SNP (Single Nucleotide Polymorphism) marker combination for realizing accurate origin traceability of tetrastigma hemsleyanum and application

Abstract

The invention belongs to a method for tracing the origin of tetrastigma hemsleyanum, and particularly discloses an SNP (Single Nucleotide Polymorphism) marker combination for realizing the accurate origin of tetrastigma hemsleyanum, and the SNP marker combination is composed of the following primer pairs: The-cc-snp01, The-ec-snp03, The-ec-snp04, The-sc-snp01 and The-sw-snp02. The invention also discloses a method for accurately tracing the origin of tetrastigma hemsleyanum, which utilizes the SNP marker combination and comprises the following steps: acquiring DNA of tetrastigma hemsleyanum to be detected; carrying out PCR (Polymerase Chain Reaction) amplification; and judging according to an amplification result. According to the method, accurate origin traceability of all distribution regions of the tetrastigma hemsleyanum can be realized; therefore, the quality of the tetrastigma hemsleyanum medicinal material is guaranteed.

Description

Technical Field

[0001] The present invention belongs to a method for tracing the origin of Clerodendrum trifoliatum, and relates to a SNP marker combination and application for realizing accurate origin tracing of Clerodendrum trifoliatum. Background Art

[0002] Tetrastigma hemsleyanum Diels et Gilg, also known as Sanyeqing, is a vine of the genus Tetrastigma in the family Vitaceae. The whole plant can be used for medicinal purposes, with the underground tubers and fruits having the best medicinal effects. It has the effects of promoting blood circulation, removing blood stasis, detoxifying, and resolving phlegm. It is clinically used to treat viral meningitis, Japanese encephalitis, viral pneumonia, jaundice hepatitis, etc., especially the tubers are effective for high fever in children (Hu et al., 2021). In China, it is widely distributed in Jiangsu, Zhejiang, Jiangxi, Fujian, Taiwan, Guangdong, Guangxi, Hubei, Hunan, Sichuan, Guizhou, Yunnan, and Tibet (Wen, 2007); it grows in rock crevices under forests on slopes, valleys, and streams at an altitude of 300-1300 meters. Although the geographical distribution of Tetrastigma hemsleyanum is wide, long-term human excavation has led to the depletion of its wild resources, and scientific protection is urgently needed. Ex situ conservation is the most important means to effectively preserve species genetic resources, and the evaluation of potential habitat suitability, construction of suitable ex situ habitats, establishment of ex situ populations and adaptability evaluation are the keys to successful ex situ conservation. At the same time, strengthening the genetic management of ex situ populations, avoiding potential genetic risks, and maintaining the genetic integrity of species are also key factors for successful ex situ conservation. The chemical composition of three-leaf cliff creeper from different origins varies significantly, which will directly affect the efficacy and cultivation and domestication effects. Therefore, in order to avoid genetic mixing caused by blind introduction, the genetic integrity of the species is maintained. Ensure the stability of the efficacy of three-leaf cliff creeper cultivars. And rationally plan the planting area to reduce the over-exploitation of wild resources. We urgently need an efficient and reliable technology to accurately trace the origin of three-leaf cliff creeper.

[0003] The patent application with publication number CN118392599A discloses a method for tracing the origin of Tripterygium wilfordii based on mineral elements and stable isotopes. The method is: collect Tripterygium wilfordii samples from six regions, namely Zhejiang, Fujian, Jiangxi, Guangxi, Yunnan and Chongqing, prepare analytical samples and number them; weigh Tripterygium wilfordii sample powder and put it into a can, add pure nitric acid, seal the can and put it into an oven for digestion reaction; after the digestion reaction is completed, fix the volume of the digested solution, and then filter the sample solution for mineral elements and stable isotopes. 32 S and 10 B Analysis: SPSS22.0 software was used for single-factor ANOVA analysis, and Duncan's multiple comparison method was used to determine the differences in mineral elements of clover from different origins. This method detected 43 mineral elements and isotopes of clover from different origins. 32 S and10 The content of B was determined, and a traceability model for the place of origin was established to predict the place of origin of Tetrastigma hemsleyanum. However, this technology is easily affected by environmental conditions, thus affecting the accuracy of traceability. That is, the content and ratio of mineral elements and stable isotopes are easily affected by environmental factors such as soil, climate, and water source, which may lead to differences in the analysis results of samples from the same place of origin in different batches, affecting the accuracy of traceability. In addition, the above method is cumbersome and time-consuming, requires the use of high-precision instruments such as mass spectrometers, spectrometers, and expensive reagents, and the experimental cost is relatively high.

[0004] Although the place-of-origin traceability method based on mineral elements and stable isotopes has certain advantages in macroscopic geographical traceability, it has disadvantages in terms of environmental factor influence, sample processing complexity, instrument and cost requirements, resolution and specificity, data analysis and model establishment, and scope of application. In contrast, the place-of-origin traceability method based on SNP specific loci has higher stability, simplicity, cost-effectiveness, and resolution, and is a more efficient and reliable traceability method.

