RPA primer pair, real-time fluorescent RPA primer group and kit for detecting salmonella typhimurium

By designing specific RPA primer pairs and real-time fluorescent RPA primer sets, the rapid, specific and sensitive detection problem of Salmonella typhimurium is solved, and rapid detection under non-laboratory conditions is achieved with high sensitivity and specificity.

CN120119015APending Publication Date: 2025-06-10HUAZHONG UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510485062.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-17
Publication Date
2025-06-10

AI Technical Summary

Technical Problem

The prior art is difficult to detect Salmonella typhimurium quickly, specifically and sensitively, and traditional culture methods take a long time, and existing molecular biological methods require strict equipment and sample quality.

Method used

A RPA-based primer pair and real-time fluorescent RPA primer set are designed, including specific upstream primers, downstream primers and probes, combining fluorophores and quenching groups, used to detect Salmonella typhimurium, and corresponding kits and detection methods are provided.

Benefits of technology

A fast, high specificity and strong sensitivity detection of Salmonella typhimurium can be achieved, and the on-site detection can be carried out under non-laboratory conditions. The detection time is short, with a minimum detection limit of 1.217x103CFU/mL and is not affected by cross-reactions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120119015A_ABST
    Figure CN120119015A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of microbiological detection, and discloses an RPA (recombinase polymerase amplification) primer pair, a real-time fluorescent RPA primer group and a kit for detecting salmonella typhimurium. The primer pair for detecting the salmonella typhimurium based on the RPA comprises an upstream primer RPA-F with a sequence as shown in SEQ ID NO: 1 and a downstream primer RPA-R with a sequence as shown in SEQ ID NO: 2, and the primer group for detecting the salmonella typhimurium based on the real-time fluorescence RPA comprises the upstream primer RPA-F, the downstream primer RPA-R and a probe RPA-P with a sequence as shown in SEQ ID NO: 3. The primer group and the primer pair can be used for rapidly detecting salmonella typhimurium, and are high in specificity and sensitivity and low in minimum detection limit.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of microbial detection, and particularly relates to an RPA primer pair for detecting Salmonella typhimurium, a real-time fluorescence RPA primer set, and a kit. Background Art

[0002] Salmonella Typhimurium is a Gram-negative bacillus belonging to the genus Salmonella. It is widely present in nature and is one of the main pathogens causing human foodborne diseases. It is transmitted through undercooked meat (especially poultry and eggs), contaminated dairy products or vegetables, and can also be infected by contacting animals carrying the bacteria (such as poultry or reptiles). This bacterium has peritrichous flagella, strong motility, and can use the type III secretion system to invade host intestinal epithelial cells, destroy cell structure and release endotoxin (LPS), resulting in gastroenteritis symptoms such as diarrhea, fever, and abdominal pain. Most healthy patients can recover on their own, but infants, the elderly, or immunocompromised individuals may develop serious complications such as bacteremia, causing 93.8 million infections and 150,000 deaths annually.

[0003] Due to its extremely low infectious dose (only 1 CFU is required to cause disease) and the characteristics of widely contaminating foods such as meat, eggs, and milk, S. Typhimurium has become a major pathogen of global foodborne diseases, and its prevention and control face severe challenges. Traditional Salmonella detection methods (such as the cultivation method adopted in national standard GB / T 13091-2018) are regarded as the "gold standard", but they rely on enrichment culture in selective media, biochemical identification, and counting, taking more than 5 days, seriously lagging behind the rapid circulation demand of food. Therefore, rapid detection technologies based on specific biological receptors (such as antibodies, aptamers, nucleic acid probes, phages, and lectins) have developed rapidly. For example, ELISA realizes detection through the binding of antibodies and antigens. The flagellin-targeted ELISA developed by the di Febo team reduces the detection limit to 7×10 2 CFU / mL, while the immunogold nanoparticle biosensor designed by Cho et al. has a sensitivity as high as 3 cells / mL. Molecular biology methods use nucleic acid sequences as targets. The PCR technology realizes rapid identification by amplifying specific genes (such as STM4200, invA). The multiplex PCR of the Heymans team can distinguish Salmonella typhimurium and its monophasic variants within 2 hours, with a detection limit of 10 CFU / 25 g; although qPCR and dPCR have high sensitivity (150 CFU / mL) and accurate quantification ability, they have strict requirements for equipment and sample quality.

