Probe group for detecting influenza A virus nucleic acid and application
By using the LbuCas13a protein and CRISPR-Cas13a detection method, combined with colloidal carbon immunochromatography test strips and using the line-elimination detection mode, the problem of complex and instrument-dependent problems of existing influenza virus detection methods is solved, and rapid, sensitive and specific detection is achieved, which is of great significance for disease prevention and control.
Patent Information
- Application Number
- CN202510374893.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-27
- Publication Date
- 2025-06-10
AI Technical Summary
Existing influenza virus detection methods such as RT-qPCR have a long detection time, complex operation and rely on instruments and equipment, making it difficult to meet the detection needs of fast, simple and easy operation.
The CRISPR-Cas13a detection method based on LbuCas13a protein was adopted, combined with colloidal carbon immunochromatography test strips, and the detection mode of line elimination method was adopted to achieve rapid, sensitive and specific detection of influenza A virus nucleic acid.
It realizes rapid, sensitive and specific detection of influenza A virus nucleic acid, reduces detection time and operation complexity, and does not require reliance on instruments and equipment, which has important disease prevention and control significance.
Smart Images

Figure CN120119039A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of molecular biology detection, and particularly relates to a probe set for detecting nucleic acid of influenza A virus and its application. Background Art
[0002] Acute respiratory infections are the main cause of the increase in the incidence and mortality of respiratory diseases globally. RNA viruses are the main pathogenic factors causing respiratory infections. Common respiratory RNA viruses include novel coronavirus, influenza virus, respiratory syncytial virus, etc. These viruses are highly transmissible and prone to mutation, seriously threatening the progress and development of human society. Currently, the gold standard for detecting influenza virus is the RT-qPCR method, which has high sensitivity and good accuracy, but the detection time is relatively long, the operation is complex, and it relies on instrument equipment. Therefore, it is of great significance for disease prevention and control to develop a simple, fast, and easy-to-operate detection method.
[0003] In terms of specificity and operability, compared with the traditional PCR method, the technology based on clustered regularly interspaced short palindromic repeats (CRISPR) has been proven to have unique advantages in molecular diagnosis. Due to the high specificity of Cas / guide-RNA in recognizing the target, the CRISPR-based detection method has been used to identify point mutations of SARS-CoV-2 coronavirus. As a key effector factor in the CRISPR system, Cas13a protein has unique ribonuclease activity. Cas13a protein can accurately cleave the target RNA under the guidance of CRISPR RNA (crRNA), and at the same time activate the non-specific cleavage activity of Cas13a protein to cleave the RNA on the surface of Cas13a protein. LbuCas13a protein shows excellent cleavage efficiency among homologous Cas13a proteins. By using LbuCas13a protein, sensitive and specific cleavage of nucleic acid can be achieved, and combined with an immunochromatographic test strip, the conversion and amplification of the cleavage signal can be realized, and the detection result can be presented quickly and visually, showing great potential in the rapid and low-cost detection of SARS-CoV-2 coronavirus.
[0004] Regarding the interpretation method of immunochromatographic test strips for detecting RNA viruses by Cas13a at home and abroad, the main method is the "visible line method", that is, when there is a band on the test line "T" line, the nucleic acid test result is judged as positive. This type of interpretation method is easy to directly read the test result. That is, when the target RNA exists, the Cas13a protein plays a cleavage role. When the probe is not completely cleaved, the intact probe will still be intercepted at the control line "C" line. The cleaved and free probe containing the label will be captured and bound by the specific antibody at the test line, so that bands appear at both the C line and the T line, and the interpretation result is positive. However, when the probe is completely cleaved and broken, there is no colloidal gold enrichment at the control (C) line, and there is only a band at the test (T) line, and there is no band at the control line (C). This method does not meet the rigor of in vitro diagnosis.
[0005] To be more in line with the rigor of in vitro diagnosis, if the "line disappearance method" detection mode is adopted, that is, when there is no band at the test line "T" line, the nucleic acid test result is judged as positive. When laying the specific antibody corresponding to the probe on the test strip, the opposite thinking needs to be adopted. When the target RNA does not exist, Cas13a cannot play a cleavage role, the probe is intact, and it can be captured at the "T line" of the test strip. Excessive antibodies labeled with colloidal carbon are captured at the C (control) line, so that bands appear at both the C line and the T line, and the interpretation result is negative; when the target RNA exists, Cas13a plays a cleavage role, the probe is completely cleaved, and the probe with the labeled end is not captured by the antibody at the "T line" and all free to the C line and is captured by the C antibody, so that there is no band at the T line and there is a band at the C line, and the determination result is positive. Summary of the Invention
[0006] The purpose of the present invention is to provide a probe set for detecting nucleic acid of influenza A virus and its application. Based on the ability of LbuCas13a protein to cleave free RNA and target specific RNA sequences, an immunochromatographic Cas13a nucleic acid detection method is established with a colloidal carbon immunochromatographic test strip as the visualization detection method.
