LMTIA primer combination for detecting salmonella and application

Abstract

The invention discloses an LMTIA primer combination for detecting salmonella and application, and relates to the technical field of microbiological detection.The LMTIA primer combination comprises a first primer and a second primer, the sequence of the first primer is shown as SEQ.ID.No.1, and the sequence of the second primer is shown as SEQ.ID.No.2. The invention further discloses a kit for detecting salmonella. Amplification of the target gene of the to-be-detected sample can be completed within 30 min through the first primer, the second primer and a constant-temperature environment, expensive equipment such as a PCR instrument is not needed, the specificity is high, the false positive rate is low, the sensitivity is not worse than that of PCR, and the kit can be used for rapidly detecting salmonella on site.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial detection, and particularly relates to an LMTIA primer combination for detecting Salmonella and its application. Background Art

[0002] The contamination of Salmonella in food is an important task for food safety risk monitoring and public health prevention and control globally. More than 2,600 serotypes of Salmonella have been reported. It is the third largest pathogen causing human foodborne diseases, second only to Escherichia coli and Campylobacter. Salmonella is divided into two major species: Salmonella enterica and Salmonella bongori. Salmonella enterica is further divided into subspecies such as Salmonella arizonae, Salmonella diarizonae, Salmonella indica, Salmonella enterica, Salmonella houtenae, Salmonella salamae, etc. Salmonella mainly infects humans through contaminated foods such as meat, eggs, milk, fruits, vegetables, and water sources, and can cause symptoms such as diarrhea, gastroenteritis, typhoid, paratyphoid, and septicemia.

[0003] Currently, the molecular biology methods for detecting Salmonella generally have disadvantages such as long time consumption, cumbersome operation, and the need for sophisticated PCR instruments. In addition, due to the large number of Salmonella serotypes, the target specificity for detecting Salmonella needs to be strengthened. Summary of the Invention

[0004] The main object of the present invention is to propose an LMTIA primer combination for detecting Salmonella and its application, aiming to provide a molecular biology detection method for Salmonella with strong specificity, high sensitivity, and relatively fast and simple operation.

[0005] To achieve the above object, the present invention proposes an LMTIA primer combination for detecting Salmonella. The LMTIA primer combination includes a first primer and a second primer. The sequence of the first primer is as shown in SEQ.ID.No.1, and the sequence of the second primer is as shown in SEQ.ID.No.2.

[0006] The present invention also provides an application of the aforementioned LMTIA primer combination in detecting Salmonella.

[0007] In one embodiment, the application includes the following steps:

[0008] The sample to be tested is subjected to ladder melting temperature isothermal amplification using the LMTIA primer combination as described above to obtain an amplification product. Gel electrophoresis is performed on the amplification product, and whether Salmonella is present in the sample to be tested is judged according to the gel electrophoresis result.

[0009] In one embodiment, the temperature of the ladder melting temperature isothermal amplification is 60-63°C, and the time of the ladder melting temperature isothermal amplification is 25-30 min.

[0010] In one embodiment, in the step of judging whether Salmonella is present in the sample to be tested according to the gel electrophoresis result: the detection limit is 1 fg / μL.

[0011] In the technical solution of the present invention, the core genome covering the main prevalent serotypes of Salmonella is screened out through bacterial pan-genome analysis. This genome coexists in the main prevalent serotypes of Salmonella. Further, target sequences suitable for detection by the ladder melting temperature nucleic acid isothermal amplification technology (LMATIA) are screened out from these core genomes. The target sequences meet the following conditions: 1) The melting temperature curve is a ladder type, including sequences of a herringbone ladder type, a semi-herringbone ladder type, and a straight ladder type, and the sequence length ≥ 60 bp; 2) The GC content of the target sequence is 40%-80%; 3) The target sequence itself has high specificity and can only recognize Salmonella and not other strains when aligned. The target sequence screened out by the present invention comes from the TtrC gene, and a pair of primers are designed based on the target sequence for LMTIA detection. Through the first primer, the second primer, and a constant temperature environment, amplification can be completed within 30 min, and expensive equipment such as a PCR instrument is not required. It has strong specificity, a low false positive rate, and a sensitivity not inferior to that of PCR, and can be used for rapid on-site detection of Salmonella. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on the structures shown in these drawings without creative efforts.

