Method for preparing disease animal model and application thereof

Abstract

The invention provides a method for preparing a disease animal model and application thereof, and relates to the technical field of gene engineering. According to the method, the accurate adenine base editor ABE-ABE10 capable of specifically editing YA (Y = T or C) is applied to manufacturing of the mouse disease animal model for the first time, and compared with ABE8e, the ABE10 has good efficiency and accuracy in generation of the disease model. According to the novel method for manufacturing the animal model by using the ABE10, the application of the ABE is further promoted so as to be matched with a wider clinical scene, and the production process of different animal models is greatly promoted.

Description

Technical Field

[0001] This application relates to the field of genetic engineering technology, and particularly relates to a method for preparing a disease animal model and its application. Background Art

[0002] Current research has shown that approximately 60% of genetic diseases are caused by single-base mutations, and treating these genetic diseases requires safe and effective genome editing tools. The efficiency of using CRISPR / Cas9-mediated homologous recombination to repair such pathogenic point mutations is very low. In 2017, the adenine base editor (ABE) was reported. It is formed by fusing adenine deaminase with CRISPR / Cas9, achieving efficient A-to-G base editing on the genome, and can be used to treat 48% of diseases caused by point mutations. It is an important gene editing tool for the treatment of genetic diseases. ABE has been reported to be used for efficient gene editing of the genome, production of disease animal models, gene therapy, etc.

[0003] However, when ABE performs base editing, there is an editing window of approximately 5 bases, and adjacent bases will also be edited while editing the target base. When using ABE to produce a disease animal model, it will also induce adjacent base editing while inducing the target base conversion in mouse embryos, which may interfere with the relationship between the disease phenotype of the mouse and the base mutation, and may also bring unpredictable safety risks. Summary of the Invention

[0004] To attempt to solve the above problems, the present invention uses the high-precision ABE - ABE10 with sequence preference (YA, Y = T or C) developed in the early stage to produce an animal disease model and attempts to break its limitations in the production of disease animals. Taking the production of hypocholesterolemia and short-tail or tail-deleted mouse models as an example, using the sequence-preferred and highly precise adenine base editing tool ABE10, by targeting the bases with YA sequences of the PCSK9 and TBXT genes, precise and efficient base editing is achieved, and finally a mouse model with hypocholesterolemia and short-tail or tail-deleted phenotypes is produced.

[0005] On the one hand, this application provides the use of the fusion protein ABE10 in the preparation of a disease animal model.

[0006] The fusion protein ABE10 has been disclosed in the Chinese patent with the application number 202311786372.7.

[0007] The amino acid sequence of the fusion protein ABE10 is shown in SEQ ID No.1.

[0008] The ABE10 can accurately target the A base in the YA (Y = T or C) sequence (in embryos), causing the site to mutate from A to G, generating a disease animal model, and can be particularly used to prepare a hypocholesterolemia mouse model and / or a short-tailed or tailless mouse model.

[0009] Furthermore, the animal can be selected from one or more of mice, rats, hamsters, guinea pigs, monkeys, rabbits, pigs, zebrafish, Xenopus laevis, Drosophila; preferably, mice; preferably, the disease animal model includes a hypocholesterolemia animal model and / or a short-tailed or tailless animal model.

[0010] Preferably, the disease animal model includes a hypocholesterolemia mouse model and / or a tailless mouse model.

[0011] Furthermore, the construction of the hypocholesterolemia animal model is achieved by silencing and / or weakening the expression of PCSK9; more preferably, the method for silencing and / or weakening the expression of PCSK9 includes mutating the A in the CA of the splice donor of exon 1 of the PCSK9 gene to G.

[0012] Mutate the A in the reverse strand "CA" of the splice donor "GT" of exon 1 of the PCSK9 gene to G.

[0013] Preferably, the reverse strand of the splice donor of exon 1 of the PCSK9 gene includes CCCATACCTTGGAGCAACGGCGG, where the A at the 6th base in the 3' to 5' direction is mutated to G.

[0014] In a preferred embodiment, the genebank number of PCSK9 is AL954352.10.

[0015] Specifically, in the present invention, by utilizing the property that ABE10 can accurately target the A base in the YA (Y = T or C) sequence (in embryos), an sgRNA targeting the A 6 site in the reverse strand of the splice donor of exon 1 of the PCSK9 gene is designed, and ABE10 is used to edit the A 6 (mutated from A to G) at this target site to cause PCSK9 to skip exon 1 during expression, thereby generating a mouse model with a hypocholesterolemia phenotype, and the principle is as Figure 2 shown.