[0007] In order to achieve the above purpose, the technical solution adopted by the present invention is as follows:
[0008] The present invention first provides a probe set for detecting nucleic acid of influenza A virus, which is a crRNA for detecting nucleic acid of influenza A virus, and is M1crRNA or M2crRNA, and the sequences are as follows:
[0009] M1crRNA: 5’-GACCACCCCAAAAATGAAGGGGACTAAAACGCCTCAAGATCTGTGTTTTTCCCAGCA-3’;
[0010] M2crRNA: 5’-GACCACCCCAAAAATGAAGGGGACTAAAACGTGGTTACAGCCCCCATCCTATTGTAT3’。
[0011] The present invention also provides a kit for detecting influenza A virus nucleic acid, which comprises the probe set for detecting influenza A virus nucleic acid described above.
[0012] Furthermore, the kit for detecting influenza A virus nucleic acid comprises a colloidal carbon immune chromatography test strip by the line elimination method and a CRISPR reaction system. The CRISPR reaction system contains the probe set for detecting influenza A virus nucleic acid. The immune chromatography test strip by the line elimination method sequentially comprises a sample pad, a conjugate pad containing colloidal carbon-labeled rabbit anti-biotin antibody, an NC membrane containing a T line and a C line, and a water-absorbing paper in the sample flow direction.
[0013] When the probe is FAB-polyU-11nt, the T line is formed by rabbit anti-6-FAM polyclonal antibody, and the C line is formed by goat anti-rabbit IgG.
[0014] When the probe is DB-polyU-11nt, the T line is formed by Anti-Digoxigenin antibody, and the C line is formed by goat anti-rabbit IgG.
[0015] When the probe is TB-polyU-11nt, the T line is formed by Anti-TAMRA antibody [5G5], and the C line is formed by goat anti-rabbit IgG.
[0016] When the probe is CB-polyU-11nt, the T line is formed by Anti-Cy5 antibody [CY5-15], and the C line is formed by goat anti-rabbit IgG.
[0017] The sequences of each probe are as follows:
[0018]
[0019]
[0020] Furthermore, the CRISPR reaction system is as follows:
[0021] System 1
[0022]
[0023] After the above reaction system is configured, it is added into a clean RNase-Free PCR tube, and then placed in a PCR instrument for reaction at 37°C for 10 min to obtain the step1 system.
[0024] System 2
[0025]
[0026] After the above reaction system is configured, react at 37 °C for 90 min in a PCR instrument, then terminate the reaction at 4 °C for 2 min. Insert the prepared colloidal carbon immunochromatographic test strip and read the test result within 5 - 10 min.
[0027] The present invention also provides the application of the described kit in detecting influenza A virus nucleic acid, and the described application is not for the purpose of diagnosing or treating diseases.
[0028] The present invention adopts the above technical solutions, uses the LbuCas13a protein as a detection effector protein, combines the CRISPR-Cas13a detection with immunochromatographic test strip interpretation, and adopts a "line disappearance method" detection presentation method, that is, no band at the test line "T" of the test strip is interpreted as positive, and an immunochromatographic-LbuCas13a detection method is constructed.
[0029] Advantages of the present invention:
[0030] 1. Successfully constructed a colloidal carbon immunochromatographic test strip, combined with the Cas13a reaction, constructed an immunochromatographic-LbuCas13a detection method, and applied it to the detection of influenza virus, proving that the detection method has high sensitivity and good specificity, and is of great significance for the prevention, control and research of respiratory RNA viruses.
[0031] 2. Through qPCR quantification and digital PCR result analysis, the minimum detection limit of the immunochromatographic LbuCas13a detection method was determined to be 381.75 copies / μL.
[0032] 3. The "line disappearance method" detection mode adopted in the present invention in combination with Cas13a does not require amplification of the target, effectively avoiding aerosol contamination generated during amplification. Description of the Drawings
[0033] Figure 1Electrophoresis diagram of PCR products as the in vitro transcription template for crRNA; A: M: Takara 20bp DNA ladder Marker; Lanes 1-4 represent respectively: in vitro transcription template for LwcrRNA1, in vitro transcription template for LwcrRNA2, in vitro transcription template for LwcrRNA3, in vitro transcription template for LwcrRNA4; B: M: Takara 20bp DNA Marker; Lanes 1-3 represent respectively: in vitro transcription template for LbucrRNA1, in vitro transcription template for LbucrRNA2, in vitro transcription template for LbucrRNA3; Lanes 4 and 5 represent respectively the forward and reverse primer fragments without PCR; Lane 6 represents the mixture of forward and reverse primer fragments without PCR.