[0013] Figure 1 It is the gel electrophoresis diagram of the first specific detection in Example 2 provided by the present invention;

[0014] Figure 2 It is the gel electrophoresis diagram of the second specific detection in Example 2 provided by the present invention;

[0015] Figure 3 It is the gel electrophoresis diagram of the sensitivity detection in Example 3 provided by the present invention.

[0016] The realization, functional features, and advantages of the present invention will be further described in conjunction with embodiments and with reference to the accompanying drawings. Detailed Embodiments

[0017] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. For those not specified in the embodiments, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through commercial purchase. In addition, the meaning of "and / or" appearing throughout the text includes three parallel solutions. Taking "A and / or B" as an example, it includes solution A, solution B, or a solution that satisfies both A and B simultaneously. In addition, the technical solutions between various embodiments can be combined with each other, but it must be based on the ability of those of ordinary skill in the art to implement. When the combination of technical solutions results in contradictions or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection required by the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0018] The contamination of Salmonella in food is an important task for food safety risk monitoring and public health prevention and control globally. More than 2,600 serotypes of Salmonella have been reported. It is the third largest pathogen causing human foodborne diseases, second only to Escherichia coli and Campylobacter. Salmonella is divided into two major species: Salmonella enterica and Salmonella bongori. Salmonella enterica is further divided into subspecies such as Salmonella arizonae, Salmonella diarizonae, Salmonella indica, Salmonella enterica, Salmonella houtenae, and Salmonella salamae. Salmonella mainly infects humans through contaminated foods such as meat, eggs, milk, fruits, and vegetables, as well as water sources, and can cause symptoms such as diarrhea, gastroenteritis, typhoid, paratyphoid, and septicemia.

[0019] Currently, the molecular biology methods for detecting Salmonella generally have disadvantages such as long time consumption, cumbersome operation, and the need for sophisticated PCR instruments. In addition, due to the large number of Salmonella serotypes, the target specificity for detecting Salmonella needs to be strengthened.

[0020] In view of this, the present invention provides an LMTIA primer combination for detecting Salmonella. The LMTIA primer combination includes a first primer and a second primer. The sequence of the first primer is as shown in SEQ.ID.No.1, and the sequence of the second primer is as shown in SEQ.ID.No.2.

[0021] In the technical solution of the present invention, the core genome covering the main epidemic serotypes of Salmonella is screened through bacterial pan-genome analysis. This genome coexists in the main epidemic serotypes of Salmonella. Further, a target sequence suitable for ladder melting temperature nucleic acid isothermal amplification technology (LMATIA) detection is screened from these core genomes. The target sequence satisfies the following conditions: 1) The melting temperature curve is a ladder type, including sequences of chevron ladder type, semi-chevron ladder type, and straight ladder type, and the sequence length is ≧60bp; 2) The GC content of the target sequence is 40% - 80%; 3) The target sequence itself has high specificity and can only recognize Salmonella during alignment and cannot recognize other strains. The target sequence screened in the present invention comes from the TtrC gene. A pair of primers is designed from the target sequence for LMTIA detection, and their sequences are as shown in SEQ.ID.No.1 and SEQ.ID.No.2. The number of bases of the target sequence screened from the TtrC gene is 91bp, and its sequence is as shown in SEQ.ID.No.3. Through the first primer, the second primer, and a constant temperature environment, amplification can be completed within 30 minutes, and expensive equipment such as a PCR instrument is not required. It has strong specificity, a low false positive rate, and a sensitivity not inferior to PCR, and can be used for rapid on-site detection of Salmonella.

[0022] SEQ.ID.No.1(5’-3’):

[0023] TCCGTTCCGCCTGGTTTTTGCGCAATTTAACCCTTACTCGT.

[0024] SEQ.ID.No.2(5’-3’):

[0025] GGCTGGCTGGCTATTCTTTTCGCTATCCACAGGCCGAA.

[0026] SEQ.ID.No.3(5’-3’):

[0027] GCGCAATTTAACCCTTACTCGTTACCAGGCGGAACGGATGGCTGGC TGGCTATTCTCGGCACCTTCGGCCTGTGGATAGCGCTACTGATTA.

[0028] Among them, the first primer has 37 bases, and the second primer has 34 bases.

[0029] It is understandable that the bacterial pan-genomics analysis in the present invention mainly compares the genomes of different strains of the same species or genus, and can reconstruct the phylogenetic relationships between bacterial species by using 100% of the genomic information, further accurately identify and diagnose pathogens, and point out the direction for clinical diagnosis and treatment. Among them, the genes shared by all strains belong to the core genome (core-resistome), and the core genome covers all the genes that regulate the basic survival functions and main phenotypic traits of the species. These gene functions are mainly related to energy production, amino acid metabolism, nucleotide metabolism, lipid transport, and transcription and translation mechanisms. By using the pan-genomic method to find the genetic differences among multiple strains of Salmonella, molecular targets with strong specificity can be mined, covering the main serotypes of Salmonella.