[0016] Furthermore, the construction of the tailless animal model is achieved by silencing and / or weakening the expression of TBXT; preferably, the method for silencing and / or weakening the expression of TBXT includes mutating the A in the CA of the splice acceptor of exon 6 of the TBXT gene to G.

[0017] Mutate the A to G in the "CA" of the reverse strand of the exon 6 splice acceptor "GT" of the TBXT gene.

[0018] Preferably, the reverse strand of the exon 6 splice acceptor of the TBXT gene includes ACCTACTTGGAGAGCTGTTCCGA, where the A at the 5th base from the 3' to 5' end is mutated to G.

[0019] In a preferred embodiment, the genebank number of TBXT is AC154579.3.

[0020] Specifically, in the present invention, taking advantage of the property of ABE10 to precisely target the A base in the YA (Y = T or C) sequence (in embryos), a sgRNA targeting the A site of the reverse strand of the GT splicing site of exon 6 of the TBXT gene is designed, and ABE10 is used to edit the A 5 site at this target point (mutating A to G). Its disruption can lead to the skipping of exon 6, thereby inducing a mouse model with a missing tail. The principle is as 5 (mutating A to G) shown. Figure 6 as

[0021] Moreover, the TBXT gene has the property of homozygous lethality. Editing with ABE8e results in the complete skipping of exon 6, making the TBXT gene homozygous mutant. Homozygous TBXT - jumping - deletion mice will die during embryogenesis. Therefore, a mouse model with a short tail or missing tail phenotype cannot be obtained by editing with ABE8e. However, by using the method of this application, heterozygous or chimeric mice with silenced and / or weakened TBXT expression can be obtained, and then a mouse model with a short tail or missing tail phenotype can be obtained, solving the problem of its homozygous lethality.

[0022] Those skilled in the art can understand that the disease animal model can be prepared by conventional methods.

[0023] On the other hand, this application also provides a method for preparing a disease animal model. The method includes: using a single - base gene editing system to edit an animal gene, and the single - base gene editing system includes the fusion protein ABE10.

[0024] Furthermore, the single - base gene editing system further includes sgRNA, and the sgRNA guides the fusion protein ABE10 to perform single - base gene editing on the target gene in the target cell.

[0025] Preferably, the animal can be selected from one or more of mice, rats, hamsters, guinea pigs, monkeys, rabbits, pigs, zebrafish, Xenopus laevis, Drosophila; more preferably, mice.

[0026] In a preferred embodiment, the mouse is a C57 / BL6 mouse.

[0027] In a preferred embodiment, the cell is an animal embryo cell.

[0028] In a preferred embodiment, the method for preparing a disease animal model includes: mixing sgRNA and mRNA of the fusion protein ABE10 at a ratio of 200 ng / μL: 100 - 200 ng / μL and injecting the mixture into embryo cells. The sgRNA guides the fusion protein ABE10 to perform single-base gene editing on the target gene in the target cells. The embryo cells develop until parturition to obtain the disease animal model.

[0029] Furthermore, the method further includes the step of introducing a promoter into the single-base gene editing system, and the promoter is the T7 promoter.

[0030] Those skilled in the art can also select other promoters for experiments according to the actual situation as long as they can complete the function of in vitro transcribing mRNA.

[0031] Furthermore, the disease animal model includes a hypocholesterolemia animal model and / or a tail-deleted animal model; preferably, the disease animal model is a disease animal model with a homozygous lethal gene;

[0032] Preferably, the construction of the hypocholesterolemia animal model is achieved by silencing and / or weakening the expression of PCSK9, so that the levels of PCSK9 and LDL-C are reduced; more preferably, the method for silencing and / or weakening the expression of PCSK9 includes mutating the A in the reverse strand CA of the splice donor of exon 1 of the PCSK9 gene to G; preferably, the sequence of the sgRNA includes SEQ ID No.2;

[0033] Preferably, the construction of the tail-deleted animal model is achieved by silencing and / or weakening the expression of TBXT; preferably, the method for silencing and / or weakening the expression of TBXT includes mutating the A in the reverse strand CA of the splice acceptor of exon 6 of the TBXT gene to G; preferably, the sequence of the sgRNA includes SEQ ID No.3.

