Application of intestinal-derived bacterium in preparation of medicine for relieving constipation

Abstract

The invention relates to the technical field of biology, in particular to application of lactobacillus brevis to preparation of a medicine for treating, relieving and preventing constipation. The lactobacillus brevis disclosed by the invention has relatively strong colonization ability in intestinal tracts of mice; the body weight change of the mouse is not influenced, and certain biological safety is achieved; the intestinal peristalsis can be obviously enhanced, the water content of excrement is increased, and the constipation symptom of mice is relieved. Therefore, the lactobacillus brevis provided by the invention can be widely added into various foods or medicines for application.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a Lactobacillus brevis strain that can enhance intestinal motility and relieve constipation. Background Art

[0002] Constipation refers to a decrease in the frequency of defecation, difficult defecation, hard or spherical feces, and a feeling of incomplete defecation, which is a common clinical symptom. The causes of constipation include functional constipation and organic constipation. Functional constipation refers to constipation caused by factors such as defecation habits, diet, and mental psychology; organic constipation refers to constipation caused by intestinal diseases, endocrine and metabolic diseases, etc.

[0003] Currently, the main methods for treating constipation mainly include drug treatment and surgical treatment. In terms of drug treatment, commonly used drugs include laxatives, prokinetics, and drugs for regulating intestinal flora. Laxatives mainly soften feces by increasing the water content in feces to promote defecation; prokinetics mainly accelerate defecation by promoting intestinal motility; drugs for regulating intestinal flora mainly improve constipation symptoms by regulating intestinal flora. In terms of surgical treatment, it is mainly for organic constipation, such as intestinal tumors, etc., which require surgical treatment.

[0004] In recent years, microbial treatment of constipation has become a new research direction. Some studies have shown that the intestinal flora of constipation patients is dysregulated, the number of probiotics decreases, and the number of harmful bacteria increases. Supplementing probiotics can improve constipation symptoms. In addition, some prebiotics and synbiotics have also become candidate drugs for treating constipation. Prebiotics refer to substances that can promote the growth and reproduction of beneficial intestinal bacteria, such as oligosaccharides, oligomers, etc.; synbiotics refer to a combination of probiotics and prebiotics, which can supplement probiotics and prebiotics at the same time to better improve constipation symptoms. Liu Weixian et al. found that a strain of Lactobacillus paracasei K56 has the effects of regulating intestinal flora and moistening the intestines and promoting defecation (Liu Weixian, et al. Study on the function of Lactobacillus paracasei K56 in regulating intestinal flora and moistening the intestines and promoting defecation [J]. Science and Technology of Food Industry, 2020, 41(20): 279-284). Li Sitong et al. explored the mechanisms of three strains of bacteria from Lactobacillus plantarum, Lactobacillus acidophilus, and Bifidobacterium animalis subsp. lactis in relieving constipation, and found that the relief effect of the three strains on constipation symptoms may be achieved through different mechanisms such as specifically increasing intestinal lubrication, promoting intestinal motility, and slowing down intestinal water absorption (Li Sitong, et al. Mechanisms of Lactobacillus and Bifidobacterium in relieving constipation [J]. Chinese Journal of Microecology, 2023, 35(7): 778-783).

[0005] In summary, constipation is a common clinical problem, and the existing treatment methods mainly include drug treatment and surgical treatment. Microbial treatment of constipation has become a new research direction. Finding highly effective and non-toxic probiotic strains to treat chronic constipation has broad application prospects. Summary of the Invention

[0006] To achieve the above object, the technical solution adopted by the present invention is as follows: The present invention protects the use of Lactobacillus brevis ( Lactobacillus brevis ) ibiome003 in the preparation of a drug for treating, alleviating, and preventing constipation. The Lactobacillus brevis ( Lactobacillus brevis ) ibiome003 is deposited in the China Center for Type Culture Collection, located at the China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The deposit date is March 21, 2023, and the deposit number is CCTCC No. M2023387.

[0007] Furthermore, the drug may further include pharmaceutically acceptable excipients.