[0034] Figure 2 Diagram for detecting the activity of Cas13a protein; A: Detection of the activity of commercial LwacrRNA protein; B: Detection of the activity of LbuCas13a protein of the present invention.
[0035] Figure 3 Detection of the activity of LbuCas13a protein; 1: Negative control group; 2: Experimental group containing target RNA.
[0036] Figure 4 Schematic diagram of the detection principle of the single CRISPR test strip.
[0037] Figure 5 Immunochromatographic detection of Cas13a for influenza samples; 0: Negative control; 1: Influenza positive sample 1; 2: Influenza positive sample 2; 3: Influenza positive sample 3.
[0038] Figure 6 Diagram of the results of the qPCR standard curve; A: qPCR amplification curve; B: qPCR standard curve.
[0039] Figure 7 Diagram of the one-dimensional results of digital PCR.
[0040] Figure 8 Diagram of the detection sensitivity results of immunochromatographic Cas13a; 0: Negative control; Inactivated SARS-CoV-2 coronavirus RNA sample; 1: 6108 copies / μL sample; 2: 3054 copies / μL sample; 3: 1527 copies / μL sample; 4: 763.5 copies / μL sample; 5: 381.75 copies / μL sample; 6: 190 copies / μL sample; 7: 9595 copies / μL sample.
[0041] Figure 9Graph of the test results for inactivated SARS-CoV-2 coronavirus and influenza virus samples; Line T1 corresponds to the probe TARMA detection group (the test sample is the SARS-CoV-2 coronavirus); Line T2 corresponds to the Dig group test line (the test sample is influenza), 0: negative control; 1-8: SARS-CoV-2 coronavirus and influenza virus samples. Detailed implementation mode
[0042] The present invention will be further described below in conjunction with the drawings and embodiments. The experimental methods without specific conditions noted below are in accordance with the conventional experimental conditions in the art or the conditions recommended by the manufacturer.
[0043] Goat anti-rabbit IgG and rabbit anti-6-FAM polyclonal antibody were both purchased from Sangon Biotech Co., Ltd. Anti-Digoxigenin antibody, Anti-TAMRA antibody [5G5], and Anti-Cy5 antibody [CY5-15] were all purchased from the manufacturer abcam.
[0044] The LwaCas13a protein is a commercially purchased protein, and the LbuCas13a protein was self-expressed and purified through an Escherichia coli cloning and expression system with reference to the following literature.
[0045] [1] Liu L, Li X, Ma J, et al. The Molecular Architecture for RNA-Guided RNACleavage by Cas13a. [J]. Cell, 2017: 714. DOI: 10.1016 / j.cell.2017.06.050.
[0046] [2] Adler BA, Hessler T, Cress BF, Lahiri A, Mutalik VK, Barrangou R, Banfield J, Doudna JA. Broad-spectrum CRISPR-Cas13a enables efficient phage genome editing. Nat Microbiol. 2022: 7(12): 1967-1979. doi: 10.1038 / s41564-022-01258-x. Example 1 Detection of LbuCas13a protein activity
[0047] 1.1 Preparation of crRNA and extraction of target RNA
[0048] (1) To verify the activity of the LbuCas13a protein, corresponding crRNAs were designed based on the SARS-CoV-2 coronavirus (S gene) pseudovirus provided by our research group (the pseudovirus was obtained by inserting a partial phage genome and the SARS-CoV-2 coronavirus (S gene) into the pSE380 plasmid and expressing it through Escherichia coli Er2566). The preparation method of crRNA was as follows: First, DNA oligos corresponding to the RNA were synthesized, and double-stranded DNA was formed by PCR. Then, crRNA was prepared by in vitro transcription. The DNA template fragment corresponding to the RNA was synthesized by Anhui General Biology Co., Ltd. The DNA template sequence is shown in Table 1.
[0049] Table 1 Synthetic DNA template sequence
[0050]
[0051] Using the synthesized DNA fragment as a template, PCR amplification was performed on the synthesized DNA fragment (the 5' end of the upstream primer carried a T3 promoter sequence) to obtain a DNA fragment with a T3 promoter sequence. The primers used for amplification were synthesized by Anhui General Biology Co., Ltd., and the primer sequences are shown in Table 2.