[0034] In a preferred embodiment, the sequence of the sgRNA contains 2'-O-methyl 3”-thiolphosphate (MS) modification.

[0035] SEQ ID No.2 includes the sequence: C*C*C*AUACCUUGGAGCAACGGGUUUUAGAGCUAGAA AUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGCU*U*U*U. Wherein, * represents the modification of 2'-O-methyl 3”-thiolphosphate (MS) modification.

[0036] SEQ ID No. 3 includes the sequence: A*C*C*UACUUGGAGAGCUGUUCGUUUUAGAGCUAGAA AUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGCU*U*U*U. Among them, * represents the modification of 2'-O-methyl 3”-thiol phosphate (MS).

[0037] Among them, the modification of 2'-O-methyl 3”-thiol phosphate (MS) can improve the stability of sgRNA in vivo.

[0038] PCSK9, namely proprotein convertase subtilisin / kexin type 9, is a serine protease encoded by the PCSK9 gene. It is mainly produced by the liver and is also expressed in other organs such as the intestine, heart, and pancreas. PCSK9 is not only associated with autosomal dominant hypercholesterolemia, but also can effectively regulate the lipid metabolism level in the body and affect the occurrence and development of coronary heart disease. PCSK9 regulates lipid metabolism mainly by specifically binding to the low-density lipoprotein receptor (LDLR) on the cell surface to form a complex and being transported to the lysosome, resulting in the accelerated degradation of LDLR, thereby increasing the plasma low-density lipoprotein cholesterol (LDL-C) level.

[0039] TBXT is a gene that affects mouse tail evolution. When its exon 6 skips, the resulting incomplete transcript affects mouse tail evolution.

[0040] On the other hand, the present application also provides the application of the described method in improving the efficiency and / or accuracy of preparing a disease animal model.

[0041] Preferably, the construction and editing efficiency of the hypocholesterolemia mouse model is greater than or equal to 90%; more preferably, greater than or equal to 94%.

[0042] Preferably, the editing does not produce off-target editing.

[0043] The present invention has the following beneficial effects:

[0044] In the present invention, the precise adenine base editor ABE10 that can specifically edit YA (Y = T or C) is first applied to the production of a mouse disease animal model. Compared with ABE8e, ABE10 has good efficiency and accuracy in the generation of disease models.

[0045] ABE10 can effectively and precisely induce base editing. Among them, the base editing efficiency of PCSK9 can reach 94.44%. Moreover, compared with ABE8e, only ABE10 precisely induces the A-to-G conversion on the opposite DNA strand of the GT splicing site and hardly produces bystander editing. Similarly, the base editing efficiency of TBXT can reach 100%. And no mice were born in the ABE8e treatment group, indicating that homozygous editing of ABE8e leads to complete skipping of exon 6, while homozygous TBXT jumping deletion mice will die during embryogenesis, but ABE10 can overcome this problem.

[0046] In summary, the present invention provides a novel platform for efficiently and accurately preparing disease animal models, which will greatly promote the production process of different animal models. This new method of using ABE10 to make animal models will also further promote the application of ABE to match a wider range of clinical scenarios and will greatly promote the production process of different animal models. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] The drawings described herein are used to provide a further understanding of the present application and constitute a part of the present application. The illustrative embodiments of the present application and their descriptions are used to explain the present application and do not constitute an improper limitation of the present application. In the drawings:

[0048] Figure 1 It is a schematic structural diagram of the fusion protein ABE10;

[0049] Figure 2 It is a schematic diagram for constructing an animal model of ABE10 targeting the PCSK9 gene;

[0050] Figure 3 It is a comparison diagram of the high-throughput sequencing results of F0 generated after microinjection of ABE8e / ABE10;

[0051] Figure 4 It is a diagram showing the expression of PCSK9 in F0 mice generated after microinjection of ABE10;

[0052] Figure 5 It is a diagram showing the expression of LDL-C in F0 mice generated after microinjection of ABE10;

[0053] Figure 6 It is a schematic diagram for constructing an animal model of ABE10 targeting the TBXT gene;

[0054] Figure 7 It is a comparison diagram of the high-throughput sequencing results of F0 generated after microinjection of ABE10;

[0055] Figure 8 It is a diagram of the tail condition of F0 mice generated after microinjection of ABE10 after 6 weeks. Detailed Embodiments

[0056] To more clearly illustrate the overall concept of this application, the following provides a detailed description by way of examples in conjunction with the accompanying drawings of the specification. In the following description, numerous specific details are given to provide a more thorough understanding of the present invention. However, it will be apparent to those skilled in the art that the present invention may be practiced without one or more of these details. In other instances, to avoid confusion with the present invention, some well-known technical features in the art are not described.