[0005] The invention of CN119410826A, "A method for rapidly identifying Tetrastigma hemsleyanum var. macrophyllum and Tetrastigma hemsleyanum var. microphyllum", discloses a PCR method for rapidly identifying Tetrastigma hemsleyanum var. macrophyllum and Tetrastigma hemsleyanum var. microphyllum, including: 1. Extracting the DNA of Tetrastigma hemsleyanum by the CTAB method; 2. Performing PCR amplification with a pair of forward and reverse primers for amplifying the DNA sequence of the promoter region of the FLS11 gene; 3. Analyzing by agarose gel electrophoresis and detecting the PCR products under an ultraviolet gel imaging system. The present invention has established a rapid, convenient, and reliable identification method, which is simple to operate, low in price, good in reproducibility, good in stability, and can be directly used for rapidly identifying different types of Tetrastigma hemsleyanum. This method can well distinguish between Tetrastigma hemsleyanum var. microphyllum and Tetrastigma hemsleyanum var. macrophyllum, but it cannot achieve accurate place-of-origin traceability for Tetrastigma hemsleyanum of the same type from different geographical sources.

[0006] The references involved in the above text are as follows:

[0007] Hu W, Zheng Y, Xia P, Liang Z. 2021. The research progresses and future prospects of Tetrastigma hemsleyanum Diels et Gilg: A valuable Chinese herbal medicine. Journal of Ethnopharmacology 271, 113836.

[0008] Wen J. 2007. Vitaceae. In: Kubitzki K, ed. Flowering Plants - Eudicots. Berlin: Springer - Verlag, 467–479. Summary of the Invention

[0009] The technical problem to be solved by the present invention is to provide an SNP marker combination for realizing precise origin traceability of Tetrastigma hemsleyanum and its application.

[0010] To solve the above - mentioned technical problem, the present invention provides an SNP marker combination for realizing precise origin traceability of Tetrastigma hemsleyanum, which consists of the following primer pairs:

[0011] The - cc - snp01:

[0012] Forward primer: ATTTGGGCTTGAAGGTCTAGGC

[0013] Reverse primer: AGGAACAAGACAACGAAGGTGC;

[0014] The - ec - snp03:

[0015] Forward primer: GTCGTACTGGGATCACCCTTCT

[0016] Reverse primer: TGAACATGACCTTGCTCACTGG

[0017] The - ec - snp04

[0018] Forward primer: CAGTCGGCCCGCAAATGAAAT

[0019] Reverse primer: CGGTCTGATCCATGTTGAAGCA

[0020] The - sc - snp01

[0021] Forward primer: ATAGCATGGCAGCAAGGCAATC

[0022] Reverse primer: AGCCGCAGGATAGATTCCAGTC

[0023] The - sw - snp02

[0024] Forward primer: GCCAAGGTAACATCGGTTTGG

[0025] Reverse primer: TGTCTGTTGGGTTAGGCTCAGT.

[0026] The present invention also provides a method for precise origin tracing of *Tetrastigma hemsleyanum*: Using the above SNP marker combination, it includes the following steps:

[0027] 1), Obtain the DNA of the *Tetrastigma hemsleyanum* to be tested;

[0028] 2), Conduct PCR amplification;

[0029] The PCR system is:

[0030] DNA 50 - 100 ng;

[0031] Primer F / R 0.5 / 0.5 μL;

[0032] 2×Rapid Taq Master Mix (Novoprotein, P222 - 01) 10 μL;

[0033] ddH 2 O To 20 μL;

[0034] The PCR amplification program is:

[0035] 95°C, 6 min;

[0036] 95°C, 15 s; 55°C, 15 s; 72°C, 7 s; 35 cycles;

[0037] 72°C, 5 min;

[0038] 4°C, hold;

[0039] 3), Judgment.

[0040] As an improvement to the method for precise origin tracing of *Tetrastigma hemsleyanum* of the present invention:

[0041] The SNP marker corresponding to the specific primer The - cc - snp01 is located at the 61665485th base of chromosome No. 6 of the *Tetrastigma hemsleyanum* genome. The nucleotide at the SNP locus is "G" in the CC lineage and "T" in the other lineages. Then, it is determined that the origin of the individual with the base "G" is central China;

[0042] The SNP marker corresponding to the specific primer The - ec - snp03 is located at the 62098925th base of chromosome No. 15 of the *Tetrastigma hemsleyanum* genome. The nucleotide at the SNP locus is "A" in the EC lineage and "C" in the other lineages. Then, it is determined that the origin of the individual with the base "A" is eastern China;

[0043] The SNP marker corresponding to the specific primer The-ec-snp04 is located at the 62,100,681st base of chromosome 15 in the genome of *Tetrastigma hemsleyanum*. If the nucleotide at this SNP locus is "C" in the EC lineage and "T" in other lineages, then an individual with the base "C" is determined to be from eastern China;

[0044] The SNP marker corresponding to the specific primer The-sc-snp01 is located at the 39,720,990th base of chromosome 2 in the genome of *Tetrastigma hemsleyanum*. If the nucleotide at this SNP locus is "C" in the SC lineage and "G" in other lineages, then an individual with the base "C" is determined to be from southern China;

[0045] The SNP marker corresponding to the specific primer The-sw-snp02 is located at the 57,724,452nd base of chromosome 4 in the genome of *Tetrastigma hemsleyanum*. If the nucleotide at this SNP locus is "C" in the SW lineage and "T" in other lineages, then an individual with the base "G" is determined to be from southwestern China.

