A method for preparing a disease animal model and its application

Abstract

The application provides a method for preparing a disease animal model and application thereof, and relates to the technical field of genetic engineering.In the application, a precise adenine base editor ABE, ABE10, which can specifically edit YA (Y=T or C), is applied to the preparation of a mouse disease animal model, and ABE10 has good efficiency and precision in the generation of the disease model compared with ABE8e.This new method for preparing an animal model by using ABE10 will further promote the application of ABE so as to match more extensive clinical scenarios, and will greatly promote the production process of different animal models.

Description

Technical Field

[0001] This application relates to the field of genetic engineering technology, and in particular to a method for preparing animal models of diseases and its application. Background Technology

[0002] Current research shows that approximately 60% of genetic diseases are caused by single-base mutations, and treating these diseases requires safe and effective genome editing tools. Repairing these pathogenic point mutations using CRISPR / Cas9-mediated homologous recombination is extremely inefficient. In 2017, the adenine base editor (ABE) was reported. Composed of adenine deaminase fused with CRISPR / Cas9, it achieves highly efficient A-to-G base editing on the genome and can be used to treat 48% of diseases caused by point mutations, making it an important gene editing tool for treating genetic diseases. ABE has been reported for efficient genome editing, the creation of animal models of diseases, and gene therapy.

[0003] However, ABE has an editing window of approximately five bases during base editing, which causes simultaneous editing of adjacent bases while editing the target base. When using ABE to create animal models of disease, it can also induce adjacent base editing in mouse embryos while simultaneously inducing target base transitions. This may interfere with the relationship between mouse disease phenotypes and base mutations, and could also pose unpredictable safety risks. Summary of the Invention

[0004] To address the aforementioned issues, this invention utilizes the previously developed high-precision ABE (Abe10) with sequence preference (YA, Y=T or C) to create animal disease models, attempting to overcome its limitations in animal disease creation. Taking the creation of hypocholesterolemia and short-tailed or tailless mouse models as an example, the sequence-preferenced and highly precise adenine base editing tool ABE10 is used to target the YA sequence-containing bases in the PCSK9 and TBXT genes, achieving precise and efficient base editing, ultimately producing mouse models with hypocholesterolemia and short-tailed or tailless phenotypes.

[0005] On the one hand, this application provides the application of the fusion protein ABE10 in the preparation of animal models of disease.

[0006] The fusion protein ABE10 has been disclosed in Chinese patent application number 202311786372.7.

[0007] The amino acid sequence of the fusion protein ABE10 is shown in SEQ ID No. 1.

[0008] The ABE10 can precisely target the A base in the YA (Y=T or C) sequence (in the embryo), causing the site to mutate from A to G, thus generating a disease animal model, especially for the preparation of hypocholesterolemia mouse models and / or short-tailed or tailless mouse models.

[0009] Further, the animal may be selected from one or more of mice, rats, hamsters, guinea pigs, monkeys, rabbits, pigs, zebrafish, African clawed frogs, and fruit flies; preferably, mice; preferably, the disease animal model includes a hypocholesterolemia animal model and / or a short-tailed or tailless animal model.

[0010] Preferably, the animal model of the disease includes a hypocholesterolemia mouse model and / or a tailless mouse model.

[0011] Furthermore, the construction of the hypocholesterolemia animal model is achieved by silencing and / or attenuating PCSK9 expression; more preferably, the method of silencing and / or attenuating PCSK9 expression includes mutating A to G in the reverse strand CA of the PCSK9 gene exon 1 splice donor.

[0012] The A in the reverse strand "CA" of the PCSK9 gene exon 1 splicing donor "GT" was mutated to G.

[0013] Preferably, the reverse strand of the PCSK9 gene exon 1 splicing donor includes CCCATACCTTGGAGCAACGGCGG, wherein the A at the 6th base from the 3' to 5' end is mutated to G.

[0014] In a preferred embodiment, the genebank number of PCSK9 is AL954352.10.