[0057] It should be noted that the following detailed description is exemplary and is intended to provide further illustration of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs.

[0058] Before further describing the specific embodiments of the present invention, it should be understood that the protection scope of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the embodiments of the present invention are for the purpose of describing specific embodiments and not for limiting the protection scope of the present invention.

[0059] Unless otherwise specified, in the following embodiments, reagents or instruments for which the manufacturer is not indicated are all conventional products that can be obtained through commercial purchase. For those embodiments where specific conditions are not indicated, they are carried out according to conventional conditions or conditions recommended by the manufacturer.

[0060] The plasmids, restriction enzymes, PCR enzymes, column DNA extraction kits, DNA gel recovery kits, etc. used in the following examples are commercial products, and the specific operations are carried out according to the kit instructions.

[0061] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt the conventional techniques in the fields of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields in this technical field, and can be specifically carried out according to Molecular Cloning: A Laboratory Manual (Fourth Edition).

[0062] Among them, the bases include adenine (A), thymine (T), guanine (G), cytosine (C), and uracil (U).

[0063] In addition, the "water" described in the present invention includes any feasible water that can be used in the art, such as deionized water, distilled water, ion-exchanged water, double-distilled water, high-purity water, and purified water.

[0064] In the following examples, unless otherwise specified, % means wt%, i.e., weight percentage.

[0065] In this application, ABE10 is applied to the production of a mouse disease animal model. PCSK9, i.e., proprotein convertase subtilisin / kexin type 9, is a serine protease encoded by the PCSK9 gene, which is associated with autosomal dominant hypercholesterolemia, can regulate the lipid metabolism level in the body, and affect the occurrence and development of coronary heart disease. PCSK9 regulates lipid metabolism mainly by specifically binding to the low-density lipoprotein receptor (LDLR) on the cell surface to form a complex and transporting it to the lysosome, resulting in the accelerated degradation of LDLR, thereby increasing the plasma low-density lipoprotein cholesterol (LDL-C) level. This application designs an sgRNA targeting the antisense strand of the splice donor of exon 1 of the PCSK9 gene at the A 6 site, with the expectation of disrupting the gene expression by destroying this splice site to generate a hypocholesterolemic mouse model (as Figure 2 shown).

[0066] Recently, TBXT was reported to be a gene affecting mouse tail evolution. When its exon 6 skips, the resulting incomplete transcript affects mouse tail evolution and can induce a model of short tail or tail loss in mice (as Figure 6 shown). This application designs for the first time an sgRNA targeting the antisense strand of the GT splice site of exon 6 of the TBXT gene at the A 5 site, with the expectation of disrupting its splice site to achieve the skipping of exon 6 and to produce a mouse model with a short tail or tail loss.

[0067] 1. Preparation of mRNA and sgRNA

[0068] 1.1 Preparation of mRNA

[0069] 1.1.1 Construction of the fusion protein ABE10

[0070] In the present invention, the mRNA is based on ABE10 (the fusion protein ABE10 has been disclosed in the Chinese patent with the application number 202311786372.7), and the structural schematic diagram is as Figure 1 shown, and the related sequences are shown in Table 1. The T7 promoter is introduced into the ABE10 template by PCR using the primers T7-ABEs-mRNA-F / R (Table 2), and polymerase chain reaction (PCR) is carried out using KOD-Plus-Neo DNA polymerase (Toyobo, code: KOD-401). The base-editing mRNA is transcribed in vitro using the mMESSAGE mMACHINE T7 kit (Invitrogen) and purified using the MEGAclear kit (Invitrogen).

[0071] Table 1. Coding sequence of ABE10

[0072]

[0073]

[0074] Table 2. PCR primers used for constructing T7 promoter

[0075] Primer Name Primer Sequence (5’-3’) T7-ABEs-mRNA-F ttaatacgactcactatagggagaatgaagaggaccgccgatggctc T7-ABEs-mRNA-R ctagtcacctcccagctgagacaggtc

[0076] 1.2. Preparation of sgRNA

[0077] Construction of sgRNA expression plasmid. In this example, 2 editing targets, PCSK9 and TBXT, were designed. sgRNAs with 2'-O-methyl 3”-thiolphosphate (MS) modification were synthesized by GenScript (Nanjing, China) respectively. The specific sequences are shown in Table 3.