[0030] The LMTIA technology in the present invention is a novel nucleic acid isothermal amplification technology, which realizes the isothermal amplification of polymerase chain reaction by using the melting temperature (Tm) difference between the primer and the target sequence. The present invention can amplify the target gene with only 1 pair of primers, and has the advantages of polymerase chain reaction (PCR) and loop-mediated isothermal amplification technology (LAMP).

[0031] The present invention also provides an application of the LMTIA primer combination as described above in detecting Salmonella. Since the target sequence corresponding to the LMTIA primer combination as described above is a sequence commonly present in multiple main serotypes of Salmonella, that is, the target sequence is a conserved region unique to Salmonella, the primer has high specificity and can effectively distinguish Salmonella from other non-target microorganisms. Therefore, the LMTIA primer combination can be used to amplify the sequences of Salmonella of multiple serotypes, improving the sensitivity and specificity of detecting Salmonella.

[0032] In some embodiments of the present invention, the application includes the following steps:

[0033] The sample to be tested is subjected to ladder melting temperature isothermal amplification by the LMTIA primer combination as described above to obtain an amplification product, and the amplification product is subjected to gel electrophoresis, and it is judged whether Salmonella exists in the sample to be tested according to the gel electrophoresis result.

[0034] In the technical solution of the present invention, the target gene in the TtrC gene of different serotypes of Salmonella in the sample to be tested is isothermally amplified by the LMTIA primer combination, so that the target gene binds to the primer to obtain an amplification product. Gel electrophoresis is performed on the amplification product, and whether Salmonella exists in the sample to be tested is judged according to whether there is a target band in the gel electrophoresis pattern. That is, if there is a target band in the gel electrophoresis pattern, Salmonella exists in the sample to be tested. Through the steps of the present invention, amplification can be completed within 30 minutes, and the result of whether Salmonella exists can be obtained quickly, which is suitable for on-site rapid detection. It can be understood that the temperature of the present invention can be achieved by means such as water bath, without using an expensive PCR instrument.

[0035] In some embodiments of the present invention, the temperature of the ladder melting temperature isothermal amplification is 60-63°C, and the time of the ladder melting temperature isothermal amplification is 25-30 minutes. That is, the temperature of the ladder melting temperature isothermal amplification can be 60°C, 62°C or 63°C, and the time can be 25 minutes, 27 minutes or 30 minutes. Preferably, the temperature and time of the ladder melting temperature isothermal amplification are 62°C and 30 minutes respectively. Under this condition, the target sequence of Salmonella has a relatively fast amplification speed under the action of the primer combination.

[0036] In some embodiments of the present invention, in the step of judging whether Salmonella exists in the sample to be tested according to the gel electrophoresis result: the detection limit is 1 fg / μL. The detection limit refers to the lowest concentration or amount that can distinguish the presence or absence of the target substance at a given confidence level (usually 95%). That is, the detection limit is the lowest value at which the detection method can accurately judge "yes" or "no". It can be understood that the lowest detection concentration of the primer combination of the present invention for detecting Salmonella is 1 fg / μL, indicating that its detection sensitivity is relatively high.

[0037] The technical solution of the present invention will be further described in detail below in conjunction with specific embodiments and drawings. It should be understood that the following embodiments are only used to explain the present invention and are not used to limit the present invention.

[0038] Example 1 Screening of LMTIA target gene and primer design

[0039] 1. Bacterial pan-genome analysis

[0040] Through pan-genome analysis, the core genomes of different serotypes of Salmonella are obtained.

[0041] 2. Screening of LMTIA target gene

[0042] View the melting curves of Salmonella - specific genes invA, bcfD, phoP, siiA, and ttrRSBCA genes, etc. through Oligo7 software, and screen sequences with a herringbone ladder - shaped, semi - herringbone ladder - shaped, or straight ladder - shaped melting curve and a sequence length ≥ 60 bp; upload the sequences screened above to the NCBI (National Center for Biotechnology Information) website for comparative verification of their specificity. The finally screened target sequence comes from the TtrC gene, and its sequence is shown as SEQ.ID.No.3.