[0052] Table 2 Primers for amplifying the synthetic DNA fragment
[0053]
[0054]
[0055] Refer to Tables 3 and 4 to configure the PCR amplification system and perform PCR amplification. The amplification products were detected by agarose gel electrophoresis.
[0056] Table 3 In vitro transcription template crRNA double-stranded amplification system
[0057]
[0058] Table 4 In vitro transcription template crRNA double-stranded amplification program
[0059]
[0060] (2) The RNA of the SARS-CoV-2 coronavirus (S gene) pseudovirus was extracted using the Beyotime RNAeasy TM Viral RNA Extraction Kit, and the concentration was measured by Nanodrop 2000 and stored at -80°C.
[0061] (3) Purification of the in vitro transcription template DNA double-stranded product
[0062] ① Mix 150 μL of 1×TE (pH 8.0) with the above double-stranded PCR amplification product.
[0063] ② Add 5 μL of nucleic acid co-precipitant to the 195 μL system and mix well by pipetting.
[0064] ③ Add 20 μL of 5 M sodium chloride to the mixed system and mix well by pipetting.
[0065] ④ Add 2 volumes of absolute ethanol to the above mixed system, mix well by pipetting, and place in a -80 °C refrigerator for 40 min.
[0066] ⑤ Take out from the -80 °C refrigerator, centrifuge at 12,000×g for 10 min to collect nucleic acid, and aspirate the supernatant with a pipette tip in a laminar flow hood.
[0067] ⑥ Add 1 mL of 70% ethanol to the precipitate, gently invert, and then centrifuge at 12,000×g for 1 min. Carefully discard the supernatant and open the lid to air dry for 5 min to remove residual alcohol.
[0068] ⑦ Dissolve the nucleic acid precipitate with 10 μL of DEPC Treated Water solvent, let stand for 5 min, and the purified in vitro transcription template can be obtained. Measure the concentration using Nanodrop 2000.
[0069] 1.2 In vitro transcription of crRNA
[0070] (1) Take the purified in vitro transcription template crRNA double strand and configure the RNA transcription reaction system. The transcription reaction system is shown in Table 5.
[0071] Table 5 RNA transcription reaction system
[0072]
[0073] Place the prepared mixture in a 37 °C incubator and react for 16 h.
[0074] (2) Purification of in vitro transcription products
[0075] ① Add 4 μL of DNase I (100 mg / mL) to the in vitro transcription system, place at 37 °C and react for 15 min to remove template DNA.
[0076] ② Then add 135 μL of DEPC Treated Water and 15 μL of 3 M sodium acetate solution (pH 5.2) to the reaction system and mix well by pipetting.
[0077] ③ Then add 200 μL of phenol-chloroform (25:24:1 = phenol:chloroform:isoamyl alcohol) to the reaction system and mix well.
[0078] ④ Centrifuge the reaction mixture at 12,000×g for 10 min to obtain upper and lower layers. Take the upper aqueous phase and transfer it to another clean 1.5 mL centrifuge tube.
[0079] ⑤ Add 2 volumes of absolute ethanol to the supernatant, place it in a -80 °C refrigerator for 40 min, centrifuge at 12,000×g for 20 min, discard the supernatant, and collect the nucleic acid precipitate.
[0080] ⑥ Wash the nucleic acid precipitate with 1 mL of pre-cooled 70% ethanol, centrifuge at 12,000×g for 1 min, and discard the supernatant.
[0081] ⑦ Resuspend the RNA precipitate in 20 μL of DEPC Treated Water, measure the concentration with Nanodrop 2000, and store it at -80 °C.
[0082] (3) Results: Synthesize crRNA by in vitro transcription. First, perform PCR amplification on the DNA sequence corresponding to crRNA to obtain a double-stranded template product containing the T3 promoter, as shown in Figure 1 shown. The theoretical value of the target product fragment is 78 bp. The results show that compared with the fragment without PCR, with the 20 bp DNA ladder marker as a reference, the size of the target fragment product conforms to the theoretical value and can be used for subsequent in vitro transcription. The in vitro transcribed crRNA was purified by phenol-chloroform extraction, with a concentration of approximately 500 ng / μL, and stored at -80 °C for subsequent protein activity verification experiments.
[0083] 1.3 Detection of LbuCas13a protein activity
[0084] (1) To verify the accuracy of crRNA preparation and the reaction system, take commercial LwaCas13a protein, S gene RNA, and LwcrRNA, and configure the Cas13a protein reaction system together with the fluorescent reporter molecule. The sequence of the fluorescent reporter molecule is shown in Table 6, and the reaction systems are shown in Tables 7 and 8.