[0004] Therefore, it is of great significance to find a new method with high specificity and sensitivity and suitable for on-site detection of Salmonella typhimurium. Summary of the Invention

[0005] To solve the problems existing in the background art, the present invention provides an RPA primer pair for detecting Salmonella typhimurium, a real-time fluorescence RPA primer set and a kit, which can quickly detect Salmonella typhimurium, is suitable for on-site detection, and has high specificity and sensitivity.

[0006] The technical solutions of the present invention to solve the above technical problems are as follows:

[0007] In the first aspect, the present invention provides a primer pair for detecting Salmonella typhimurium based on RPA, including an upstream primer RPA-F with a sequence as shown in SEQ ID NO:1 and a downstream primer RPA-R with a sequence as shown in SEQ ID NO:2.

[0008] In the second aspect, the present invention provides a primer set for detecting Salmonella typhimurium based on real-time fluorescence RPA, including an upstream primer RPA-F with a sequence as shown in SEQ ID NO:1, a downstream primer RPA-R with a sequence as shown in SEQ ID NO:2, and a probe RPA-P with a sequence as shown in SEQ ID NO:3.

[0009] According to the above scheme, a fluorescent group is labeled on a T base on the 5'-end side of the probe RPA-P, a quenching group is labeled on a T base on the 3'-end side, [THF] is designed between the two groups, the fluorescent group and the quenching group are 2-5 bases apart, and a C3-spacer is introduced at the 3'-end for terminal blocking.

[0010] In the third aspect, the present invention provides a kit for detecting Salmonella typhimurium using real-time fluorescence RPA, including the above-mentioned primer set for detecting Salmonella typhimurium based on real-time fluorescence RPA.

[0011] According to the above scheme, the kit further includes a reaction buffer.

[0012] According to the above scheme, the kit further includes a negative control and / or a positive control.

[0013] In the fourth aspect, the present invention provides a method for rapidly detecting Salmonella typhimurium for non-disease diagnosis purposes based on real-time fluorescence RPA, including the following steps:

[0014] Extract the genomic DNA of the sample to be tested or release the bacterial genomic DNA by thermal lysis method;

[0015] Perform a real-time fluorescence RPA reaction on the genomic DNA using the above-mentioned primer set for detecting Salmonella typhimurium based on real-time fluorescence RPA or the above-mentioned kit, and determine the result.

[0016] According to the above scheme, the temperature of the real-time fluorescence RPA reaction is 30°C to 45°C, and the reaction time is 4 min to 15 min.

[0017] According to the above scheme, the lowest detection limit of Salmonella typhimurium is 1.217x10 3 CFU / mL.

[0018] The beneficial effects of the present invention are as follows:

[0019] The primer pair for detecting Salmonella typhimurium based on RPA and the primer set for detecting Salmonella typhimurium based on real-time fluorescence RPA provided by the present invention have no false positives, good amplification effects and high specificity;

[0020] Using the real-time fluorescence RPA based on the primer set of the present invention, Salmonella typhimurium can be rapidly and real-timely detected on-site. The operation is simple and does not require complex temperature control equipment, overcoming the dependence on laboratory equipment. It can be used for on-site detection in areas with insufficient equipment conditions, saving the time of sample transportation and avoiding the influence of transportation on the detection results;

[0021] Using the primer set and method of the present invention to detect Salmonella typhimurium has strong specificity, no cross-reaction with other pathogenic bacteria of Enterobacteriaceae and food safety pathogenic bacteria, high sensitivity, short detection time, and the results can be seen for templates with different concentrations in 4 - 15 min, and the lowest detection limit is low, up to 1.217x10 3 CFU / mL. Description of the Drawings

[0022] Figure 1 This is the amplification effect of the Real-time RPA reaction of six groups of primer probes in Example 1 of the present invention. Among them, the primer pair of A is ST1-1, the primer pair of B is ST1-2, the primer pair of C is ST2-1, the primer pair of D is ST2-2, the primer pair of E is ST3-1, and the primer pair of F is ST3-2;

[0023] Figure 2 This is the experimental result of the Real-time RPA sensitivity of two primer sets ST3-1 and ST3-2 in Example 1 of the present invention. Among them, A is the sensitivity result diagram of the ST3-1 primer, and B is the sensitivity result diagram of the ST3-2 primer;

[0024] Figure 3 This is the result diagram of the screening of the concentration of the real-time fluorescence RPA primer in Example 2 of the present invention;

[0025] Figure 4 This is the result diagram of the screening of the concentration of the real-time fluorescence RPA probe in Example 2 of the present invention;

[0026] Figure 5This is the graph of the screening results of the concentration of real-time fluorescence RPA B buffer in Example 2 of the present invention;