[0043] 3. Design of LMTIA primers

[0044] Design a primer combination for the target sequence shown in SEQ.ID.No.3. The primer combination includes a first primer and a second primer, and their sequences are shown as SEQ.ID.No.2 and SEQ.ID.No.1 respectively.

[0045] Example 2 Specificity detection

[0046] 1. First - time specificity detection

[0047] Select a series of Salmonella strains with different serotypes, including Salmonella ATCC14028, Salmonella A7 (CP084001.1), Salmonella A29 - 2 (CP083731.1), Salmonella A39 (CP084194.1), Serratia ATCC13880; and non - Salmonella strains, including Staphylococcus aureus ATCC25923, Cronobacter sakazakii JXES - 28 (CP098777.1), Cronobacter sakazakii ATCC51329, Serratia ATCC13880, Listeria monocytogenes ATCC19114, Escherichia coli ATCC43895 as test samples for LMTIA amplification. The amplification system is shown in Table 1, and gel electrophoresis is performed on the amplification products to compare the electrophoresis results of different strains. Use the group without any strains as the negative control. It should be noted that the strains with ATCC numbers were all donated by Wuhan Center for Disease Control, and the other strains were isolated, preserved, sequenced, and then submitted to NCBI to obtain sequence numbers.

[0048] Table 1 LMTIA amplification system

[0049]

[0050]

[0051] In Table 1, Nuclease-free water was purchased from Wuhan Youming Biotechnology Co., Ltd.; 2×BcaBEST Buffer was purchased from Wuhan Youming Biotechnology Co., Ltd.; the concentration of the primer combination in the 10× primer combination was 10 mM, among which, the concentration of the first primer was 10 mM and the concentration of the second primer was 10 mM; BcaBEST DNA Polymerase ver 2.0 was purchased from Wuhan Youming Biotechnology Co., Ltd., and the DNA of the sample to be tested was extracted by Tiangen Biochemical Bacterial Genomic DNA Extraction Kit.

[0052] The amplification conditions for LMTIA were: water bath at 62 °C for 30 min.

[0053] The amplified product was electrophoresed using a freshly prepared 1.8% agarose gel, and the electrophoresis time was 1 h. The electrophoresis results are as Figure 1 shown.

[0054] Figure 1 In the figure, lane M: DL 2000 DNA Marker; lanes 1-2: Salmonella ATCC14028; lanes 3-4: Salmonella A7 (CP084001.1); lanes 5-6: Salmonella A29-2 (CP083731.1); lanes 7-8: Salmonella A39 (CP084194.1); lane 9: Staphylococcus aureus ATCC25923; lane 10: Cronobacter sakazakii JXES-28 (CP098777.1); lane 11: Cronobacter sakazakii ATCC51329; lane 12: Serratia ATCC13880; lane 13: Listeria monocytogenes ATCC19114; lane 14 Escherichia coli ATCC43895; lanes 15-16: negative control. It can be Figure 1 seen that all Salmonella were detected, while non-Salmonella were not detected, indicating that the primer combination of the present invention has high specificity.

[0055] 2. Second specificity test

[0056] A series of Salmonella strains of different serotypes were selected, including Salmonella CICC21513, Salmonella SAL-0079 (CP071686.1), Salmonella SAL-020 (CP071690.1), Salmonella SAL-045 (CP071693.1), Salmonella JXY0409-18 (CP084216.1), Salmonella NC3 (JAGSPE000000000), Salmonella NC4 (JAGSPF000000000), Salmonella NC31 (JAGSPG000000000), Salmonella NC62 (JAGSPH000000000); and non-Salmonella strains, including Cronobacter malonaticus CICC24177, Escherichia coli ATCC25922, Listeria monocytogenes ATCC19114, Pseudomonas ATCC9027, were used as test samples for LMTIA amplification. The amplification system is shown in Table 1, and the amplification products were subjected to gel electrophoresis to compare the electrophoresis results of different strains. A group without any strains was used as a negative control.

[0057] The conditions for LMTIA amplification were: water bath at 62 °C for 30 min.

[0058] The amplification products were electrophoresed using a newly prepared 1.8% agarose gel, and the electrophoresis time was 1 h. The electrophoresis results are as Figure 2 shown.

