasing L-arginine production.

6. A method for producing L-arginine by fermentation, characterized in that: The method comprises the following steps: fermenting the recombinant bacteria according to claim 4, collecting the fermentation liquid, and obtaining L-arginine.

Citation Information

Patent Citations

  • Method for the fermentative production of l-amino acids

    CN109517751A

  • Genes encoding for genetic stability, gene expression and gene of folding related proteins

    CN1582299A