[0015] Specifically, this invention utilizes the property of ABE10 to precisely target the A base in the YA (Y = T or C) sequence (in the embryo) to design an sgRNA targeting the A6 site of the PCSK9 gene exon 1 splicing donor reverse strand. By using ABE10 to edit the A6 site at this target (mutating from A to G), PCSK9 skips exon 1 during expression, thereby generating a mouse model of hypocholesterolemia. The principle is as follows: Figure 2 As shown.

[0016] Furthermore, the tail-deficient animal model is constructed by silencing and / or attenuating TBXT expression; preferably, the method of silencing and / or attenuating TBXT expression includes mutating A to G in the reverse strand CA of the exon 6 splice acceptor of the TBXT gene.

[0017] The A in the back strand "CA" of the 6th exon splice acceptor "GT" of the TBXT gene was mutated to G.

[0018] Preferably, the reverse strand of the TBXT gene exon 6 splice acceptor includes ACCTACTTGGAGAGCTGTTCCGA, wherein the A at the 5th base from the 3' to 5' end is mutated to G.

[0019] In a preferred embodiment, the genebank number of TBXT is AC154579.3.

[0020] Specifically, this invention utilizes the ability of ABE10 to precisely target the A base in the YA (Y = T or C) sequence (in the embryo) to design an sgRNA targeting the A5 site of the GT splice site on the reverse strand of exon 6 of the TBXT gene. ABE10 is then used to edit A5 at this target site (mutating from A to G). This disruption leads to the skipping of exon 6, thereby inducing a mouse tail-deficient model. The principle is as follows: Figure 6 As shown.

[0021] Furthermore, the TBXT gene is homozygous lethal. Editing with ABE8e results in the complete skipping of exon 6, leading to a homozygous mutation in the TBXT gene. Mice with homozygous TBXT skipping deletion will die during the embryonic stage. Therefore, ABE8e editing cannot obtain mouse models with short tails or tail loss phenotypes. However, the method described in this application can obtain heterozygous or chimeric mice with silenced and / or attenuated TBXT expression, thereby obtaining mouse models with short tails or tail loss phenotypes and solving the problem of homozygous lethality.

[0022] Those skilled in the art will understand that the disease animal model can be prepared using conventional methods.

[0023] On the other hand, this application also provides a method for preparing an animal model of disease, the method comprising: editing animal genes using a single-base gene editing system, the single-base gene editing system comprising the fusion protein ABE10.

[0024] Furthermore, the single-base gene editing system also includes sgRNA, which guides the fusion protein ABE10 to perform single-base gene editing on the target gene in the target cell.

[0025] Preferably, the animal may be selected from one or more of the following: mouse, rat, hamster, guinea pig, monkey, rabbit, pig, zebrafish, African clawed frog, and fruit fly; more preferably, mouse.

[0026] In a preferred embodiment, the mouse is a C57 / BL6 mouse.

[0027] In a preferred embodiment, the cell is an animal embryonic cell.

[0028] In a preferred embodiment, the method for preparing the disease animal model includes: mixing sgRNA and the mRNA of the fusion protein ABE10 at a ratio of 200 ng / μL: 100-200 ng / μL and injecting them into embryonic cells; the sgRNA guides the fusion protein ABE10 to perform single-base gene editing on the target gene in the target cells; and the disease animal model is obtained by developing the embryonic cells until delivery.

[0029] Furthermore, the method also includes the step of introducing a promoter into the single-base gene editing system, wherein the promoter is the T7 promoter.

[0030] Those skilled in the art can also choose other promoters for experiments based on the actual situation, as long as they can complete the in vitro transcription of mRNA.

[0031] Furthermore, the animal model of disease includes a hypocholesterolemia animal model and / or a tail-deficient animal model; preferably, the animal model of disease is a disease animal model with a homozygous lethal gene.