[0027] Figure 6 This is the graph of the specific detection results after optimizing the real-time fluorescence RPA detection system in Example 2 of the present invention;

[0028] Figure 7 This is the graph of the sensitivity detection results of the real-time fluorescence RPA detection system in Example 2 of the present invention;

[0029] Figure 8 This is the Probit analysis graph of the eight sensitivity detection results of the real-time fluorescence RPA detection system using SPSS software in Example 2 of the present invention. Detailed implementation manners

[0030] The principles and features of the present invention will be described below in conjunction with the accompanying drawings and specific embodiments. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0031] It should be understood that the terms described in the present invention are only for describing specific embodiments and are not intended to limit the present invention. In addition, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0032] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. The reagents not specifically described in detail in this application are all conventional reagents and can be obtained commercially; the methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.

[0033] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the description of the present invention, which are obvious to those skilled in the art. Other implementation manners obtained from the description of the present invention are obvious to those skilled in the art. The description and examples of this application are only exemplary.

[0034] Regarding the terms "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, that is, they are intended to mean including but not limited to.

[0035] As a specific gene of Salmonella typhimurium, the STM4495 gene encodes products that are subunits of type II restriction endonuclease and methylase. These two enzymes play important roles in the survival, reproduction of Salmonella typhimurium and its interaction with the host. Type II restriction endonuclease can recognize and cut specific DNA sequences, participating in the defense mechanism of bacteria against exogenous DNA such as invading phages; the methylase subunit can methylate its own DNA to protect the bacterial DNA from being cut by restriction endonucleases and maintain the stability of the genome. Strains isolated from numerous case samples infected with Salmonella typhimurium and contaminated food samples have been found to contain the STM4495 gene.

[0036] In the present invention, the inventors designed RPA detection primers based on the STM4495 gene of Salmonella typhimurium. The primer design principles were as follows: the primer length was 28 - 35 bp, the size of the amplification product was 150 - 500 bp, the GC content was 40% - 60%, and the Tm value was 50 - 100. Multiple pairs of primers were designed and screened. Then, based on the results of the primer screening, real-time fluorescence RPA probes were designed for the primers with good amplification performance and no obvious dimers. On this basis, mismatched bases were introduced into the forward primer, reverse primer, and probe in order to reduce the hairpin structure and dimer structure. Finally, a primer-probe group with no false positives, good amplification effect, and unaffected high specificity was successfully screened out. Among them, the primer pair consisted of the upstream primer RPA-F with the sequence shown in SEQ ID NO:1 and the downstream primer RPA-R with the sequence shown in SEQ ID NO:2. The sequences of the upstream primer RPA-F and the downstream primer RPA-R were as follows:

[0037] RPA-F: 5’-TACCGAGTCTATTATCTTTTCGCCACCA (SEQ ID NO:1)

[0038] RPA-R: 5’-ATATTCACCTCCACTACTACAAGGAAACCA (SEQ ID NO:2);

[0039] The sequence of the probe RPA-P was shown in SEQ ID NO:3:

[0040] RPA-P: 5’-TTAAAAGCAGGCATGTCCACCGGTGACAATATTAAATTTC AAAGAT (SEQ ID NO:3)

[0041] On the 5'-end side of the above probe RPA-P, a fluorescent group is labeled on one T base, and a quenching group is labeled on one T base on the 3'-end side. [THF] is designed between the two groups, and the fluorescent group and the quenching group are 2 to 5 bases apart. A C3-spacer is introduced at the 3'-end for terminal capping.

[0042] In some specific embodiments, the fluorescent group is FAM and the quenching group is BHQ1.

[0043] In some specific embodiments, the fluorescent group FAM is labeled on the 30th base T of the probe RPA-P, the quenching group BHQ1 is labeled on the 32nd base T, and the 31st base A is replaced by [THF]. Its sequence is as follows:

[0044] RPA-P: 5'-TTAAAAGCAGGCATGTCCACCGGTGACAAT

[0045] [FAM-dT][THF]T[BHQ1-dT]TAAATTTCAAAGAT-SpC3

[0046] The present invention can directly use the above primer set to achieve real-time fluorescence RPA detection of Salmonella typhimurium. The detection method is as follows:

[0047] Extract the genomic DNA of the sample to be tested or release the bacterial genomic DNA by thermal lysis method;

[0048] Use the above primer set to perform real-time fluorescence RPA reaction on the genomic DNA and make a result determination.