[0085] Table 6 Sequence of fluorescent reporter molecule
[0086]
[0087] Table 7 LwaCas13a protein reaction system I
[0088]
[0089] Place the above reaction system in a PCR instrument and set the reaction program: 37 °C, 10 min. As the step1 system. After the reaction, add the reaction system according to the following table for step2.
[0090] Table 8 LwaCas13a Protein Reaction System II
[0091]
[0092] The blank control group used an equal amount of RNase-Free H 2 O to replace LwcrRNA, and ssRNA and LwaCas13a protein were added to the reaction system. The probe used in the system was FQ-polyU-11nt. After all reaction systems were prepared, they were added to a clean black microplate. The pipette was used to blow and mix well, and then centrifuged briefly to remove air bubbles. A fluorescence microplate reader was used, with the excitation wavelength set at 492 nm and the emission wavelength at 518 nm. The reaction program was: 37 °C for 2 h, and the fluorescence was detected every 5 min.
[0093] The results of fluorescence changes are shown in Figure 2 Figure A. It can be seen that when the target RNA is present, compared with the blank control group, the commercial LwaCas13a protein can achieve normal probe cleavage, and the fluorescence signal is significantly enhanced. The above results prove that the crRNA preparation and detection system is correct and can complete the detection of Cas13a protein and signal capture.
[0094] (2) Verify the activity of LbuCas13a protein.
[0095] ① Take the purified LbuCas13a protein, S gene RNA, and LbucrRNA, and configure the Cas13a protein reaction system (detected by a microplate reader) together with the fluorescence reporter molecule. The reaction system is the same as in Tables 7 and 8.
[0096] ② Take the purified LbuCas13a protein, S gene RNA, and LbucrRNA, and configure the Cas13a protein reaction system (detected by a test strip) together with the fluorescence reporter molecule. The reaction system is shown in Tables 9 and 10.
[0097] Table 9 LbuCas13a Protein Reaction System I
[0098]
[0099] The above reaction system was placed in a PCR instrument, and the reaction program was set: 37 °C for 10 min. This was the step1 system. After the reaction was completed, the reaction system was added according to the following table for step2.
[0100] Table 10 LbuCas13a Protein Reaction System II
[0101]
[0102] The blank control group used an equal amount of RNase-Free H 2Instead of LbucrRNA, ssRNA and LbuCas13a protein were added to the reaction system. The probe used in the system was FB-polyU-11nt. After all the reaction systems were prepared, they were added to clean PCR tubes. The above reaction systems were placed in a constant temperature incubator and reacted at 37 °C for 2 h. After the reaction was completed, the Cas12 / Cas13 special nucleic acid detection test strip was inserted into the PCR tube containing the reaction solution for detection, and the detection result was read within 5 - 10 min.
[0103] The results are shown in Figure 2 Figure B. The enzyme-linked immunosorbent assay showed that: compared with the blank control group, with the extension of the detection time, the fluorescence intensity of the experimental group gradually increased, proving that the purified LbuCas13a protein had the expected protein activity.
[0104] In addition, the Cas12 / 13 nucleic acid detection test strip of Tiosbio was used for detection. The interpretation method: positive means that both the quality control line (C line) and the test line (T line) showed red bands, or the quality control line (C line) of the test strip did not show color and the test line (T line) showed color; negative means that the quality control line (C line) showed a red band and the test line (T line) did not show color; invalid means that neither the quality control line (C line) nor the test line (T line) showed a band. See Figure 3 Figure. Compared with the negative control group, the experimental group containing the target RNA showed that the T line was colored and the C line was colored. According to the determination method of the test strip, it was positive, proving the expected activity of the LbuCas13a protein.
[0105] Example 2 Preparation and Assembly of Immunochromatographic Test Strip
[0106] 1. Colloidal carbon-labeled antibody
[0107] Rabbit anti-biotin antibody was selected as the antibody to be labeled, and the antibody was conjugated and labeled with colloidal carbon. The colloidal carbon-labeled antibody kit of Beijing Nano-Gold Biotechnology Co., Ltd. was used in this experiment. For the detailed operation steps, please refer to the instruction manual of the kit).