[0032] Preferably, the construction of the hypocholesterolemia animal model is achieved by silencing and / or attenuating PCSK9 expression, thereby reducing PCSK9 and LDL-C levels; more preferably, the method of silencing and / or attenuating PCSK9 expression includes mutating A to G in the reverse strand CA of the PCSK9 gene exon 1 splice donor; preferably, the sequence of the sgRNA includes SEQ ID No. 2;

[0033] Preferably, the tail-deficient animal model is constructed by silencing and / or attenuating TBXT expression; preferably, the method of silencing and / or attenuating TBXT expression includes mutating A to G in the reverse strand CA of the exon 6 splice acceptor of the TBXT gene; preferably, the sequence of the sgRNA includes SEQ ID No. 3.

[0034] In a preferred embodiment, the sgRNA sequence contains a 2'-O-methyl 3'-thiophosphate (MS) modification.

[0035] SEQ ID No. 2 includes the sequence: C*C*C*AUACCUUGGAGCAACGGGUUUUAGAGCUAGAA AUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGCU*U*U*U. Wherein, * indicates modification with 2'-O-methyl 3”-thiophosphate (MS).

[0036] SEQ ID No. 3 includes the sequence: A*C*C*UACUUGGAGAGCUGUUCGUUUUAGAGCUAGAA AUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGCU*U*U*U. Where * indicates modification with 2'-O-methyl 3”-thiophosphate (MS).

[0037] Among them, 2'-O-methyl 3”-thiophosphate (MS) modification can improve the stability of sgRNA in vivo.

[0038] PCSK9, or preprotein convertase subtilisin 9, is a serine protease encoded by the PCSK9 gene. It is primarily produced by the liver, but is also expressed in other organs such as the intestines, heart, and pancreas. PCSK9 is not only associated with autosomal dominant hypercholesterolemia, but it also effectively regulates lipid metabolism, influencing the development and progression of coronary heart disease. PCSK9 regulates lipid metabolism mainly by specifically binding to the low-density lipoprotein receptor (LDLR) on the cell surface, forming a complex that is then transported to lysosomes. This leads to accelerated LDLR degradation, thereby increasing plasma low-density lipoprotein cholesterol (LDL-C) levels.

[0039] TBXT is a gene that influences the evolution of the mouse tail. When its exon 6 is skipped, the resulting incomplete transcript affects the evolution of the mouse tail.

[0040] On the other hand, this application also provides the application of the method in improving the efficiency and / or accuracy of preparing animal models of diseases.

[0041] Preferably, the efficiency of constructing and editing the hypocholesterolemia mouse model is greater than or equal to 90%; more preferably, it is greater than or equal to 94%.

[0042] Preferably, the editing does not produce bystander editing.

[0043] The present invention has the following beneficial effects:

[0044] This invention is the first to apply the precise adenine base editor ABE10, which can specifically edit YA (Y = T or C), to the creation of mouse disease animal models. Compared with ABE8e, ABE10 has better efficiency and accuracy in the generation of disease models.

[0045] ABE10 effectively and precisely induces base editing. Among these, PCSK9 achieved a base editing efficiency of 94.44%, and compared to ABE8e, only ABE10 precisely induced the A-to-G conversion of the opposite DNA strand at the GT splice site, with almost no bystander editing. Similarly, TBXT achieved a base editing efficiency of 100%, and no mice were born in the ABE8e treatment group, indicating that homozygous editing by ABE8e completely skips exon 6, while homozygous TBXT skipping deletion mice die during embryonic development; however, ABE10 overcomes this problem.

[0046] In summary, this invention provides a novel, efficient, and accurate platform for preparing animal models of diseases, which will greatly accelerate the production process of various animal models. This new method for creating animal models using ABE10 will also further promote the application of ABE to match a wider range of clinical scenarios and will also greatly accelerate the production process of various animal models. Attached Figure Description

[0047] The accompanying drawings, which are included to provide a further understanding of this application and form part of this application, illustrate exemplary embodiments of this application and are used to explain this application, but do not constitute an undue limitation of this application. In the drawings:

[0048] Figure 1 This is a schematic diagram of the structure of the fusion protein ABE10;

[0049] Figure 2 A schematic diagram illustrating the construction of an animal model for ABE10 targeting the PCSK9 gene;

[0050] Figure 3 A comparison diagram of F0 high-throughput sequencing results generated after ABE8e / ABE10 microinjection;