[0049] In some specific embodiments, the temperature of the real-time fluorescence RPA reaction is 30°C to 45°C, and the reaction time is 4 min to 15 min. The minimum detection limit of Salmonella typhimurium is 1.217x10 3 CFU / mL.

[0050] Using the primer set of the present invention for real-time fluorescence RPA detection of Salmonella typhimurium gives a positive result, and the result can be observed in real time with a fluorescence excitation and detection device, with high sensitivity and good specificity.

[0051] The present invention further provides a kit for detecting Salmonella typhimurium by real-time fluorescence RPA, including the above primer set.

[0052] In some preferred embodiments, the kit further includes a reaction buffer. More preferably, the kit further includes a negative control and / or a positive control as needed.

[0053] The above kit can be directly used for real-time fluorescence RPA detection of Salmonella typhimurium. The detection method is the same as above.

[0054] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention.

[0055] Strains:

[0056] Escherichia coli O157:H7 (Escherichia coli O157:H7 CCTCC AB200051), Salmonella Typhimurium (Salmonella Typhimurium CCTCC AB204062), and Staphylococcus aureus (Staphylococcus aureus CCTCC AB2013186) were purchased from the China Center for Type Culture Collection (CCTCC). Yersinia pseudotuberculosis (Yersinia pseudotuberculosis NCTC 10275), Yersinia enterocolitica (Yersinia enterocolitica DSM 13030), Klebsiella pneumoniae (Klebsiella pneumoniae ATCC 11296), methicillin-resistant Staphylococcus aureus (methicillin resistant Staphylococcus aureus NBRC100910), Pseudomonas aeruginosa (Pseudomonas Aeruginosa DSM 50071), and Proteus mirabilis (Proteus mirabilis ATCC 29906) were preserved in our laboratory.

[0057] For the screening of primers and probes and the verification of system specificity, the present invention constructs a specificity verification system based on the principles of genetic evolutionary relatedness and habitat coexistence. Klebsiella pneumoniae, Yersinia pseudotuberculosis, Yersinia enterocolitica, and Proteus mirabilis, which are phylogenetically related to the target strain Salmonella Typhimurium, were selected as genetic controls; at the same time, clinically common cross-contaminated strains, including Escherichia coli O157:H7 (Escherichia coli O157:H7), Staphylococcus aureus, methicillin-resistant Staphylococcus aureus (MRSA), Pseudomonas aeruginosa, and Bacillus cereus, were included to construct a multi-species interference model for specificity verification.

[0058] Reagents and instruments: The bacterial genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; the RPA kit DNA isothermal rapid amplification kit (fluorescent type) was purchased from AmpFuture Biotechnology, and the fluorescence detection instrument used was Thermo Fisher Applied Biosystems QuantStudio 6.

[0059] Template: The genomic DNA of the above strains was extracted using a bacterial genomic DNA extraction kit, and the extraction steps were carried out according to the operating steps in the kit. The concentration and purity of the DNA were measured using a ultra-micro spectrophotometer.

[0060] Example 1 Primer, probe design and screening

[0061] Primers for RPA detection were designed based on the STM4495 gene of Salmonella typhimurium. The primer design principles were: the primer length was 28 - 35 bp, the amplified product size was 150 - 500 bp, the GC content was 40% - 60%, and the Tm value was 50 - 100. Multiple pairs of primers were designed and sent to Sangon Biotech (Shanghai) Co., Ltd. for artificial synthesis. Using the genomic DNA of Yersinia pseudotuberculosis, Yersinia enterocolitica, Klebsiella pneumoniae, Escherichia coli O1547:H7, Salmonella typhimurium, Staphylococcus aureus, methicillin-resistant Staphylococcus aureus, Pseudomonas aeruginosa, and Proteus mirabilis as templates for RPA amplification, the RPA amplification reaction was carried out according to the steps on the DNA isothermal amplification kit. The amplified product was mixed evenly with Tris-saturated phenol / chloroform / isoamyl alcohol (25:24:1) extraction solution in equal proportion, centrifuged at 12,000 rpm for 5 min, and the supernatant was taken for 1.8% agarose gel electrophoresis detection. Primer pairs with good amplification effect, no obvious dimer, and good specificity were screened out.

[0062] Probes were designed based on the upstream primer RPA-F and the downstream primer RPA-R. The probes were designed in primer5.0, and the probe position was between the upstream primer and the downstream primer. The probe design principles were: the probe length was at least 46 bp; THF, that is, an apurinic / apyrimidinic site (AP site), was introduced in the middle of the probe; at least 30 bp of bases were reserved in front of the AP site, and at least 15 bp of bases were behind the AP site; there should be two T bases with close distances on both sides of the AP site, which were respectively modified with a fluorescent group and a quenching group, and the fluorescent group and the quenching group were 2 - 5 bases apart. A C3-spacer was introduced at the 3' end of the probe for terminal blocking.