[0008] There are various classification methods for excipients in preparations, which can be classified from sources, functions and uses, administration routes, etc. Classified by source, they can be divided into natural products, semi-synthetic products, and fully synthetic products. Classified by the functions and uses of excipients in preparations, there are 65 types, namely pH regulators, chelating agents, clathrating agents, coating agents, protective agents, humectants, disintegrants, surfactants, virus inactivators, supplements, precipitants, film-forming materials, flavoring agents, excipients for freeze-drying, carbon dioxide adsorbents, foaming agents, fragrances, preservatives, excipients, desiccants, curing agents, buffers, sustained and controlled release materials, adhesives, flavor correctors, antioxidants, antioxidant synergists, anti-adhesives, air displacement agents, condensers, base materials for ointments, gel materials, polishing agents, propellants, solvents, softeners, emulsifiers, ointment bases, soft capsule materials, lubricants, wetting agents, penetration enhancers, osmotic pressure regulators, suppository bases, sweeteners, fillers, pill cores, stabilizers, adsorbents, absorbents, diluents, defoaming agents, flocculants, ethanol modifiers, plaster bases, inks, thickeners, solubilizers, plasticizers, binders, excipients for traditional Chinese medicine processing, filter aids, cosolvents, suspending agents, colorants.

[0009] Preferably, the pharmaceutically acceptable excipients include at least one of adjuvants, stabilizers or protective agents, bacteriostatic agents, excipients, cosolvents, flavor correctors, diluents, and buffers.

[0010] Adjuvant: A substance that is mixed with one or more components that bind to a vaccine antigen to enhance [such as strengthen, accelerate, prolong, and (or) possibly direct] its specific immune response and the clinical effect of the vaccine.

[0011] Stabilizer or protective agent: A substance used to stabilize or protect the active ingredients of biological products and prevent their degradation or loss of activity.

[0012] Bacteriostatic agent: A substance used to inhibit the growth of microorganisms and prevent microbial contamination.

[0013] Excipient: A substance used in freeze-dried products to shape the drug and serve as a scaffold.

[0014] Solubilizer: A substance used to increase the solubility of a drug.

[0015] Flavoring agent: A substance used to improve the taste of oral drugs.

[0016] Diluent, buffer: A solvent used to dissolve and dilute the product and adjust the pH of the product, such as water for injection, sodium chloride injection, phosphate buffered saline (PBS), etc.

[0017] Exemplary excipients include but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (monohydrate), calcium stearate, cross-linked carboxymethyl cellulose, cross-linked polyvinylpyrrolidone, citric acid, cross-linked povidone, cysteine, ethyl cellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methyl cellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, polyvinylpyrrolidone, pregelatinized starch, propylparaben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.

[0018] Furthermore, the drug may further include a combined drug, which is another drug that synergistically acts with Lactobacillus brevis ( Lactobacillus brevis ), ibiome003, including but not limited to other species of bacteria, such as: Lactobacillus paracasei ( Lacticaseibacillus paracasei ), Bifidobacterium bifidum ( Bifidobacterium bifidum ), Bifidobacterium longum subsp. infantis ( Bifidobacterium longum subsp. infantis ), Bifidobacterium animalis subsp. lactis ( Bifidobacterium animalis subsp. lactis ), Lactobacillus acidophilus ( Lactobacillus acidophilus ), Streptococcus thermophilus ( Streptococcus thermophilus ), Lactobacillus delbrueckii subsp. bulgaricus ( Lactobacillus delbrueckii subsp. bulgaricus ), Pediococcus acidilactici ( Pediococcus acidilactici ), Lactobacillus rhamnosus ( Lacticaseibacillus rhamnosus ), Lactobacillus plantarum ( Lactobacillus plantarum ), etc.; or other drug active ingredients, such as: wheat bran, magnesium sulfate, lactulose, polyethylene glycol, phenolphthalein tablets (laxative tablets), castor oil, senna leaf, glycerol, liquid paraffin, etc.

[0019] Preferably, the drug is any one of powder, granules, capsules, tablets, pills and suppositories.

[0020] Powder refers to a dry powder preparation made by crushing and uniformly mixing the raw material drug or suitable excipients.

[0021] Granules refer to dry granular preparations with a certain particle size made by mixing raw materials with suitable excipients.

[0022] Capsules refer to solid preparations made by filling raw materials or suitable excipients into hollow capsules or sealing them in soft capsule materials.