[0051] Figure 4 Figure showing PCSK9 expression in F0 mice induced by ABE10 microinjection;

[0052] Figure 5 Figure showing LDL-C expression in F0 mice induced by ABE10 microinjection;

[0053] Figure 6 A schematic diagram illustrating the construction of an animal model for ABE10 targeting the TBXT gene;

[0054] Figure 7 Comparison of F0 high-throughput sequencing results generated after ABE10 microinjection;

[0055] Figure 8 This image shows the tail of an F0 mouse 6 weeks after microinjection of ABE10. Detailed Implementation

[0056] To more clearly illustrate the overall concept of this application, a detailed description is provided below with reference to the accompanying drawings and embodiments. Numerous specific details are set forth in the following description to provide a more thorough understanding of the invention. However, it will be apparent to those skilled in the art that the invention can be practiced without one or more of these details. In other instances, certain technical features well-known in the art have not been described to avoid confusion with the invention.

[0057] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0058] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention.

[0059] Unless otherwise specified, all reagents or instruments used in the following embodiments, unless otherwise indicated by the manufacturer, are commercially available products. Where specific conditions are not specified in the embodiments, they are performed under standard conditions or conditions recommended by the manufacturer.

[0060] The plasmids, restriction enzymes, PCR enzymes, column DNA extraction kits, and DNA gel recovery kits used in the following examples are commercial products. The specific operations were performed according to the kit instructions.

[0061] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. Specifically, they can be performed according to Molecular Cloning: A Laboratory Manual (Fourth Edition).

[0062] The bases include adenine (A), thymine (T), guanine (G), cytosine (C), and urazine (U).

[0063] In addition, the "water" mentioned in this invention includes any feasible water that can be used in the art, such as deionized water, distilled water, ion-exchanged water, double-distilled water, high-purity water, and purified water.

[0064] In the following examples, unless otherwise specified, % means wt%, i.e., weight percentage.

[0065] This application utilizes ABE10 to create a mouse disease model. PCSK9, or proprotein convertase subtilisin 9, is a serine protease encoded by the PCSK9 gene. It is associated with autosomal dominant hypercholesterolemia and can regulate lipid metabolism, influencing the development of coronary heart disease. PCSK9 regulates lipid metabolism primarily by specifically binding to the low-density lipoprotein receptor (LDLR) on the cell surface, forming a complex that is then transported to lysosomes, leading to accelerated LDLR degradation and thus increasing plasma low-density lipoprotein cholesterol (LDL-C) levels. This application designs an sgRNA targeting the A6 site of the PCSK9 gene exon 1 splice donor reverse strand to disrupt gene expression and generate a mouse model of hypocholesterolemia (e.g., PCSK9). Figure 2 (As shown).

[0066] Recently, TBXT has been reported as a gene that influences the evolution of mouse tails. When its exon 6 is skipped, the resulting incomplete transcript affects the evolution of mouse tails, potentially inducing models of short tails or tail loss in mice (e.g., ...). Figure 6 (As shown). This application is the first to design an sgRNA targeting the A5 site of the GT splice site on the back strand of exon 6 of the TBXT gene, in order to disrupt its splice site and achieve exon 6 skipping, in order to create a mouse model with a short tail or tail loss.

[0067] 1. Preparation of mRNA and sgRNA

[0068] 1.1 Preparation of mRNA

[0069] 1.1.1 Construction of fusion protein ABE10

[0070] In this invention, the mRNA is based on ABE10 (the fusion protein ABE10 has been disclosed in Chinese patent application number 202311786372.7), and its structural diagram is shown below. Figure 1 As shown in Table 1, the sequences involved were introduced into the ABE10 template via PCR using primers T7-ABEs-mRNA-F / R (Table 2). Polymerase chain reaction (PCR) was performed using KOD-Plus-Neo DNA polymerase (Toyobo, code: KOD-401). The mRNA was transcribed in vitro using the mMESSAGE mMACHINE T7 kit (Invitrogen) and purified using the MEGAclear kit (Invitrogen).