[0063] Based on primer design principles and mismatch design, primers and probes were designed. The following are 6 sets of primer-probe combinations with relatively good effects. The 6 sets of primer-probe combinations are: ST1-1 and ST-P1, ST1-2 and ST-P1, ST2-1 and ST-P2, ST2-2 and ST-P2, ST3-1 and ST-P3, ST3-1 and ST-P3. Their corresponding nucleotide sequences are shown in Table 1 below.

[0064] Table 1

[0065]

[0066]

[0067] For the above 6 sets of primer-probe combinations, a Real-time RPA experiment was carried out using S.typhimurium genomic DNA (50 ng / μL) as a template. A blank control group (NTC) was set for each group to exclude environmental interference during the experiment.

[0068] The specific experimental steps are as follows: The designed probes were sent to the company for synthesis. Using Salmonella typhimurium STM4495 genomic DNA as a template, amplification was carried out with a DNA isothermal rapid amplification kit (fluorescent type). Take out A buffer and B buffer 30 minutes in advance, melt them at room temperature, and mix them by shaking. The total volume of the amplification reaction is 50 μL. Add 29.4 μL of A buffer, 2 μL of upstream primer and downstream primer, 0.6 μL of probe (the concentration of primer and probe is 10 uM), 11.5 μL of ddH 2 O, 2 μL of template DNA (the concentration of DNA is 50 ng / μL) to each dry powder tube. Finally, add 2.5 μL of B buffer, mix well, centrifuge quickly, and immediately put the reaction tube into the fluorescence detection instrument. The program is set to a constant temperature of 39 °C, and the fluorescence signal is collected every 30 s. The reaction time is 30 minutes. A set of NTC control (no-template negative control) was set for each set of primer-probes. Replace 2 μL of template DNA with ddH 2 O to judge whether false positives occur.

[0069] The experimental results are as shown in Figure 1 A-1F. It can be seen from the results that the amplification curves, starting peak times, and peak signal intensities of different primer-probe combinations are different. Among them, ST3-1 and ST3-2 have relatively early starting peak times, obvious signals have been generated within 10 minutes of the reaction, and the amplification curve conforms to the S-shaped curve, with strong peak signals, meeting the requirements of Real-time RPA amplification.

[0070] Using ST3-1 and ST3-2 as primers, ST-P3 as a probe, and the genomic DNA of S.typhimurium as the reaction template (concentration gradient: 10 7 ~10 1 copies / μL), a set of NTC (using ddH 2 O to replace the template) was set up to conduct a Real-time RPA sensitivity experiment, and the experimental results are as Figure 2 shown. There is little difference between ST3-1 (probe ST-P3) and ST3-2 (probe ST-P3) in detecting genomic DNA with relatively high copies (10 7 、10 6 、10 5 copies / μL), and both can accurately detect. However, compared with ST3-1 (probe ST-P3), ST3-2 (probe ST-P3) has a significant advantage in detecting genomic DNA with low copies (10 4 、10 3 、10 2 、10 1 copies / μL). For ST3-1 (probe ST-P3), there is almost no amplification signal, while for ST3-2 (probe ST-P3), the amplification signal is more obvious.

[0071] There are only a few base differences between ST3-1 and ST3-2, but their detection sensitivities are significantly different. In summary, the primers ST3-2 and the probe ST-P3 with good amplification effect and higher detection sensitivity are selected, that is, the primer pair composed of the upstream primer RPA-F with the sequence shown in SEQ ID NO:1 and the downstream primer RPA-F with the sequence shown in SEQ ID NO:2 and the probe RPA-P (sequences are as follows), as the primer set for real-time fluorescence RPA. It can specifically amplify bright amplification bands of the expected size, show positive results through agarose gel electrophoresis, and can be used for the detection of Salmonella typhimurium. RPA-F: 5’-TACCGAGTCTATTATCTTTTCGCCACCA (SEQ ID NO:1)

[0072] RPA-R: 5’-ATATTCACCTCCACTACTACAAGGAAACCA (SEQ ID NO:2);

[0073] The sequence of the probe RPA-P is as shown in SEQ ID NO:3:

[0074] RPA-P: 5’-TTAAAAGCAGGCATGTCCACCGGTGACAATATTAAATTTCAAAGAT (SEQ ID NO:3)