[0023] Tablets refer to round or irregular-shaped solid preparations made from raw materials or suitable excipients.

[0024] Pills refer to spherical or quasi-spherical solid preparations made from raw materials and suitable excipients.

[0025] Suppositories refer to solid preparations made from raw materials and suitable matrices for oral administration.

[0026] Formulations for oral use include tablets containing the active ingredient mixed with nontoxic pharmaceutically acceptable excipients. These excipients can be, for example, inert diluents or fillers (e.g., sucrose, sorbitol, sugar, mannitol, microcrystalline cellulose, starch including potato starch, calcium carbonate, sodium chloride, lactose, calcium phosphate, calcium sulfate or sodium phosphate); granulating agents and disintegrants (e.g., cellulose derivatives including microcrystalline cellulose, starch including potato starch, cross-linked carboxymethyl cellulose sodium, alginates or alginic acid); binders (e.g., sucrose, glucose, sorbitol, gum arabic, alginic acid, sodium alginate, gelatin, starch, pregelatinized starch, microcrystalline cellulose, magnesium aluminum silicate, sodium carboxymethyl cellulose, methylcellulose, hydroxypropyl methylcellulose, ethylcellulose, polyvinyl pyrrolidone or polyethylene glycol); and lubricants, glidants and anti-adherents (e.g., magnesium stearate, zinc stearate, stearic acid, silicon dioxide, hydrogenated vegetable oil or talc). Preparations for oral use may also be in the form of chewable tablets, or in the form of hard gelatin capsules in which the active ingredient is mixed with an inert solid diluent (e.g., potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate or kaolin), or in the form of soft gelatin capsules in which the active ingredient is mixed with water or an oil medium (e.g., peanut oil, liquid paraffin or olive oil). Powders, granules and pills can be prepared using the ingredients mentioned above under tablets or capsules in a conventional manner using, for example, a mixer, fluidized bed equipment or spray drying equipment.

[0027] Other pharmaceutically acceptable excipients for oral formulations include, but are not limited to, colorants, flavoring agents, plasticizers, humectants, and buffers. Formulations for oral use may also be in the form of chewable tablets, or in the form of hard gelatin capsules, wherein the active ingredient is mixed with an inert solid diluent (e.g., potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate, or kaolin), or in the form of soft gelatin capsules, wherein the active ingredient is mixed with water or an oil medium (e.g., peanut oil, liquid paraffin, or olive oil). Powders, granules, and pills may be prepared in a conventional manner using, for example, a mixer, a fluidized bed apparatus, or a spray drying apparatus using the ingredients mentioned above under tablets or capsules.

[0028] The dosage of the drug is not less than 1× 10 8 CFU.

[0029] The medication cycle is based on the ability to achieve the desired effect, including but not limited to 1-3 times a day, 3-7 days a week, etc., and is also related to the effective concentration of the specific preparation.

[0030] The present invention also protects Lactobacillus brevis ( Lactobacillus brevis ) Use of ibiome003 in the preparation of a fermentation agent, a functional bacterial agent or a nutritional composition for relieving constipation.

[0031] The fermentation composition or fermentation agent or functional bacterial agent comprises the aforementioned Lactobacillus brevis ( Lactobacillus brevis ) The bacterial liquid prepared by ibiome003, or the powder, capsule or granule obtained by further processing; the starter may further contain one or more non-antagonistic microbial agents, selected from Lactobacillus paracasei, Bifidobacterium bifidum, Bifidobacterium longum infantis subspecies, Bifidobacterium animalis lactis subspecies, Lactobacillus acidophilus, Streptococcus thermophilus, Lactobacillus delbrueckii subspecies bulgaricus, Pediococcus acidilactici, Lactobacillus rhamnosus, Lactobacillus plantarum, Lactobacillus acid-resistant, Lactobacillus bulgaricus, etc. to prepare a composite bacterial agent.

[0032] The effective bacterial concentration and viable bacterial count should not be less than 1× 10 8 CFU.

[0033] Fermentation agents or functional bacterial agents can also be used as functional foods and nutritional products.

[0034] Preferably, the nutritional composition is a food, a nutraceutical, a supplement, a probiotic or a commensal.