[0046] The present invention aims to develop a stable, highly accurate, simple to operate, and low-cost origin tracing technology using high-throughput sequencing data to achieve precise origin tracing for all distribution areas of *Tetrastigma hemsleyanum*, thereby realizing goals such as quality assurance of *Tetrastigma hemsleyanum* medicinal materials, medication safety, resource protection, and industrial upgrading.

[0047] The core points of the present invention lie in the systematic screening of genome-wide SNPs, the precise locking of homozygous sites, and the functional fusion design of primers and SNP sites; the innovative deep integration of population genetics and molecular markers and the high-throughput sequencing-driven marker development process. Compared with traditional methods, it has significant advantages in stability, resolution, cost-effectiveness, and operation convenience, and is particularly suitable for the origin tracing scenario of *Tetrastigma hemsleyanum* that requires high precision and large scale. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] The following further elaborates on the specific embodiments of the present invention in conjunction with the accompanying drawings.

[0049] Figure 1 It is the ADMIXTURE analysis result of *Tetrastigma hemsleyanum*;

[0050] Figure 2 The PCR amplification results of 27 individuals using the CC lineage-specific primer The-cc-snp01;

[0051] Figure 3 The PCR amplification results of 27 individuals using the CC lineage-specific primer The-cc-snp02;

[0052] Figure 4PCR amplification results of 27 individuals using the EC lineage-specific primer The-ec-snp01;

[0053] Figure 5 PCR amplification results of 27 individuals using the EC lineage-specific primer The-ec-snp02;

[0054] Figure 6 PCR amplification results of 27 individuals using the EC lineage-specific primer The-ec-snp03;

[0055] Figure 7 PCR amplification results of 27 individuals using the EC lineage-specific primer The-ec-snp04;

[0056] Figure 8 PCR amplification results of 27 individuals using the SC lineage-specific primer The-sc-snp01;

[0057] Figure 9 PCR amplification results of 27 individuals using the SC lineage-specific primer The-sc-snp02;

[0058] Figure 10 PCR amplification results of 27 individuals using the SC lineage-specific primer The-sc-snp03;

[0059] Figure 11 PCR amplification results of 27 individuals using the SC lineage-specific primer The-sc-snp04;

[0060] Figure 12 PCR amplification results of 27 individuals using the SW lineage-specific primer The-sw-snp01;

[0061] Figure 13 PCR amplification results of 27 individuals using the SW lineage-specific primer The-sw-snp02;

[0062] Figure 14 PCR amplification results of 27 individuals using the SW lineage-specific primer The-sw-snp03;

[0063] Figure 15 PCR amplification results of 27 individuals using the SW lineage-specific primer The-sw-snp04;

[0064] Figure 16 First-generation sequencing results of the PCR amplification products of the specific primers of the four lineages. Detailed implementation manners

[0065] The present invention will be further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0066] Example 1. Method for obtaining SNPs positions and corresponding primers, comprising the following steps:

[0067] 1). The applicant collected leaf materials of Tetrastigma hemsleyanum from different geographical sources and performed high-throughput whole-genome resequencing.

[0068] The leaf materials of Tetrastigma hemsleyanum from different geographical sources are shown in Table 1 below.

[0069] Table 1. Information of Tetrastigma hemsleyanum samples for whole-genome resequencing

[0070]

[0071]

[0072]

[0073]

[0074]

[0075] 2). The sequenced data was filtered and then aligned to the reference genome of Tetrastigma hemsleyanum to obtain a VCF1 file containing single nucleotide polymorphism sites (SNPs).

[0076] 3). The obtained VCF1 file was used for population genetic structure analysis with ADMIXTURE software, and all individuals were divided into different lineages, namely the Central China lineage (CC), the East China lineage (EC), the South China lineage (SC), and the Southwest China lineage (SW), hereinafter referred to as CC, EC, SC, and SW for short. The specific differentiation of the lineages is as Figure 1 .