[0059] Figure 2 In the figure, lane M: DL 2000 DNA Marker; lane 1: Salmonella CICC21513; lane 2: Salmonella SAL-0079 (CP071686.1); lane 3: Salmonella SAL-020 (CP071690.1); lane 4: Salmonella SAL-045 (CP071693.1); lane 5: Salmonella JXY0409-18 (CP084216.1); 6: Salmonella NC3 (JAGSPE000000000); 7: Salmonella NC4 (JAGSPF000000000); 8: Cronobacter malonaticus CICC24177; lane 9: Escherichia coli ATCC25922; lane 10: Listeria monocytogenes ATCC19114; lane 11: Salmonella NC31 (JAGSPG000000000); lane 12: Salmonella NC62 (JAGSPH000000000); lane 13: Pseudomonas ATCC9027; N: negative control. It can be Figure 2 seen that all Salmonella strains were detected, while none of the non-Salmonella strains were detected, indicating that the primer combination of the present invention has high specificity.

[0060] From the results of the two detections, it can be seen that this method can amplify all the tested Salmonella strains, and these Salmonella serotypes are different, indicating that this method has broad-spectrum detection ability, while other types of bacteria cannot be amplified, showing strong specificity.

[0061] Example 3 Sensitivity Detection

[0062] Sensitivity detection method: Extract the DNA of Salmonella 14028 using a DNA extraction kit to obtain the DNA extract of Salmonella 14028. Measure the DNA concentration in its DNA extract multiple times using an ultra-micro spectrophotometer, and calculate the average DNA concentration to be 153 ng / μL. Subsequently, dilute the DNA extract successively to 8 concentration gradients of 15.3 ng / μL, 1.53 ng / μL, 153 pg / μL, 15.3 pg / μL, 1.53 pg / μL, 153 fg / μL, 15.3 fg / μL, and 1.53 fg / μL. Together with the original concentration of the DNA extract, a total of 9 concentration samples are subjected to LMTIA amplification. The amplification system is shown in Table 1, and gel electrophoresis is performed on the amplification products to compare the electrophoresis results of different strains. The specific amplification system, amplification conditions, and electrophoresis method are the same as those in Example 2. The detection results are as Figure 3 shown. A group without any strains is used as a negative control.

[0063] Figure 3 In it, Lane M: DL 2000 DNA Marker; Lanes 1 and 2: 153 ng / μL; Lanes 3 and 4: 15.3 ng / μL; Lanes 5 and 6: 1.53 ng / μL; Lanes 7 and 8: 153 pg / μL; Lanes 9 and 10: 15.3 pg / μL; Lanes 11 and 12: 1.53 pg / μL; Lanes 13 and 14: 153 fg / μL; Lanes 15 and 16: 15.3 fg / μL; Lanes 17 and 18: 1.53 fg / μL; Lanes 19 and 20: Negative control. From Figure 3 this, it can be seen that the lowest detection limit reaches 1 fg / μL, and the detection sensitivity of the primer combination of the present invention is relatively high.

[0064] In summary, the present invention only needs to design a pair of primers, which is simpler than its similar technologies such as LAMP primer design, uses fewer primers, and has a lower false positive rate. Compared with the PCR method, the lowest detection limit of this technology is 1 fg / μL, which is more sensitive, and the total amplification time only requires 30 minutes, with a short time consumption. It does not require a PCR amplification instrument, and the required equipment is simple, which is conducive to promotion at the grass-roots level or on-site detection.

[0065] The above are only the preferred embodiments of the present invention, and do not limit the patent scope of the present invention. For those skilled in the art, the present invention may have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the patent protection scope of the present invention.

Claims

1. A LMTIA primer combination for detecting Salmonella, characterized in that: The LMTIA primer combination includes a first primer and a second primer, the sequence of the first primer is shown as SEQ.ID.No.1, and the sequence of the second primer is shown as SEQ.ID.No.

2.

2. Use of the LMTIA primer combination as claimed in claim 1 in detecting Salmonella.

3. The use according to claim 2, characterized in that The application comprises the following steps: The sample to be tested isothermally amplified with a ladder melting temperature using the LMTIA primer combination as described in claim 1 to obtain an amplified product, and the amplified product is subjected to gel electrophoresis to determine whether Salmonella is present in the sample to be tested based on the gel electrophoresis result.

4. The use according to claim 3, characterized in that The temperature of the ladder-type melting temperature isothermal amplification is 60-63° C., and the time of the ladder-type melting temperature isothermal amplification is 25-30 min.

5. The use according to claim 3, characterized in that In the step of judging whether Salmonella exists in the sample to be tested according to the gel electrophoresis result: the detection limit is 1 fg / μL.

Images