[0035] Wherein, the food includes ordinary food and special food.

[0036] The common food comprises the above-mentioned Lactobacillus brevis ( Lactobacillus brevisibiome003 and auxiliary substances for realizing food functions, presented in forms including but not limited to "dietary supplements", "fermented foods", etc., and can also be used synergistically with other foods for relieving constipation, such as: prunes, pitayas, pineapples, apples, kiwifruits, pears, coconuts, pomegranates, wild jujubes, celery, pumpkins, bamboo shoots, sweet potatoes, leeks, kelp, etc.

[0037] The dietary supplement includes the bacterial liquid prepared from the aforementioned Lactobacillus brevis ( Lactobacillus brevis ibiome003) or the powder obtained by further processing, and is further processed by adding nutrients such as cellulose, vitamins, and minerals.

[0038] The fermented foods include dairy products, soy products, or fruit and vegetable products, etc. The dairy products are milk, sour cream, or cheese, etc. The soy products are soy milk, tempeh, or miso, etc. The fruit and vegetable products are cucumber, carrot, beet, celery, or cabbage products, etc.

[0039] The special foods include health foods, foods for special medical purposes, and infant formula foods.

[0040] Health foods refer to foods that claim to have specific health functions or aim to supplement vitamins and minerals. It has the function of regulating the body, does not aim to treat diseases, and does not cause any acute, subacute, or chronic harm to the human body.

[0041] Foods for special medical purposes refer to formula foods specifically processed and prepared to meet the special needs of nutrients or diets for people with eating restrictions, impaired digestion and absorption, metabolic disorders, or specific disease states. Such foods include special medical purpose infant formula foods suitable for infants aged 0 to 12 months and special medical purpose formula foods suitable for people over 1 year old.

[0042] Infant formula foods include milk-based infant formula foods and soy-based infant formula foods. Most of the infant formula milk powders sold on the market belong to milk-based infant formula foods and are suitable for normal infants aged 0 - 36 months.

[0043] The probiotics refer to live microorganisms that are beneficial to the health of the host organism when provided in an appropriate amount.

[0044] The synbiotics refer to those foods containing a mixture of prebiotics and probiotics. They usually contain prebiotic components that are beneficial for growth and / or metabolic activity, and generally have probiotic effects in combination with, such as but not limited to, Lactobacillus brevis ( Lactobacillus brevis ibiome003 combined with fructooligosaccharide or galactooligosaccharide.

[0045] Furthermore, the use is to enhance intestinal motility and / or increase the water content of feces.

[0046] Compared with the prior art, the present invention has the following beneficial technical effects: 1. This strain of functional bacteria is isolated from healthy Chinese adults and has good safety. 2. This strain of functional bacteria has strong colonization ability in the intestines of mice. 3. This strain of functional bacteria does not affect the body weight change of mice and has certain biological safety. 4. This strain of functional bacteria can significantly enhance intestinal motility, increase the water content of feces, and relieve the constipation symptoms of mice.

[0047] Biomaterial sample preservation information: Lactobacillus brevis ( Lactobacillus brevis ) ibiome003 was deposited at the China Center for Type Culture Collection (CCTCC) on March 21, 2023. The address of the deposit center is the China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the deposit number is CCTCC No. M2023387. Brief Description of the Drawings

[0048] Figure 1 It is a single colony photo of Lactobacillus brevis in Example 2; Figure 2 It is the morphological observation of the colony of Lactobacillus brevis after Gram staining under 40X in Example 2; Figure 3 It is the detection of the colonization ability of Lactobacillus brevis in Example 3. The numbers marked between groups in the figure represent the P value; Figure 4 It is the effect of Lactobacillus brevis on the constipation phenotype of mice induced by LH in Example 4. Among them, 4A is the result of intestinal motility, 4B is the result of fecal water content, and the numbers marked between groups represent the P value; Figure 5 It is the effect of Lactobacillus brevis on the constipation phenotype of mice induced by CUMS in Example 5. Among them, 5A is the result of intestinal motility, 5B is the result of fecal water content, and the numbers marked between groups represent the P value; Figure 6 It is the effect of Lactobacillus brevis on the constipation phenotype of mice induced by AAD in Example 6. Among them, 6A is the result of intestinal motility, 6B is the result of fecal water content, and the numbers marked between groups represent the P value; Figure 7It is the graph of the change trend of the body weight of the mice in Example 7. The numbers marked between groups in the graph represent the P value. Embodiment

[0049] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below with reference to specific embodiments and the accompanying drawings.