[0077] 4). Use BCFTOOLS software to obtain a VCF2 file without heterozygous sites from the above VCF1 file. Then, specific SNPs sites were screened out for each lineage. The specific steps are as follows:

[0078] First, extract a VCF3 file containing all individuals of the target lineage from the VCF2 file without heterozygous sites. Then, only screen out the sites where the genotypes of all individuals in the target lineage are completely consistent to obtain a VCF4 file, and record the corresponding SNPs site position information (positions1). The number of SNPs sites (positions1) is specifically shown in Table 2 below;

[0079] According to the obtained position information (positions1), use the VCFTOOLS software to remove all individuals of the target lineage from the VCF2 file to obtain the VCF5 file. Use the BCFTOOLS software to screen the sites in the VCF5 file where the genotypes of individuals without the target lineage are not present among the remaining individuals, to obtain the VCF6 file, and simultaneously record the corresponding SNP site position information (positions2). The number of the SNPs sites (positions2) is specifically as shown in Table 2 below;

[0080] Table 2. Site information where the analysis process meets the corresponding conditions

[0081] Pedigree Position1 (pcs) Position2 (pcs) CC 181 2 EC 133212 10 SC 11775 7975 SW 75851 71619

[0082] According to the obtained position information (positions2), use the VCFTOOLS software to extract the VCF7 file containing all individuals of the target lineage and the remaining lineages from the VCF2 file. At this time, in the VCF7 file, the SNP sites of the individuals of the target lineage and the individuals of the remaining lineages are both in the homozygous state and have different genotypes.

[0083] 5), Design specific primers according to the finally obtained SNP position information (position2). Use the SAMTOOLS software to extract the sequences of 150 bp upstream and downstream of the SNP sites that meet the conditions from the reference genome, and use Primer Premier 6 to design specific primers for different lineages. The requirements for primer design are that the Tm value is 58°C ± 2°C, the primer length is 18 - 22 bp, and the length of the amplification product is 100 - 300 bp. Finally, select the primers with a score of "Good" or "Best" and the target SNP site located in the amplification product, and send them to a biological company for primer synthesis.

[0084] The obtained primers are specifically as described in Table 3 below.

[0085] Table 3. Information on 14 SNP molecular markers of Tetrastigma hemsleyanum

[0086]

[0087]

[0088] Example 2: Use a nucleic acid extraction kit to extract the DNA of 27 Tetrastigma hemsleyanum individuals that have not undergone whole-genome resequencing. The 27 individuals are all from different populations, as shown in Table 4 below.

[0089] Table 4. Sample information for testing the effectiveness of SNP molecular markers

[0090] Serial Number Sample Name Pedigree where the sample is located Sampling Point 1 CQNC05 CC Nanchuan District, Chongqing City 2 GXZY02 CC Ziyuan County, Guilin City, Guangxi Zhuang Autonomous Region 3 GZLS08 CC Leishan County, Qiandongnan Prefecture, Guizhou Province 4 HBLC04 CC Lichuan City, Enshi Prefecture, Hubei Province 5 HBWF04 CC Wufeng County, Yichang City, Hubei Province 6 HBXS01 CC Xingshan County, Yichang City, Hubei Province 7 HNCS05 CC Yuelu District, Changsha City, Hunan Province 8 SCEMS05 CC Emeishan City, Leshan City, Sichuan Province 9 SCXY02 CC Xuyong County, Luzhou City, Sichuan Province 10 AHQM05 EC Qimen County, Huangshan City, Anhui Province 11 HBTS06 EC Tongshan County, Xianning City, Hubei Province 12 JXCY06 EC Chongyi County, Ganzhou City, Jiangxi Province 13 JXXS05 EC Xiushui County, Jiujiang City, Jiangxi Province 14 ZJKH03 EC Kaihua County, Quzhou City, Zhejiang Province 15 ZJSC02 EC Suichang County, Lishui City, Zhejiang Province 16 FJXL06 SC Xinluo District, Longyan City, Fujian Province 17 FJYA02 SC Yong'an City, Sanming City, Fujian Province 18 FJYP04 SC Yanping District, Nanping City, Fujian Province 19 GDLH03 SC Luohu District, Shenzhen City, Guangdong Province 20 GXJX02 SC Jinxiu County, Laibin City, Guangxi Zhuang Autonomous Region 21 GXQB05 SC Qinbei District, Qinzhou City, Guangxi Zhuang Autonomous Region 22 HNRC06 SC Rucheng County, Chenzhou City, Hunan Province 23 GXHJ05 SW Huanjiang County, Hechi City, Guangxi Zhuang Autonomous Region 24 GXLY07 SW Lingyun County, Baise City, Guangxi Zhuang Autonomous Region 25 GZBZ03 SW Bozhou District, Zunyi City, Guizhou Province 26 HNJS02 SW Jishou City, Xiangxi Prefecture, Hunan Province 27 YNXC02 SW Xichou County, Wenshan Prefecture, Yunnan Province

[0091] The nucleic acid extraction kit used is, for example, the FastPure Plant DNA Isolation Mini Kit with the model number DC104-01 from Nanjing Novoprotein Co., Ltd. All the reagents used for DNA extraction below are provided by this kit.