[0078] Table 3. Targets and sequences used

[0079]

[0080] Note: * indicates 2'-O-methyl 3”-thiolphosphate (MS) modification

[0081] 2. Construction of animal models with hypocholesterolemia and short tail or tail loss using fusion protein ABE10

[0082] The following mice used are C57 / BL6 mice.

[0083] 2.1. Preparation of microinjection mixture

[0084] Prepare the injection mixture with nuclease-free water to obtain a working system mRNA (mRNA containing ABE10) with a total volume of 20 μL and a final concentration of 100 ng / μL and a mixture of sgRNA (PCSK9-sg1 / TBXT-sg1) with a final concentration of 200 ng / μL. Replace the mRNA group containing ABE10 with mRNA containing ABE8e as the control group.

[0085] 2.2. Collection of one-cell stage embryos

[0086] C57BL / 6J and ICR mice are raised in a specific pathogen-free environment with a 12-hour light / dark cycle and ad libitum diet, and are used as embryo donors and foster mothers respectively.

[0087] (1) On the first day: Inject 100 μL (5 IU) of PMSG working solution into the peritoneal cavity of 6-8-week-old donor female mice between 1-2 pm.

[0088] (2) On the third day: Inject 100 μL (5 IU) of hCG working solution into the peritoneal cavity of the female mice injected with PMSG between 2 - 4 pm. After injection, cage the hormonally treated female mice one-on-one with male mice aged 10 - 14 weeks. Meanwhile, mate the estrous female mice without hormonal treatment with vasectomized male mice around 4 pm for the preparation of pseudopregnant female mice.

[0089] (3) On the fourth day: Before 9 am, check whether the recipient female mice caged with vasectomized male mice have vaginal plugs. Concentrate the female mice with vaginal plugs in new cages for the embryo transfer experiment in the afternoon.

[0090] (4) Sacrifice the superovulated donor female mice by carbon dioxide asphyxiation, remove the oviducts, and place them in a petri dish containing pre-warmed M2 medium.

[0091] (5) Place the oviducts in another new petri dish containing pre-warmed M2 medium and hyaluronic acid, with the volume ratio of M2 medium to hyaluronic acid being 9:1. Under a stereomicroscope, use forceps to pull the ampulla of the oviduct to release the embryos into the petri dish. Incubate the embryos in M2 medium with hyaluronic acid until the cumulus cells fall off. After removing the cumulus cells, transfer the embryos to a new petri dish containing M2 medium without hyaluronic acid, and repeatedly rinse the embryos with M2 medium to wash away both the hyaluronic acid and cumulus cells.

[0092] (6) Transfer the rinsed embryos to a new petri dish. First, disperse a few drops of KSOM medium in the dish, and then slowly add mineral oil to the dish to separate and cover the KSOM medium with the mineral oil. Generally, in a 35-mm petri dish, 6 spots of KSOM medium can be added, with each spot being 50 μL. Take 50 embryos as a group and first place them in the middle KSOM medium spot for rinsing, and then transfer them to a new medium spot. Before microinjection, incubate the retrieved embryos in M2 medium in a cell culture incubator.

[0093] 2.3. Microinjection and Embryo Transfer

[0094] (1) Prepare a holding needle, an injection needle, and a silanized glass slide. Drop a drop of M2 medium covered with mineral oil in the middle of the slide.

[0095] (2) Let the injection needle automatically suck in and fill with the microinjection mixture prepared in step 2.1 by capillary action, and load the injection needle onto the holding handle of the microinjector.

[0096] (3) Transfer 50 embryos into the M2 medium on a glass slide. Move the fixing needle closer to the embryos so that the embryos are fixed on the fixing needle by negative pressure. After the embryos are fixed, find the cytoplasm under a high-power microscope. Push the tip of the injection needle through the zona pellucida and cell membrane, and inject the microinjection mixture into the cytoplasm of the embryos.

[0097] (4) Transfer the injected embryo cells to a new spot of M2 medium. Repeat steps (2) and (3) until all the embryos are injected. After injecting one experimental group, transfer the embryos to a new KSOM medium and place the embryos in an incubator for 1 - 2 hours or overnight. After all the embryos are injected, exclude the embryos that died due to mechanical damage, and transfer the healthy embryos to a new KSOM medium.