[0050] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0051] Example 1: Isolation of Lactobacillus brevis Volunteer fecal samples (from the gifts of employees of Hefei Hanwei Biotechnology Co., Ltd.) were stored in 20% glycerol phosphate buffer and serially diluted to 10 -5 , 10 -6 , 10 -7 times. 100 μL of each concentration was spread on GAM broth (Solarbio LA4450) and MRS broth medium. Single colonies were picked into the corresponding liquid medium, and the genomic DNA of the strains was analyzed by measuring with 16sRNA universal primers (upstream primer sequence 27F: AGAGTTTG ATCCTGGCTCAG, downstream primer sequence 1492R: GGTTA CCTTGTTACGACTT); the amplification program was as follows: (1). 95 °C for 7 min; (2). 95 °C for 15 s; (3). 65 °C for 15 s; (4). 72 °C for 30 s; (5). GOTO step 2, 9x; (6). 95 °C for 15 s; (7). 55 °C for 15 s; (8). 72 °C for 30 s, (9). GOTO step 6, 32x; (10). 72 °C for 5 min; (11). 12 °C for 30 min. It was stored at -80 °C with glycerol.

[0052] The amplified product was sent for sequencing, and the 16s rRNA sequence was aligned by General Biosystems Co., Ltd. to determine the species. The sequence of one of the 16srRNA is shown in SEQ ID No. 1 and was submitted to the NCBI Basic Local Alignment Search Tool for the analysis of the 16s rRNA gene of the strain. The alignment results showed that the strain with the highest similarity to it is Levilactobacillus brevis ATCC 14869 (similarity 99.86%), so this strain belongs to Levilactobacillus brevis species, former name: Lactobacillus brevis ( Lactobacillus brevis)kind.

[0053] Example 2: Identification of Lactobacillus brevis 2.1 Single colony photos After culturing Lactobacillus brevis on MRS medium for 48 hours, take a photo. The photo of a single colony is as follows: Figure 1 As shown, the colonies are round, smooth, with neat edges, white in color and a moist surface.

[0054] 2.2 Smear microscopy The smear of Lactobacillus brevis was performed under a microscope at 40X and the results were as follows: Figure 2 As shown in the microscopic examination picture, it can be seen from the picture that Lactobacillus brevis is Gram-stain positive, has a short rod shape, and has no spores.

[0055] 2.3 Detection of biochemical reaction of sugar alcohol fermentation Take 300 μL of frozen Lactobacillus brevis to 1 mL of MRS medium to revive the strain, take the liquid cultured Lactobacillus brevis and purify it by streaking on MRS solid medium, pick a single colony and inoculate it in 1 mL of MRS liquid medium and culture it for 24 hours, then take the liquid cultured strain, dilute it by gradient, spread it on MRS solid medium and culture it for 72 hours. Then carry out the sugar alcohol fermentation biochemical reaction detection respectively.

[0056] Basic characteristics verification reaction of strains: detection of sugar alcohol fermentation biochemical reaction Use a sterilized pipette tip to pick up a single colony into a commercial bacterial biochemical test ampoule (purchased from Qingdao Haibo Biotechnology, see the table for the product number), inoculate and place it in 37°C for anaerobic culture for 48 hours, and judge the test results according to the kit instructions, as shown in Table 1: Table 1 Serial number Article number Name Test result (positive: +; negative: -) 1 GB007 Mannitol fermentation tube - 2 GB014 Salicin fermentation tube - 3 GB054 D-Ribose + 4 GB055 D-Arabinose - 5 GB056 Lactose - 6 GB057 Cellobiose - 7 GB060 Sorbitol - 8 GB062 Gluconate + 9 GB102-1 Trehalose - 10 GB104-1 Melibiose + 11 GB112 L-Rhamnose - 12 GB177 D-Mannose - 13 GB178 D-Maltose + 14 GB188 L-Arabinose + 15 GB193 D-Xylose + 16 GB195 D-Sucrose - 17 GB196 Esculin + 18 GB199 D-Glucose + 19 GB200 D-Galactose + 20 GB202 Amygdalin - 21 GB203 D-Fructose + The test results show that the tested strain is confirmed to be Lactobacillus brevis ( Lactobacillus brevis ).