[0092] Specifically as follows:

[0093] Step 1. Sample treatment

[0094] Take 100 mg of fresh plant tissue or 20 mg of dry plant tissue, add liquid nitrogen and grind it into powder thoroughly, and transfer the powder to a 1.5 ml centrifuge tube.

[0095] Step 2. DNA extraction (performed according to the kit instructions), and the following steps are carried out in sequence:

[0096] 1). Immediately add 400 μl of Buffer A1 and 4 μl of RNase A (10 mg / ml) to the ground sample powder, vortex and mix well to help with lysis.

[0097] 2). Incubate in a water bath at 65 °C for 10 min. During the water bath, invert the centrifuge tube 2 - 3 times to mix the sample.

[0098] 3). Add 130 μl of Buffer A2 to the mixture, mix well, place on ice for 5 min, centrifuge at 14,000 rpm (18,400 × g) for 5 - 10 min, carefully aspirate the supernatant into a new 1.5 ml centrifuge tube (prepared by yourself), and be careful not to aspirate the interfacial substance.

[0099] 4). Calculate the volume of the supernatant, add 1.5 times the volume of the supernatant of Buffer A3 (please check whether absolute ethanol has been added before use), for example, add 750 μl of Buffer A3 to 500 μl of supernatant, and immediately pipette and mix well.

[0100] 5). Transfer the mixture (including the precipitate) obtained in the previous step to FastPure gDNA Columns IV (the adsorption column has been placed in the collection tube), centrifuge at 12,000 rpm (13,400 × g) for 30 - 60 sec, and discard the filtrate.

[0101] 6). Add 600 μl of Buffer AW (please check whether absolute ethanol has been added before use), centrifuge at 12,000 rpm (13,400 × g) for 30 sec, and discard the filtrate.

[0102] 7). Repeat step 6).

[0103] 8), Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm (13,400×g) for 2 min to remove as much washing solution as possible to avoid the inhibition of downstream reactions by residual ethanol in the washing solution. After centrifuging the empty column, the lid can be opened and placed for 2 - 5 min to allow the residual ethanol to completely evaporate.

[0104] 9), Place the adsorption column in a new 1.5 ml centrifuge tube (prepared by yourself). Add 50 - 100 μl of Elution Buffer preheated to 65 - 70 °C to the center of the membrane of the adsorption column, let it stand at room temperature for 3 - 5 min, and centrifuge at 12,000 rpm (13,400×g) for 1 min.

[0105] 10), Discard the adsorption column and store the DNA at -20 °C.

[0106] Example 3: The DNA of the 27 individuals (Table 4) obtained in Example 2 was respectively subjected to the following operations:

[0107] The DNA PCR system is as follows:

[0108] DNA 50 - 100 ng (calculated according to the DNA concentration);

[0109] Primer F / R 0.5 / 0.5 μL;

[0110] 2×Rapid Taq Master Mix (Novoprotein, P222 - 01) 10 μL;

[0111] ddH 2 O To 20 μL.

[0112] The PCR amplification program is as follows:

[0113] 95 °C, 6 min;

[0114] 95 °C, 15 s; 55 °C, 15 s; 72 °C, 7 s; 35 cycles;

[0115] 72 °C, 5 min;

[0116] 4 °C, hold.

[0117] Perform PCR amplification on the 27 individuals described in Table 4 using the specific primers of different lineages as described in Table 3; specifically as follows:

[0118] I. Specific primers for the CC lineage:

[0119] When the primers F / R adopt the CC lineage specific primer The - cc - snp01, the PCR amplification results of the 27 individuals are as Figure 2 described;

[0120] When the primers F / R are the CC lineage-specific primer The-cc-snp02, the PCR amplification results of 27 individuals are as Figure 3 described;

[0121] According to Figure 2 and Figure 3 , it can be known that:

[0122] The fragment size of the amplification product of the The-cc-snp01 primer is around the 150bp position shown by the marker, which is consistent with the expected product length of 123bp, and obvious amplification bands are observed in all 27 individuals. This indicates that the specific primer has successfully amplified in the 27 individuals, and the product can be sent to the company for sequencing.

[0123] The fragment size of the amplification product of the The-cc-snp02 primer is around the 200bp position shown by the marker, which is consistent with the expected product length of 204bp, and obvious amplification bands are observed in all 27 individuals. This indicates that the specific primer has successfully amplified in the 27 individuals, and the product can be sent to the company for sequencing.

[0124] II. Regarding the EC lineage-specific primers:

[0125] When the primers F / R are the EC lineage-specific primer The-ec-snp01, the PCR amplification results of 27 individuals are as Figure 4 described;

[0126] When the primers F / R are the EC lineage-specific primer The-ec-snp02, the PCR amplification results of 27 individuals are as Figure 5 described;

[0127] When the primers F / R are the EC lineage-specific primer The-ec-snp03, the PCR amplification results of 27 individuals are as Figure 6 described;

[0128] When the primers F / R are the EC lineage-specific primer The-ec-snp04, the PCR amplification results of 27 individuals are as Figure 7 described.