[0108] 2. Preparation of immunochromatographic test strip
[0109] The immunochromatographic test strip sequentially included a sample pad, a conjugate pad containing colloidal carbon-labeled rabbit anti-biotin antibody, an NC membrane containing the T line and the C line, and a blotting paper in the sample flow direction;
[0110] When the probe was FAB-polyU-11nt, the T line was formed by rabbit anti-6-FAM polyclonal antibody, and the C line was formed by goat anti-rabbit IgG;
[0111] When the probe is DB-polyU-11nt, the T line is formed by Anti-Digoxigenin antibody and the C line is formed by goat anti-rabbit IgG;
[0112] When the probe is TB-polyU-11nt, the T line is formed by Anti-TAMRA antibody [5G5] and the C line is formed by goat anti-rabbit IgG;
[0113] When the probe is CB-polyU-11nt, the T line is formed by Anti-Cy5 antibody [CY5-15] and the C line is formed by goat anti-rabbit IgG;
[0114] The preparation method of the immunochromatographic test strip refers to the colloidal carbon immunochromatographic experimental method of Kang Jingru and is slightly modified as follows:
[0115] (1) Sample pad treatment
[0116] Select the sample pad material, cut the sample pad material to a size of 16 mm × 10 cm, place the sample pad in a clean trough, evenly add about 20 mL of the pre-prepared sample pad treatment solution to the sample pad, ensure that the sample pad is fully wetted, soak for about 10 min, and turn it over once in the middle. Then put the sample pad into the oven to dry, set the temperature to 37 °C, dry for 3 h, and temporarily store it in the drying oven for subsequent use in test strip assembly.
[0117] (2) Test strip scribing
[0118] Cut the bottom plate and NC membrane to a length of 10 cm, cut the absorbent paper to 2.2 cm × 10 cm, tear off the protective glue on the bottom plate, stick on the NC membrane and absorbent paper, place it on the slicer, and use the coating buffer (weigh 0.032 g of Na 2 CO 3 , 0.059 g of NaHCO 3 , 0.878 g of NaCl, 5 g of trehalose, 0.05 g of NaN 3 , add 80 mL of ddH 2 O to dissolve, make up the volume to 100 mL, and then add 10 mL of methanol) to dilute the corresponding antibody or secondary antibody to an appropriate concentration, scribe on the NC membrane, and dry the scribed test strip at 37 °C for 3 h, and temporarily store it in the drying oven for subsequent use in test strip assembly.
[0119] (3) Carbon spraying on the conjugate pad
[0120] Select the conjugate pad material, cut the conjugate pad material to a size of 8 mm × 10 cm, and evenly spray the prepared antibody coated with colloidal carbon on the conjugate pad with a pipette tip. Then dry the conjugate pad at 37 °C for 3 h. Store it in a constant temperature drying oven.
[0121] (4) Assembly and Chromatography of Test Strips
[0122] After the test strip with the T line and C line drawn is dried, it is then assembled with the conjugate pad (8 mm × 10 cm) sprayed with colloidal carbon-labeled antibody and the treated sample pad (16 mm × 10 cm). The assembled test strip is then cut into 3.4 mm × 6 cm with a slicer. Then it is put into an aluminum foil bag containing desiccant and sealed for storage.
[0123] 3. Principle of the Present Invention
[0124] The present invention adopts a detection mode of the line disappearance method, that is, no band detected is a positive result. The principle of nucleic acid detection in the present invention is based on the cleavage ability of Cas13a protein, and the cleavage of Cas13a can be characterized by free RNA. Therefore, a suitable probe can be used as the main analyte for test strip detection. When the detection target does not exist, that is, the probe is not cleaved, the probe is intact and can be captured at the T (test) line, thus causing the enrichment of colloidal carbon here, and thus showing a band, which proves that the target is not detected, and the result of the detection target is determined to be negative. When the detection target exists, the probe is cleaved, and the end with colloidal carbon label dissociates to the C (quality control) line, and there is no enrichment of colloidal carbon at the T (test) line, and the determination result is positive.
[0125] Taking this embodiment and Figure 4 as an example, the two ends of the probe label are labeled with FAM and Biotin respectively, and the liquid sample to be tested is the mobile phase and chromatographs starting from the sample pad.
[0126] At the conjugate pad, one end of the probe, Biotin, will bind to the colloidal carbon-labeled rabbit anti-biotin antibody; when the detection target exists, based on the detection principle of Cas13a, the probe will be cleaved, and the colloidal carbon-labeled rabbit anti-biotin antibody will dissociate to the C (quality control) line and be captured by the goat anti-rabbit secondary antibody, forming a visible black color. The Anti-FAM antibody at the T (test) line captures the other end of the cleaved FAM-labeled probe, but there is no colloidal carbon label, so there is no band.
[0127] When the detection target does not exist, the intact probe (one end contains FAM label) with colloidal carbon label will be captured by the Anti-FAM antibody at the T line, thus forming a visible black color at the T (test) line.