[0075] The 31st base T on the 5'-end side of probe RPA-P is labeled with the fluorescent group FAM, the 35th base T is labeled with the quenching group BHQ1, the 33rd base A between the two groups is replaced with [THF], and a C3-spacer is introduced at the 3'-end for terminal blocking. Its specific structure is as follows:

[0076] RPA-P: 5'-TTAAAAGCAGGCATGTCCACCGGTGACAAT

[0077] [FAM-dT][THF]T[BHQ1-dT]TAAATTTCAAAGAT-SpC3

[0078] Example 2 Optimization of primer set performance and detection based on real-time fluorescence RPA

[0079] 1) Screening of real-time fluorescence RPA primer concentration

[0080] Using Salmonella typhimurium genomic DNA as a template, amplify with the primer set in Example 2. Use a DNA isothermal rapid amplification kit (fluorescent type). Take out buffer A and buffer B 30 min in advance, melt at room temperature, and mix well by shaking. The total volume of the amplification reaction is 50 μL. Add 29.4 μL of buffer A to each dry powder tube, and add 1 μL, 2 μL, 3 μL, 4 μL, 5 μL, 6 μL, 7 μL of the upstream primer and the downstream primer respectively, 0.6 μL of the probe (the concentrations of the primer and the probe are 10 μM), 2 μL of the template DNA (the concentration of the DNA is 50 ng / μL), and make up to a system of 47.5 μL with ddH 2 O. Finally, add 2.5 μL of buffer B, mix well, centrifuge quickly, and immediately put the reaction tube into a fluorescence detection instrument. Set the program to a constant temperature of 39 °C, collect fluorescence signals every 30 s, and the reaction time is 30 min. Set up a group of NTC controls. The experimental results are as Figure 3 shown. As the primer loading amount increases, the fluorescence intensity of the curve gradually weakens, and the time when the curve starts to peak first shortens and then lengthens. When the primer content increases to 4 μL and later, the peak starting time begins to lengthen, and the fluorescence signal intensity becomes weaker and weaker. To obtain a better amplification effect, considering the fluorescence intensity and the peak starting time comprehensively, a primer loading amount of 3 μL is selected for subsequent experiments.

[0081] 2) Screening of real-time fluorescence RPA probe concentration

[0082] Using Salmonella typhimurium genomic DNA as a template, amplify with the primer set in Example 2. Use a DNA isothermal rapid amplification kit (fluorescent type). Take out A buffer and B buffer 30 minutes in advance, melt at room temperature, and mix well by shaking. The total volume of the amplification reaction is 50 μL. Add 29.4 μL of A buffer to each dry powder tube, 3 μL of upstream primer and downstream primer, and add 0.3 μL, 0.6 μL, 0.9 μL, 1.2 μL, 1.5 μL, 1.8 μL of the probe respectively (the concentration of the primer and probe is 10 μM), 2 μL of template DNA (the concentration of DNA is 50 ng / μL), and make up the system to 47.5 μL with ddH 2 O. Finally, add 2.5 μL of B buffer, mix well, centrifuge quickly, and immediately put the reaction tube into the fluorescence detection instrument. The program is set to be isothermal at 39 °C, and the fluorescence signal is collected every 30 s. The reaction time is 30 min. Set a group of NTC controls. The experimental results are as Figure 4 shown. As the amount of probe added increases, the fluorescence intensity of the amplification curve also increases. There is a large change in fluorescence intensity from 0.6 μL to 0.9 μL. When the added amount is 1.2 μL, the peak time of the curve is the fastest. Compared with the added amounts of 1.5 μL and 1.8 μL of the probe, the fluorescence signal intensity is weaker, but the change is not significant. Considering the fluorescence intensity and peak time comprehensively, select 1.2 μL of the probe added amount for subsequent experiments.