[0129] According to Figures 4 - 7 , it can be known that:

[0130] The fragment size of the amplification product of the The-ec-snp01 primer is between 200 - 300bp shown by the marker, which is consistent with the expected product length of 250bp, and 4 individuals failed to amplify successfully.

[0131] The amplified product fragment size of the -ec-snp02 primer is between 200 - 300 bp shown by the marker, consistent with the expected product length of 231 bp. There were 6 individuals in which the amplification was not successful.

[0132] The amplified product fragment size of the -ec-snp03 primer is around the 200 bp position shown by the marker, consistent with the expected product length of 201 bp. All 27 individuals were successfully amplified.

[0133] The amplified product fragment size of the -ec-snp04 primer is between 150 - 200 bp shown by the marker, consistent with the expected product length of 179 bp. All 27 individuals were successfully amplified.

[0134] Finally, the two pairs of PCR products with better amplification effects, The-ec-snp03 and The-ec-snp04, were selected and sent to the company for sequencing.

[0135] III. Specific primers for the SC lineage:

[0136] When the primers F / R used the SC lineage-specific primer The-sc-snp01, the PCR amplification results of 27 individuals were as Figure 8 described;

[0137] When the primers F / R used the SC lineage-specific primer The-sc-snp02, the PCR amplification results of 27 individuals were as Figure 9 described;

[0138] When the primers F / R used the SC lineage-specific primer The-sc-snp03, the PCR amplification results of 27 individuals were as Figure 10 described;

[0139] When the primers F / R used the SC lineage-specific primer The-sc-snp04, the PCR amplification results of 27 individuals were as Figure 11 described;

[0140] According to Figures 8 - 11 , it can be known that:

[0141] The amplified product fragment size of the The-sc-snp01 primer is between 200 - 300 bp shown by the marker, consistent with the expected product length of 221 bp. Although the amplification effects of 2 individuals were not optimal, amplification could still be achieved.

[0142] The amplified product fragment size of the The-sc-snp02 primer is between 150 - 200 bp shown by the marker, consistent with the expected product length of 186 bp. All 27 individuals were successfully amplified.

[0143] The fragment size of the amplification product of the -sc-snp03 primer is between 150 - 200bp shown by the marker, which is consistent with the expected product length of 178bp. One individual failed to amplify successfully.

[0144] The fragment size of the amplification product of the -sc-snp04 primer is between 150 - 200bp shown by the marker, which is consistent with the expected product length of 188bp. All 27 individuals were amplified successfully.

[0145] Subsequently, the amplification products of the 4 pairs of specific primers of the SC lineage were sent to the company for sequencing.

[0146] IV. Specific primers for the SW lineage:

[0147] When the primers F / R use the SW lineage specific primer The-sw-snp01, the PCR amplification results of 27 individuals are as Figure 12 described;

[0148] When the primers F / R use the SW lineage specific primer The-sw-snp02, the PCR amplification results of 27 individuals are as Figure 13 described;

[0149] When the primers F / R use the SW lineage specific primer The-sw-snp03, the PCR amplification results of 27 individuals are as Figure 14 described;

[0150] When the primers F / R use the SW lineage specific primer The-sw-snp04, the PCR amplification results of 27 individuals are as Figure 15 described;

[0151] According to Figures 12 - 15 , it can be known that:

[0152] The fragment size of the amplification product of the The-sw-snp01 primer is around the 150bp position shown by the marker, which is consistent with the expected product length of 137bp. 3 individuals failed to amplify successfully, and the amplification effect of 6 individuals was not ideal.

[0153] The fragment size of the amplification product of the The-sw-snp02 primer is between 150 - 200bp shown by the marker, which is consistent with the expected product length of 214bp. All 27 individuals were amplified successfully, and the amplification effect of 1 individual was not ideal.

[0154] The fragment size of the amplification product of the The-sw-snp03 primer is around the 200 - 300bp position shown by the marker, which is consistent with the expected product length of 208bp. 4 individuals failed to amplify successfully.

[0155] The amplified product fragment size of the The-sw-snp04 primer is around the position of 150 - 200 bp shown by the marker, which is consistent with the expected product length of 168 bp. There were 8 individuals in which the amplification was not successful.

[0156] Finally, the PCR products with better amplification effect of The-sw-snp02 were selected and sent to the company for sequencing.

[0157] Furthermore:

[0158] I. Specific primers for the CC lineage:

[0159] 1.1), When using the CC lineage specific primer The-cc-snp01, the first-generation sequencing results of the PCR amplification products of 27 individuals are as Figure 16 described in A.

[0160] For individuals with codes 1 - 9, the sequencing result shows that the 81st base is "G", while for individuals with codes 10 - 27, it shows "T" at this position;

[0161] As shown in Table 3, the SNP site base corresponding to the The-cc-snp01 primer is G / T, and the sequencing result is consistent with the expectation;

[0162] Meanwhile, as shown in Table 4, individuals with codes 1 - 9 belong to the CC lineage; while individuals with codes 10 - 27 belong to the other three different lineages.