[0071] Table 1. Encoding sequence of ABE10

[0072]

[0073]

[0074] Table 2. PCR primers used for T7 promoter construction

[0075] Primer name Primer sequence (5'-3') T7-ABEs-mRNA-F ttaatacgactcactatagggagaatgaagaggaccgccgatggctc T7-ABEs-mRNA-R ctagtcacctcccagctgagacaggtc

[0076] 1.2 Preparation of sgRNA

[0077] In this embodiment, two editing targets, PCSK9 and TBXT, were designed for the construction of sgRNA expression plasmids. sgRNAs modified with 2'-O-methyl 3”-thiophosphate (MS) were synthesized by GenScript (Nanjing, China). The specific sequences are shown in Table 3.

[0078] Table 3. Targets and sequences used

[0079]

[0080] Note: * indicates modification of 2'-O-methyl 3”-thiophosphate (MS)

[0081] 2. Using the fusion protein ABE10 to construct animal models of hypocholesterolemia and short tail or tail loss.

[0082] The mice used below are C57 / BL6 mice.

[0083] 2.1 Preparation of Microinjection Mixture

[0084] The injection mixture was prepared using nuclease-free water to obtain a total volume of 20 μL of working system mRNA (containing ABE10) at a final concentration of 100 ng / μL and a final concentration of sgRNA (PCSK9-sg1 / TBXT-sg1) at a final concentration of 200 ng / μL. The control group was prepared by replacing the ABE10 mRNA with the ABE8e mRNA.

[0085] 2.2 Collection of one-cell stage embryos

[0086] C57BL / 6J and ICR mice were housed in a specific pathogen-free environment with a 12-hour light / dark cycle and free-feeding, and were used as embryo donors and foster mothers, respectively.

[0087] (1) Day 1: 100 μL (5 IU) of PMSG working solution was injected into the peritoneum of 6-8 week old donor female mice between 1-2 pm.

[0088] (2) Day 3: Between 2 and 4 p.m., inject 100 μL (5 IU) of hCG working solution into the peritoneum of female mice that have been injected with PMSG. After the injection, pair the hormone-treated female mice with male mice aged 10-14 weeks one-to-one. At the same time, mate female mice in estrus that have not been hormone-treated with male mice with ligated fallopian tubes around 4 p.m. to prepare for pseudopregnant female mice.

[0089] (3) Day 4: Before 9 a.m., check whether the recipient female mice that are caged with the ligated male mice have pregnancy plugs. Collect the female mice with pregnancy plugs in a new cage for the embryo transfer experiment in the afternoon.

[0090] (4) The superovulatory donor mice were euthanized by carbon dioxide asphyxiation and the oviducts were removed and placed in a petri dish. Preheated M2 medium was added to the petri dish.

[0091] (5) Place the fallopian tube in a new petri dish containing preheated M2 medium and hyaluronic acid at a volume ratio of 9:1. Under a stereomicroscope, use tweezers to pull the ampulla of the fallopian tube to release the embryo into the petri dish. Incubate the embryo in M2 medium containing hyaluronic acid until the cumulus cells fall off. After removing the cumulus cells, transfer the embryo to a new petri dish containing M2 medium without hyaluronic acid. Rinse the embryo repeatedly with M2 medium to ensure that both hyaluronic acid and cumulus cells are thoroughly removed.

[0092] (6) Transfer the rinsed embryos to a new Petri dish. First, add a few drops of KSOM medium to the dish, then slowly add mineral oil to separate and cover the KSOM medium. Generally, 6 spots of 50 μL of KSOM medium can be added to a 35 mm Petri dish. Place 50 embryos as a group, first rinsing them in the middle KSOM medium spot, then transferring them to a new medium spot. Before microinjection, incubate the removed embryos in M2 medium in a cell culture incubator.

[0093] 2.3 Microinjection and Embryo Transfer

[0094] (1) Prepare fixation needles, injection needles and silicified glass slides. Drop a drop of M2 culture medium covered with mineral oil into the center of the slide.

[0095] (2) The injection needle is automatically drawn in and filled with the microinjection mixture prepared in step 2.1 by capillary action, and the injection needle is loaded onto the fixed handle of the microinjection instrument.