[0083] 3) Screening of the concentration of real-time fluorescence RPA B buffer

[0084] Using Salmonella typhimurium genomic DNA as a template, amplify with the primer set in Example 2. Use a DNA isothermal rapid amplification kit (fluorescent type). Take out A buffer and B buffer 30 minutes in advance, melt at room temperature, and mix well by shaking. The total volume of the amplification reaction is 50 μL. Add 29.4 μL of A buffer to each dry powder tube, 3 μL of upstream primer and downstream primer, 1.2 μL of the probe (the concentration of the primer and probe is 10 μM), 2 μL of template DNA (the concentration of DNA is 50 ng / μL), and make up the system with ddH 2 O. Finally, add 1.5 μL, 2.0 μL, 2.5 μL, 3.0 μL, 3.5 μL, 4.0 μL, 4.5 μL of B buffer respectively, mix well, centrifuge quickly, and immediately put the reaction tube into the fluorescence detection instrument. The program is set to be isothermal at 39 °C, and the fluorescence signal is collected every 30 s. The reaction time is 30 min. Set a group of NTC controls. The experimental results are as Figure 5As shown, with the increase in the content of B buffer, the fluorescence intensity gradually weakens. When the loading volume of B buffer is 2.0 μL, 2.5 μL, and 3.0 μL, the fluorescence signal intensities are relatively consistent. When the loading volume of B buffer is 2.5 μL, the peak starting time is the earliest. When the loading volume ≥ 3.5 μL, the fluorescence signal intensity continuously decreases, and the peak starting time gradually becomes later. Considering both the fluorescence intensity and the peak starting time, a loading volume of 2.5 μL of B buffer is selected for subsequent experiments.

[0085] 4) Specific detection of real-time fluorescence RPA

[0086] The primer sets screened and designed in Example 2 were subjected to specificity verification. Using the genomic DNA of Yersinia pseudotuberculosis, Yersinia enterocolitica, Klebsiella pneumoniae, Escherichia coli O1547:H7, Salmonella typhimurium, Staphylococcus aureus, Methicillin-resistant Staphylococcus aureus, Pseudomonas aeruginosa, and Proteus mirabilis as templates for RPA reactions, a set of no-template controls (NTC) was set up, and amplification was carried out using a DNA isothermal rapid amplification kit (fluorescent type). Take out A buffer and B buffer 30 min in advance, melt at room temperature, and mix well by oscillation. The total volume of the amplification reaction is 50 μL. Add 29.4 μL of A buffer, 3.0 μL of upstream primer and downstream primer, 1.2 μL of probe (the concentration of the primer and probe is 10 uM), 8.9 μL of ddH 2 O, 2 μL of template DNA (the concentration of DNA is 50 ng / μL), and finally add 2.5 μL of B buffer, mix well, centrifuge quickly, and immediately place the reaction tube into a fluorescence detection instrument. The program is set to a constant temperature of 39 °C, and the fluorescence signal is collected every 30 s, and the reaction time is 30 min. The results obtained are as Figure 6 shown. The result of real-time fluorescence RPA with the genomic DNA of Salmonella typhimurium as the template is positive, and the results of the real-time fluorescence RPA reaction systems with other genomic DNAs and no-template DNA as templates are negative, indicating that this detection system can specifically detect Salmonella typhimurium with good detection specificity.

[0087] 5) Determination of the lowest detection limit of real-time fluorescence RPA

[0088] Salmonella typhimurium was diluted to 10 7 、10 5 、10 4 、10 3 、10 2 、10 1CFU / mL. The genomic DNA was released by thermal lysis method. Subsequently, 2 μL of the thermal lysis product was taken as the template for RPA reaction to evaluate the lowest detection limit of real-time fluorescence RPA. The DNA isothermal rapid amplification kit (fluorescent type) was used for amplification. Take out buffer A and buffer B 30 min in advance, melt them at room temperature, and mix well by shaking. The total volume of the amplification reaction was 50 μL. Add 29.4 μL of buffer A, 3.0 μL of upstream primer and downstream primer, 1.2 μL of probe (the concentration of primer and probe is 10 μM), 8.9 μL of ddH 2 O, 2 μL of template DNA, and finally add 2.5 μL of buffer B, mix well, centrifuge quickly. Set up a template-free control (NTC). Immediately put the reaction tube into the fluorescence detection instrument. The program was set at a constant temperature of 39 °C, and the fluorescence signal was collected every 30 s. The reaction time was 30 min. The results are as Figure 7 shown. The lowest detectable amount of this system was 10 3 CFU / mL. Repeat this sensitivity detection experiment independently eight times. When the template concentration ≥ 10 3 CFU / mL, the detection success rate of this system was 100%, and the detection effect was good. Use IBM SPSS Statistics to perform probit analysis on the above results. The results are as Figure 8 shown. When the template concentration was 1.217x10 3 CFU / ml, the probability of detecting a positive was 95%. It indicated that the sensitivity (lowest detection limit) of the Real-time RPA detection system was 1.217x10 3 CFU / ml. The detection time of this system for DNA templates with concentrations of 10 7 ~10 3 CFU / mL was only 4 - 15 min.