[0163] Therefore, it shows that the specific primer The-cc-snp01 can achieve accurate origin tracing of Tetrastigma hemsleyanum of the CC lineage.

[0164] 1.2), When using the CC lineage specific primer The-cc-snp02, the first-generation sequencing results of the PCR amplification products of 27 individuals are inconsistent with the expectation, that is, this pair of specific primers cannot achieve accurate origin tracing of Tetrastigma hemsleyanum of the CC lineage.

[0165] II. Specific primers for the EC lineage:

[0166] 2.1), When using the EC lineage specific primer The-ec-snp03, the first-generation sequencing results of the PCR amplification products of 27 individuals are as Figure 16 described in B.

[0167] For individuals with codes 10 - 15, the 97th base in the sequencing result shows "A"; while for individuals with codes 1 - 9 and 16 - 27, it shows "C" at this position;

[0168] As shown in Table 3, the SNP site base corresponding to the primer The-ec-snp03 is A / C, and the sequencing result is consistent with the expectation;

[0169] Meanwhile, as shown in Table 4, the individuals with codes 10 to 15 belong to the EC lineage; while the individuals with codes 1 to 9 and codes 16 to 27 belong to the other three lineages;

[0170] Therefore, it shows that the specific primer The-ec-snp03 can achieve accurate origin tracing of Tetrastigma hemsleyanum in the EC lineage.

[0171] 2.2), When using the EC lineage specific primer The-ec-snp04, the first-generation sequencing results of the PCR amplification products of 27 individuals are as Figure 16 described in C.

[0172] For the individuals with codes 10 to 15, the 104th base in the sequencing result shows "C", while for the individuals with codes 1 to 9 and codes 16 to 27, it shows "T" at this position;

[0173] As shown in Table 3, the SNP site base corresponding to the primer The-ec-snp04 is C / T, and the sequencing result is consistent with the expectation;

[0174] Meanwhile, as shown in Table 4, the individuals with codes 10 to 15 belong to the EC lineage; while the individuals with codes 1 to 9 and codes 16 to 27 belong to the other three lineages;

[0175] Therefore, it shows that the specific primer The-ec-snp04 can achieve accurate origin tracing of Tetrastigma hemsleyanum in the EC lineage.

[0176] 2.3), Since individuals failed to amplify successfully with The-ec-snp01 and The-ec-snp02, sequencing was not performed.

[0177] III. Specific primers for the SC lineage:

[0178] 3.1), When using the SC lineage specific primer The-sc-snp01, the first-generation sequencing results of the PCR amplification products of 27 individuals are as Figure 16 described in D.

[0179] For the individuals with codes 16 to 22, the 83rd base in the sequencing result shows "C", while for the individuals with codes 1 to 15 and codes 23 to 27, it shows "G" at this position;

[0180] As shown in Table 2, the SNP site base corresponding to the primer The-sc-snp01 is C / G, and the sequencing result is consistent with the expectation;

[0181] Meanwhile, as shown in Table 3, individuals with codes 16 to 22 belong to the SC lineage; while individuals with codes 1 to 15 and codes 23 to 27 belong to the other three lineages.

[0182] Therefore, it shows that the specific primer The-sc-snp01 can achieve the accurate origin tracing of Tetrastigma hemsleyanum in the SC lineage.

[0183] 3.2), When using the SC lineage specific primers The-sc-snp02, The-sc-snp03, and The-sc-snp04, the first-generation sequencing results of the PCR amplification products of 27 individuals were inconsistent with the expectations, that is, these three specific primer pairs could not achieve the accurate origin tracing of Tetrastigma hemsleyanum in the SC lineage.

[0184] IV. Specific primers for the SW lineage:

[0185] 4.1), When using the SW lineage specific primer The-sw-snp02, the first-generation sequencing results of the PCR amplification products of 27 individuals were as Figure 16 described in E.

[0186] For individuals with codes 23 to 27, the 131st base in the sequencing results showed "C", while for individuals with codes 1 to 22, it showed "T" at this position;

[0187] As shown in Table 3, the base of the SNP locus corresponding to the primer The-sw-snp02 is C / T, and the sequencing results are consistent with the expectations;

[0188] Meanwhile, as shown in Table 4, individuals with codes 23 to 27 belong to the SW lineage; while individuals with codes 1 to 22 belong to the other three lineages.

[0189] Therefore, it shows that the specific primer The-sw-snp02 can achieve the accurate origin tracing of Tetrastigma hemsleyanum in the SW lineage.

[0190] 4.2), Since there were multiple individuals with unsuccessful amplification for The-sw-snp01, The-sw-snp03, and The-sw-snp04, no sequencing was performed.