[0128] Regardless of whether the probe in the sample is cleaved, the excessive colloidal carbon-labeled rabbit anti-biotin antibody will continue to chromatograph with the sample, and the goat anti-rabbit secondary antibody on the C (quality control) line will unconditionally bind to the colloidal carbon-labeled rabbit anti-biotin antibody to form a visible black line.
[0129] Example 3 Verification of the Detection Accuracy of LbuCas13a
[0130] (1) First, based on the Cas13a detection system in 1.3 of Example 1, the concentrations of RNase Inhibitor and RNA fluorescence reporter analysis in the system were optimized respectively. At the same time, the detection reaction time was optimized. In the optimized reaction system, the final concentration of RNase Inhibitor was 1 U / μL, the final concentration of RNA fluorescence reporter molecule was 4 nM, and the reaction time ≥ 45 min. The optimized LbuCas13a detection system is shown in Table 12 and Table 13.
[0131] (2) Detection of inactivated influenza virus samples
[0132] Design crRNA for the inactivated influenza A H3N2 RNA sample, and prepare it by referring to the in vitro transcription method of Example 1. The primer sequences are shown in Table 11. It was synthesized by Anhui General Biology Co., Ltd. The detailed steps for the preparation of double-stranded products and in vitro transcription are the same as those in Example 1.
[0133] Table 11 Influenza sample crRNA
[0134]
[0135] Take the prepared influenza crRNA and LbuCas13a protein and configure the reaction system with reference to Table 12 and Table 13.
[0136] Table 12 Immunochromatographic Cas13a influenza detection system I
[0137]
[0138] After the above reaction system is configured, add it to a clean RNase-Free PCR tube, and then place it in a PCR instrument for reaction at 37 °C for 10 min to obtain the step1 system.
[0139] Table 13 Immunochromatographic Cas13a influenza detection system II
[0140]
[0141] The probe used in the system is TB-polyU-11nt (see Table 6). After the reaction system is configured, react it in a PCR instrument at 37 °C for 90 min, and then terminate the reaction at 4 °C for 2 min. Insert the prepared colloidal carbon immunochromatographic test strip and read the detection result within 5 - 10 min.
[0142] Result: The detection result is shown in Figure 5 As shown, the results show that for 3 inactivated influenza A H3N2 positive samples, the immunochromatographic Cas13a detection method can successfully detect the sample positive, further verifying the specificity and accuracy of the immunochromatographic Cas13a detection method.
[0143] Example 4: Determination of the detection sensitivity of immunochromatographic LbuCas13a
[0144] (1) qPCR quantitative experiment
[0145] Using in vitro transcribed RNA as the qPCR standard and the RNA of a SARS-CoV-2 coronavirus positive sample as the detection object, a qPCR quantitative experiment was carried out. The detection results are as Figure 6 shown. The standard curve was successfully obtained. The test samples were within the range of the standard curve, and the correlation coefficient of the established standard curve was 0.99869, proving a high reliability. The average Ct value of the RNA of the SARS-CoV-2 coronavirus positive sample was 21.32.
[0146] (2) Digital PCR droplet result analysis
[0147] To determine the copy number of the qPCR standard, a digital PCR experiment was carried out. The one-dimensional detection result of the ROX channel is as Figure 7 shown. The middle line is the threshold line. Above the threshold line is the distribution of positive droplets, and below the threshold line is the distribution of negative droplets. The vertical coordinate represents the fluorescence intensity, and the horizontal coordinate represents the sample well number. The analysis of the detection results shows that the target sequence exists, the distribution of positive droplets is relatively uniform, the peak value is relatively high, and the results of four repetitions are consistent with small errors. And according to the number of positive samples, through software analysis and calculation, the determined copy number of the qPCR standard is 1.219×10 8 copies / μL.
[0148] (3) Detection sensitivity of immunochromatographic Cas13a
[0149] Based on the copy number of the qPCR standard sample determined above, through conversion using the Ct value of the qPCR standard curve, the copy number of the test sample can be deduced to be 6108 copies / μL. This sample was serially diluted, and the immunochromatographic Cas13a detection method was used to detect and determine the sensitivity. The detection results are shown in Figure 8 shown.
[0150] The result analysis shows that when the copy number of the sample concentration is reduced to 190 copies / μL, there is colloidal carbon enrichment at the detection line of immunochromatographic Cas13a, and the determination result is negative. Therefore, it is speculated that the lowest detection limit of the immunochromatographic Cas13a detection method is 381.75 copies / μL.
[0151] Example 5: Detection of inactivated influenza virus samples
[0152] The detection of the inactivated influenza group samples was carried out in the same manner as (3) in Example 3.