[0096] (3) Transfer 50 embryos to M2 culture medium on a glass slide, move the fixation needle close to the embryo, and fix the embryo on the fixation needle by negative pressure. After the embryo is fixed, locate the cytoplasm under a high magnification microscope, push the tip of the injection needle through the zona pellucida and cell membrane, and inject the microinjection mixture into the cytoplasm of the embryo.

[0097] (4) Transfer the injected embryonic cells to a new M2 culture medium. Repeat steps (2) and (3) until all embryos have been injected. After injecting one experimental group, transfer the embryos to a new KSOM culture medium and incubate them in a cell culture incubator for 1-2 hours or overnight. After all embryos have been injected, exclude embryos that have died due to mechanical damage and transfer the healthy embryos to a new KSOM culture medium.

[0098] (5) Inject 600 μL of aphthylamine into the peritoneum of the pseudopregnant female mouse to anesthetize her. Use a shaver to remove the fur from the back of the female mouse. Wipe the shaved skin with 70% ethanol.

[0099] (6) Make a small incision at the location of the ovary, use blunt forceps to pull the fat pad of the ovary to pull the ovary out, and at the same time use hemostatic forceps to fix the ovary to the outside. Use blunt forceps to find the funnel-shaped opening of the fallopian tube located on the lower side of the ovarian sac.

[0100] (7) The transfer needle is used to draw in M2 culture medium, two small air bubbles, and about 15 embryos in sequence. The air bubbles are for easy observation of the position of the embryos in the transfer needle.

[0101] (8) Gently cut open the ovarian sac, use a yoke to locate the funnel-shaped opening of the fallopian tube, insert the transfer needle into the opening of the ovary, then eject the embryo from the transfer needle, and gently withdraw the transfer needle.

[0102] (9) Release the hemostatic forceps that fix the ovarian fat pad, put the ovary back into the original cavity, and suture the muscle opening and the skin opening with suture thread respectively.

[0103] (10) After surgery, the mice were placed on a constant temperature warming platform at 37°C. After the mice regained consciousness, they were transferred to a rearing cage to wait for embryonic development until delivery. Generally, the mother mice that successfully transplanted the embryo gave birth to mice 3 weeks later.

[0104] 3. Genotyping and phenotypic identification of mouse models

[0105] 3.1 Mouse genome identification

[0106] Take mice from step 2.3, approximately 7-10 days after birth, and clip their toes for genome identification. The specific steps are as follows:

[0107] 3.1.1 Genome Extraction

[0108] ① Cut off the toes and put them into 1.5mL centrifuge tubes. Add 500μL of toe digestion solution prepared according to the ratio of proteinase K: tissue lysis buffer = 1:500 to each tube and incubate overnight in a 55℃ water bath.

[0109] ② Remove the toes that have been digested overnight, let them sit at room temperature for 10-15 minutes, mix thoroughly by inverting, and centrifuge at 13000 rpm for 15 minutes.

[0110] ③ Aspirate 400 μL of supernatant from each tube, add an equal volume of chloroform, mix thoroughly, and after DNA precipitation, centrifuge at 12000 rpm for 10 minutes.

[0111] ④ Add 200 μL of 75% alcohol pre-cooled in a -20℃ refrigerator to each tube, mix gently, centrifuge at 12000 rpm at 4℃ for 5 min, discard the supernatant, and air dry in a clean workbench.

[0112] ⑤ Add 50-100 μL of deionized ultrapure water according to the amount of DNA, and dissolve at 55℃ for 2 hours to use as a PCR template.

[0113] 3.1.2 Genotyping

[0114] According to the operating procedure of the Hitom kit, corresponding identification primers were designed (Table 4). Specifically, a bridging sequence 5'-ggagtgagtacggtgtgc-3' was added to the 5' end of the forward identification primer, and a bridging sequence 5'-gagttggatgctggatgg-3' was added to the 5' end of the reverse identification primer, thus obtaining the first-round PCR product. Then, using the first-round PCR product as a template, a second round of PCR was performed, followed by mixing, gel extraction, and purification. The product was then sent to a sequencing company for NGS sequencing. The NGS results were processed through the website www.rgenome.net to determine the editing efficiency.