[0191] In the present invention, the PCR amplification products were sent to a company for Sanger sequencing. Finally, the sequencing results of 27 individuals were compared in Geneious Prime. After amplification with the corresponding specific primers for the target lineage, the bases at the target SNP loci in the sequencing results were consistent, the remaining individuals were consistent, and were also consistent with the bases shown at the corresponding SNPs loci during primer design. Therefore, it shows that the specific primers for the corresponding lineage can achieve the accurate origin tracing of Tetrastigma hemsleyanum in that lineage.

[0192] In summary, the SNP marker combination of the present invention was used to perform PCR amplification on the leaf DNA of the three-leaf cliff creeper of unknown geographical origin. The SNP marker corresponding to the specific primer The-cc-snp01 is located at the 61665485th base of chromosome 6 of the three-leaf cliff creeper genome. The nucleotide at the SNP site is "G" in the CC lineage and "T" in the other lineages, so the origin of the individual with the base "G" is determined to be central China; the SNP marker corresponding to the specific primer The-ec-snp03 is located at the 62098925th base of chromosome 15 of the three-leaf cliff creeper genome. The nucleotide at the SNP site is "A" in the EC lineage and "C" in the other lineages, so the origin of the individual with the base "A" is determined to be eastern China; the SNP marker corresponding to the specific primer The-ec-snp04 is located at the 62100681st base of chromosome 15 of the three-leaf cliff creeper genome. The-sc-snp01 corresponds to the SNP marker at the 39720990th base on chromosome 2 of the Clerodendrum thunbergii genome, and the nucleotide at the SNP site is "C" in the SC lineage, and "G" in the other lineages, so the origin of the individual with the base "C" is determined to be southern China; the-sw-snp02 corresponds to the SNP marker at the 57724452nd base on chromosome 4 of the Clerodendrum thunbergii genome, and the nucleotide at the SNP site is "C" in the SW lineage, and "T" in the other lineages, so the origin of the individual with the base "G" is determined to be southwestern China.

[0193] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. A SNP marker combination for accurate origin tracing of Thunbergia trifoliata, characterized in that The following primer pairs are included: The-cc-snp01: Forward Primer: ATTTGGGCTTGAAGGTCTAGGC Reverse primer: AGGAACAAGACAACGAAGGTGC; The-ec-snp03: Forward primer: GTCGTACTGGGATCACCCTTCT Reverse primer: TGAACATGACCTTGCTCACTGG The-ec-snp04 Forward primer: CAGTCGGCCCGCAAATGAAAT Reverse primer: CGGTCTGATCCATGTTGAAGCA The-sc-snp01 Forward primer: ATAGCATGGCAGCAAGGCAATC Reverse primer: AGCCGCAGGATAGATTCCAGTC The-sw-snp02 Forward primer: GCCAAGGTAACATCGGTTTGG Reverse primer: TGTCTGTTGGGTTAGGCTCAGT.

2. A method for accurately tracing the origin of Thunbergia trifoliata, characterized in that: Using the SNP marker combination as claimed in claim 1, comprising the following steps: 1) Obtain the DNA of the tested Clerodendrum trifoliatum; 2) Perform PCR amplification; The PCR system is: DNA 50-100ng; Primer F / R 0.5 / 0.5 μL; 2×Rapid Taq Master Mix 10μL; ddH2O To 20μL; The PCR amplification procedure is: 95℃, 6min; 95℃, 15s; 55℃, 15s; 72℃, 7s; 35 cycles; 72℃, 5min; 4℃, maintain; 3), judgment.

3. The method for accurate origin tracing of Tricholoma trifoliata according to claim 2, characterized in that: The determination of step 3) is: The SNP marker corresponding to the specific primer The-cc-snp01 is located at the 61665485th base of chromosome 6 of the genome of Tricholoma truncatum. The nucleotide at the SNP site is "G" in the CC lineage and "T" in the other lineages. Therefore, the origin of the individual with the base "G" is determined to be central China. The SNP marker corresponding to the specific primer The-ec-snp03 is located at the 62098925th base of chromosome 15 of the genome of the cloverleaf vine. The nucleotide at the SNP site is "A" in the EC lineage and "C" in the other lineages. It is determined that the origin of the individual with the base "A" is eastern China. The SNP marker corresponding to the specific primer The-ec-snp04 is located at the 62100681 base of chromosome 15 of the genome of the cloverleaf vine. The nucleotide at the SNP site is "C" in the EC lineage and "T" in the other lineages. Therefore, the origin of the individual with the base "C" is determined to be eastern China. The SNP marker corresponding to the specific primer The-sc-snp01 is located at the 39720990th base of chromosome 2 of the genome of the cloverleaf vine. The nucleotide at the SNP site is "C" in the SC lineage and "G" in the other lineages. It is determined that the origin of the individual with the base "C" is southern China. The SNP marker corresponding to the specific primer The-sw-snp02 is located at the 57724452nd base on chromosome 4 of the genome of the Tricholoma trifoliata. The nucleotide at the SNP site is "C" in the SW lineage and "T" in the other lineages. Therefore, the origin of the individual with the base "G" is determined to be southwestern China.

Images