[0153] After the sample detection reaction is completed, take 50 μL of the reaction system each, insert the prepared dual-target immunochromatographic test strip, and read the test result within 5 - 10 minutes.
[0154] Perform dual-target test strip immunochromatographic Cas13a detection on 8 inactivated SARS-CoV-2 coronavirus positive RNA samples and 8 inactivated influenza A H3N2 positive RNA samples. The test results are as Figure 9 shown (for the construction of the immunochromatographic test strip with multiple targets, the corresponding capture antibody can be selected for laying according to the probes in the detection system. One probe can correspond to one detection target. Multiple detection T lines can be laid on the prepared colloidal carbon test strip to construct an immunochromatographic test strip for multi-target detection; one probe corresponds to one detection target, and different probes are captured by different antibodies respectively. Then, in the experiment, multiple detection systems are configured, the samples are added separately for reaction, and after the reaction is completed, the mixtures of each system are taken and detected on the same test strip to present the test results, so as to achieve multi-target detection).
[0155] The results show that no positive detection of influenza samples was found in test strip 1, and no positive detection of SARS-CoV-2 coronavirus was found in test strip 7. It is speculated that the sample concentration may be too low. The positive samples with other numbers were all successfully detected. The specificity and feasibility of the multi-target immunochromatographic Cas13a detection were verified.
Claims
1. A probe set for detecting influenza A virus nucleic acid, characterized in that: The crRNA for detecting influenza A virus nucleic acid is M1crRNA or M2crRNA, and the sequence is as follows: M1crRNA:5'-GACCACCCCAAAAATGAAGGGGACTAAAACGCCTCAAG ATCTGTGTTTTTCCCAGCA-3'; M2crRNA:5'-GACCACCCCAAAAATGAAGGGGACTAAAACGTGGTTAC AGCCCCCATCCTATTGTAT3'.
2. A kit for detecting influenza A virus nucleic acid, characterized in that: It comprises the probe set for detecting influenza A virus nucleic acid as claimed in claim 1.
3. A kit for detecting influenza A virus nucleic acid, characterized in that: The invention comprises a colloidal carbon immunochromatographic test strip of line elimination method and a CRISPR reaction system, wherein the CRISPR reaction system comprises the probe group for detecting influenza A virus nucleic acid as claimed in claim 1; the immunochromatographic test strip of line elimination method comprises, in order of sample flow direction, a sample pad, a binding pad containing colloidal carbon-labeled rabbit anti-biotin antibody, an NC membrane containing T lines and C lines, and absorbent paper.
4. A kit for detecting influenza A virus nucleic acid according to claim 3, characterized in that: When the probe is FAB-polyU-11nt, the T line is formed by rabbit anti-6-FAM polyclonal antibody, and the C line is formed by goat anti-rabbit IgG; When the probe is DB-polyU-11nt, the T line is formed by Anti-Digoxigenin antibody, and the C line is formed by goat anti-rabbit IgG; When the probe is TB-polyU-11nt, the T line is formed by Anti-TAMRA antibody [5G5], and the C line is formed by goat anti-rabbit IgG; When the probe is CB-polyU-11nt, the T line is formed by Anti-Cy5 antibody [CY5-15], and the C line is formed by goat anti-rabbit IgG; The sequences of each probe are as follows:
5. A kit for detecting influenza A virus nucleic acid according to claim 3, characterized in that: The CRISPR reaction system is as follows: System One After the above reaction system is prepared, add it to a clean RNase-Free PCR tube, and then place it in a PCR instrument at 37°C for 10 minutes as step 1 system; System 2 After the above reaction system is configured, react at 37°C in a PCR instrument for 90 minutes, then terminate the reaction at 4°C for 2 minutes, insert the prepared colloidal carbon immunochromatography test strip, and read the test result within 5 to 10 minutes.
6. Use of the kit according to any one of claims 2 to 5 in detecting influenza A virus nucleic acid, wherein the purpose of the use is not to diagnose or treat a disease.
Citation Information
Patent Citations
Application of Cas13a in antagonistic virus
CN110548134A
Molecular lateral chromatography detection method based on CRISPR system and detection test strip
CN113687066A
Optimized SHERLOCK nucleic acid detection technology and application of optimized SHERLOCK nucleic acid detection technology in influenza A H1N1 virus detection
CN116004908A
Method for visually detecting influenza virus H1N1 by combining CRISPR / Cas13a with hybridization chain reaction
CN116042911A
CRISPR (clustered regularly interspaced short palindromic repeats) system-based ssDNA detection method and application
CN116590387A