[0098] (5) Inject 600 μL of avertin into the abdominal cavity of the pseudopregnant mouse to anesthetize it. Use a hair clipper to shave the hair on the back of the mouse. Wipe the shaved skin with 70% ethanol.

[0099] (6) Make a small incision at the position of the ovary. Use blunt forceps to pull out the ovary by holding the fat pad of the ovary, and at the same time fix the ovary on the outside with a hemostat. Use blunt forceps to find the infundibulum of the oviduct located under the ovarian bursa.

[0100] (7) Let the transfer needle successively aspirate M2 medium, two small air bubbles, and about 15 embryos. The air bubbles are for facilitating the observation of the position of the embryos in the transfer needle.

[0101] (8) Gently dissect the ovarian bursa, locate the infundibulum of the oviduct with forceps, extend the transfer needle to the opening of the ovary, then eject the embryos in the transfer needle, and gently withdraw the transfer needle.

[0102] (9) Release the hemostat fixing the ovarian fat pad, put the ovary back into the original cavity, and suture the muscle opening and skin opening with sutures respectively.

[0103] (10) Place the operated mouse on a warming table at a constant temperature of 37 °C. After the mouse regains consciousness, transfer it to a breeding cage for breeding and wait for the embryos to develop until parturition. Generally, the pseudopregnant mice that have successful transplantation give birth to mice after 3 weeks.

[0104] 3. Genotyping and Phenotyping Identification of Mouse Models

[0105] 3.1. Mouse Genome Identification

[0106] Take the mice born in step 2.3 about 7 - 10 days after birth, cut their toes for genome identification. The specific steps are as follows:

[0107] 3.1.1 Genome Extraction

[0108] ① Cut off its toes and put them into 1.5 mL centrifuge tubes. Add 500 μL of toe digestive solution prepared according to the ratio of proteinase K: tissue lysate = 1:500 to each tube, and incubate overnight in a water bath at 55 °C.

[0109] ② Take out the toes digested overnight, place them at room temperature for 10 - 15 minutes, mix well by inverting thoroughly, and centrifuge at 13000 rpm for 15 minutes.

[0110] ③ Aspirate 400 μL of the supernatant from each tube, add an equal volume of chloroform, mix well, and centrifuge at 12000 rpm for 10 minutes after DNA precipitation.

[0111] ④ Add 200 μL of 75% alcohol pre-cooled in a -20 °C refrigerator to each tube, mix gently, centrifuge at 12000 rpm at 4 °C for 5 min, discard the supernatant, and air-dry in a clean workbench.

[0112] ⑤ Add 50 - 100 μL of deionized ultrapure water according to the amount of DNA, and dissolve at 55 °C for 2 hours to obtain the PCR template.

[0113] 3.1.2 Genotype identification

[0114] According to the operation procedure of the Hitom kit, design corresponding identification primers (Table 4), that is, add the bridging sequence 5'-ggagtgagtacggtgtgc-3' to the 5' end of the forward identification primer and the bridging sequence 5'-gagttggatgctggatgg-3' to the 5' end of the reverse identification primer to obtain the first-round PCR product. Then, use the first-round PCR product as a template, perform the second-round PCR, mix, cut the gel, recover and purify, and then send it to a sequencing company for NGS sequencing. Process the NGS results through the website www.rgenome.net to obtain the editing efficiency.

[0115] Table 4. High-throughput sequencing primers for the targets used

[0116]

[0117] 3.2. Phenotype identification

[0118] 3.2.1 Phenotype identification of hypocholesterolemic mice

[0119] Take the same batch of injected mice and collect and analyze serum samples at all time points simultaneously. Measure the PCSK9 level using an ELISA kit (Proteintech, #KE10050) and evaluate the LDL-C level using a determination kit from Solarbio (#BC5335). All procedures are carried out strictly according to the manufacturer's instructions.

[0120] 3.2.2 Phenotype identification of short-tailed or tail-loss mice

[0121] The same-sex wild-type mice (blank control) and identified TBXT gene mutation mice at 6 weeks old were photographed, and the tail lengths were observed and recorded. The results are as Figure 8 shown.