[0115] Table 4. High-throughput sequencing primers used for the target sites

[0116]

[0117] 3.2 Phenotypic Identification

[0118] 3.2.1 Phenotypic identification of hypocholesterolemia mice

[0119] Mice from the same batch were injected, and serum samples were collected and analyzed at all time points. PCSK9 levels were measured using an ELISA kit (Proteintech, #KE10050), and LDL-C levels were assessed using a Solarbio assay kit (#BC5335). All procedures were performed strictly according to the manufacturer's instructions.

[0120] 3.2.2 Phenotypic identification of mice with short tails or missing tails

[0121] Photographs were taken from 6-week-old same-sex wild-type mice (blank control) and identified TBXT gene mutant mice, and tail length was observed and recorded. The results are as follows: Figure 8 As shown.

[0122] in conclusion:

[0123] We applied ABE10, which can specifically edit YA (Y = T or C), to create a mouse disease model. Through injection into fertilized eggs, the results showed that both ABE8e and ABE10 produced highly efficient editing in embryos. Specifically, in the newborn mice, 17 out of 18 mice in the ABE10 treatment group were successfully edited, and 9 out of 11 mice in the ABE8e treatment group were successfully edited. Figure 3 However, only ABE10 precisely targets the A-to-G transition of the opposite DNA strand at the GT splice site and produces almost no bystander editing. In contrast, in the ABE8e treatment group, not only target base A6, but also bystander A4 was edited. Figure 3 The expression of PCSK9 and LDL-C was further examined, confirming that ABE10 can precisely target specific bases to generate a mouse model with a hypocholesterolemia phenotype. Figure 4 ,5).

[0124] Similarly, high-throughput sequencing results of TBXT-born mice showed that, out of 8 mice in the ABE10 treatment group, 8 mice were successfully edited. Figure 7 The editing efficiency was 100%. Simultaneously, we compared the tail length of 6-week-old same-sex mice, where heterozygous mice (#BT03, #BT04) showed a phenotype with almost no tail, while mice with lower editing efficiency (#BT02) showed a short-tail phenotype. Figure 8 However, no mice were born in the ABE8e treatment group (data not shown). A possible reason is that homozygous editing of ABE8e in mice resulted in complete skipping of exon 6, while mice with homozygous TBXT skipping deletions died during embryonic development. This also demonstrates that ABE10 can precisely target specific bases and generate mouse models with short tails or tail loss phenotypes.

[0125] Therefore, this invention provides a precise and efficient platform for generating mouse disease animal models, which will greatly improve the production process of animal models in different species (including rats, zebrafish, monkeys, pigs, etc.). ABE10 has enormous application potential in the generation of disease models.

[0126] The above description is merely an embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principle of this application should be included within the scope of the claims of this application.

Claims

1. A method of preparing an animal model of a disease, characterized by, The method comprises: editing an animal gene by using a single-base gene editing system, the single-base gene editing system comprises a fusion protein ABE10, the animal is a mouse, and the disease animal model is a hypocholesterolemic animal model or a tailless animal model; The single-base gene editing system further comprises an sgRNA, and the sgRNA guides the fusion protein ABE10 to perform single-base gene editing on a target gene in a target cell; The hypocholesterolemia animal model was established by silencing and / or attenuating PCSK9 expression. The method for silencing and / or attenuating PCSK9 expression is to... PCSK9 The A mutation in the reverse strand CA of the exon 1 splice donor of the gene is changed to G; the sequence of the sgRNA is SEQ ID No. 2; The tailless animal model is constructed by silencing and / or weakening TBXT expression, and the method for silencing and / or weakening TBXT expression comprises the following steps: TBXT The A in the reverse strand CA of the 6th exon splice acceptor of the gene is mutated to G; and the sequence of the sgRNA is SEQ ID No.

3.

2. Application of the method of claim 1 in improving the efficiency and / or precision of preparing a disease animal model.

Images