[0089] 6) Detect Salmonella typhimurium in the sample by real-time fluorescence RPA method

[0090] Detect fresh chicken and egg samples with the real-time fluorescence RPA detection system and compare it with the qPCR method. The primers for the qPCR reaction refer to the literature. The upstream primer is: GATTTGAAGGCCGGTATTATTG (SEQ ID NO:4), and the downstream primer is: ATAAACTTCATCGCACCGTCA (SEQ ID NO:5). The qPCR reaction system is: 10 μL of 2×Taq Pro Universal SYBR qPCR Master Mix, 0.4 μL of upstream primer (10 μM), 0.4 μL of downstream primer (10 μM), 2 μL of genomic template, 7.2 μL of ddH 2Make up the volume to 20 μL. After vortexing and briefly centrifuging the loaded system, detect it with a quantitative PCR instrument. The detection procedure is as follows: pre-denaturation: 95°C for 180 s, cycling reaction: 95°C for 10 s, 60°C for 30 s, a total of 40 cycles. The melting curve is set according to the machine default value. A CT value less than or equal to 35 is judged as positive, and greater than 35 is judged as negative. Purchase fresh chicken from the local vegetable market, grind the sample into a homogenate. When dealing with eggs, take out the egg liquid and fully vortex to achieve yolk-white homogenization. Take 10 g of chicken homogenate and egg tissue homogenate and mix them with the enrichment broth, enrich at 25°C and 200 rpm for 24 h, and detect by qPCR method. The detection result shows that it does not contain Salmonella typhimurium. Then contaminate 20 chicken homogenate samples and 20 egg homogenate samples (blank samples) that do not contain Salmonella typhimurium randomly with Salmonella typhimurium at different concentrations (10 3 ~10 7 CFU / mL) and sterile PBS respectively, extract the genomic DNA using a tissue genomic DNA extraction kit, and detect simultaneously with real-time fluorescence RPA and qPCR. The detection results are shown in Tables 2 and 3.

[0091] Table 2 Detection results of real-time fluorescence RPA and qPCR for chicken contaminated samples

[0092]

[0093] +: positive -: negative

[0094] Table 3 Detection results of real-time fluorescence RPA and qPCR for egg contaminated samples

[0095]

[0096]

[0097] +: positive -: negative

[0098] In both chicken samples and egg samples, 15 positives and 5 negatives were detected by real-time fluorescence RPA, which is the same as the qPCR result and consistent with the contamination result, with an accuracy rate of 100%, indicating that the real-time fluorescence RPA detection system can be well applied to actual detection.

[0099] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. A primer pair for detecting Salmonella typhimurium based on RPA, characterized in that: It includes an upstream primer RPA-F whose sequence is shown in SEQ ID NO:1 and a downstream primer RPA-R whose sequence is shown in SEQ ID NO:

2.

2. A primer set for detecting Salmonella typhimurium based on real-time fluorescence RPA, characterized in that: It comprises an upstream primer RPA-F whose sequence is shown in SEQ ID NO:1, a downstream primer RPA-R whose sequence is shown in SEQ ID NO:2 and a probe RPA-P whose sequence is shown in SEQ ID NO:

3.

3. The primer set for detecting Salmonella typhimurium based on real-time fluorescence RPA according to claim 2, characterized in that: A fluorescent group is labeled on a T base at the 5' end of the probe RPA-P, and a quenching group is labeled on a T base at the 3' end. [THF] is designed between the two groups. The fluorescent group and the quenching group are 2 to 5 bases apart. A C3-spacer is introduced at the 3' end for terminal blocking.

4. A kit for detecting Salmonella typhimurium using real-time fluorescence RPA, characterized in that: Comprising the primer set of claim 2 or 3.

5. The kit according to claim 4, characterized in that The kit also includes a reaction buffer.

6. The kit according to claim 5, characterized in that The kit also includes a negative control and / or a positive control.

7. A method for rapid detection of Salmonella typhimurium for non-disease diagnosis purposes based on real-time fluorescence RPA, characterized in that: The steps include: Extract the genomic DNA of the sample to be tested or release the bacterial genomic DNA by thermal lysis; Using the primer set described in claim 2 or 3, or the kit described in any one of claims 4 to 6, a real-time fluorescent RPA reaction is performed on genomic DNA, and the result is determined.

8. The method according to claim 7, characterized in that The temperature of the real-time fluorescence RPA reaction is 30° C. to 45° C., and the reaction time is 4 to 15 minutes.

9. The method according to claim 7, characterized in that: The minimum detection limit of Salmonella typhimurium was 1.217x10 3 CFU / mL.