[0122] Conclusion:

[0123] We applied ABE10, which can specifically edit YA (Y = T or C), to the production of mouse disease animal models. Through fertilized egg injection, the results showed that both ABE8e and ABE10 produced efficient editing in embryos. Among them, in the born mice, there were 18 in the ABE 10 treatment group, and 17 were successfully edited; there were 11 in the ABE8e treatment group, and 9 were successfully edited ( Figure 3 ). However, only ABE10 precisely targeted the A-to-G conversion on the opposite DNA strand of the GT splicing site and hardly produced off-target editing. On the contrary, in the ABE8e treatment group, not only the target base A 6 , but also the off-target A 4 was edited ( Figure 3 ). By detecting the expression levels of PCSK9 and LDL-C, it was further confirmed that ABE10 could precisely target the target base and efficiently produce a mouse model with a hypocholesterolemia phenotype ( Figure 4 , 5).

[0124] Similarly, the high-throughput sequencing results of TBXT born mice showed that there were 8 in the ABE10 treatment group, and 8 mice were successfully edited ( Figure 7 ), and the editing efficiency was 100%. At the same time, we compared the tail lengths of same-sex mice at 6 weeks old. Among them, the heterozygous mice (#BT03, #BT04) showed an almost tailless phenotype, while the mice with a lower editing efficiency (#BT02) showed a short-tail phenotype ( Figure 8 ). However, no mice were born in the ABE8e treatment group (data not shown). The possible reason is that the homozygous editing of ABE8e in mice led to a complete skipping of exon 6, and the homozygous TBXT jumping deletion mice would die in the embryonic period. This also shows that ABE10 can precisely target the target base and produce a mouse model with a short-tail or tailless phenotype.

[0125] Therefore, the present invention provides a precise and efficient platform for producing mouse disease animal models, which will greatly accelerate the production process of animal models in different species (including rats, zebrafish, monkeys, pigs, etc.). ABE10 has great application potential in the production of disease models.

[0126] The above are only embodiments of the present application and are not intended to limit the present application. For those skilled in the art, various changes and modifications can be made to the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included within the scope of the claims of the present application.

Claims

1. Application of fusion protein ABE10 in preparing disease animal models.

2. The use according to claim 1, characterized in that: The animal can be selected from one or more of mice, rats, hamsters, guinea pigs, monkeys, rabbits, pigs, zebrafish, African clawed frogs, and fruit flies; preferably, mice; preferably, the disease animal model includes a hypocholesterolemia animal model and / or a tail-deficient animal model.

3. The use according to claim 2, characterized in that: The construction of the hypocholesterolemia animal model is achieved by silencing and / or weakening PCSK9 expression; more preferably, the method of silencing and / or weakening PCSK9 expression includes mutating A to G in the reverse chain CA of the splicing donor of exon 1 of the PCSK9 gene.

4. The use according to claim 2, characterized in that: The construction of the tail-deficient animal model is achieved by silencing and / or weakening TBXT expression; preferably, the method of silencing and / or weakening TBXT expression comprises mutating A to G in the reverse chain CA of the splice acceptor of exon 6 of the TBXT gene.

5. A method for preparing a disease animal model, characterized in that: The method includes: editing animal genes using a single-base gene editing system, wherein the single-base gene editing system includes the fusion protein ABE10.

6. The method according to claim 5, characterized in that The single-base gene editing system also includes sgRNA, which guides the fusion protein ABE10 to perform single-base gene editing on the target gene in the target cell.

7. The method according to claim 6, characterized in that The animal can be selected from one or more of mice, rats, hamsters, guinea pigs, monkeys, rabbits, pigs, zebrafish, African clawed frogs, and fruit flies; preferably, mice; preferably, the disease animal model includes a hypocholesterolemia animal model and / or a tail-deficient animal model.

8. The method according to claim 7, characterized in that The construction of the hypocholesterolemia animal model is achieved by silencing and / or weakening PCSK9 expression; more preferably, the method of silencing and / or weakening PCSK9 expression includes mutating A in the reverse chain CA of the splicing donor of exon 1 of the PCSK9 gene to G; preferably, the sequence of the sgRNA includes SEQ ID No.

2.

9. The method according to claim 7, characterized in that: The construction of the tail-deficient animal model is achieved by silencing and / or weakening TBXT expression; preferably, the method of silencing and / or weakening TBXT expression comprises mutating A in the reverse chain CA of the splice acceptor of exon 6 of the TBXT gene to G; preferably, the sequence of the sgRNA comprises SEQ ID No.

3.

10. Use of the method according to any one of claims 5 to 9 to improve the efficiency and / or accuracy of preparing disease animal models.

Images