[0057] The strain was named Lactobacillus brevis ( Lactobacillus brevis )ibiome003, deposited in China Type Culture Collection, the deposit address is: China Type Culture Collection of Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province; the deposit date is: March 21, 2023; the deposit number is: CCTCC No. M2023387.

[0058] Example 3: Colonization effect of Lactobacillus brevis in the mouse intestine Ten SPF-grade C57 / B6j male mice aged 6 - 8 weeks (purchased from Jicuiyaokang) were randomly divided into two groups. One group was the normal mice + normal saline group (5 mice), and the other group was the normal mice + Lactobacillus brevis group (5 mice). Lactobacillus brevis was cultured in MRS medium, centrifuged at 3000 rpm for 10 min, and resuspended in 1xPBS to an OD of 1.0 (600 nm). The mice in the Lactobacillus brevis group were given 200 μL of the Lactobacillus brevis suspension (10 7 CFU) by gavage, and the mice in the normal saline group were given 200 μL of normal saline. Gavage was performed once every two days for 2 weeks to detect the colonization ability of Lactobacillus brevis.

[0059] Specifically, mouse feces were collected in sterile Ep tubes, weighed, and the fecal mass was counted. DNA in the feces was extracted using organic solvents (20% SDS, phenol-chloroform, white grinding beads), and QPCR quantitative analysis of the load of this strain in mouse feces was performed using 16s rDNA primers (forward primer Levil-F AAACAACTGTGTATTCCCCA, reverse primer Levil-RCAACTAATAGGATCACCCCC; reference primers, forward primer 27F: AGAGTTTG ATCCTGGCTCAG, reverse primer 1492R: GGTTA CCTTGTTACGACTT, calculation formula POWER(2,-ΔC)*100%, where Ct target gene – Ct reference gene = ΔC). The results are as Figure 3 shown. This strain of Lactobacillus brevis has strong colonization ability in the mouse intestine, suggesting that it may help it better exert its function.

[0060] The QPCR program is as follows: (1). 95°C for 2 min; (2). 95°C for 5 s; (3). 60°C for 30 s; 4. GOTO step 2, 40x; (5). 95°C for 10 s; (6). 65°C for 5 s; (7). 95°C for 5 min.

[0061] Example 4: Lactobacillus brevis colonization relieves the slow transit constipation model induced by loperamide hydrochloride (LH) Twenty-four SPF-grade C57 / B6j male mice, 6-8 weeks old (purchased from Jicuiyaokang), were randomly divided into four groups: one group was normal mice + normal saline group (6 mice), one group was LH mice + normal saline group (6 mice), one group was normal mice + Lactobacillus brevis group (6 mice), and one group was LH mice + Lactobacillus brevis group (6 mice). After the mice adapted to the environment, starting from day 0, the normal mouse group was fed with ordinary mouse feed, and the LH mouse group was induced with a slow transit constipation model using loperamide hydrochloride: continuously gavaged with loperamide hydrochloride at a dose of 50 mg / kg for 7 days, and the gavage frequency was once a day. Through the experiments of measuring the time for steel beads to be excreted from the colon (inserting 3-mm steel beads into the colon through the anus and then measuring the excretion time of the steel beads) and the time for carmine dye to be excreted in feces (gavaging carmine dye and then observing the time for red feces to be excreted), it was detected that the mice in this model showed a significant prolongation of the time for steel beads to be excreted and the time for carmine dye to be excreted at one week, indicating that the mice had constipation symptoms with slowed intestinal motility.

[0062] After successful modeling, 200 μL of normal saline was given to the mice in the normal saline group by gavage, and 200 μL of Lactobacillus brevis suspension (10 8 CFU) was given to the mice in the Lactobacillus brevis group by gavage, with a gavage frequency of once a day for two weeks. After 2 weeks, the intestinal motility and fecal water content of the mice were detected, and the specific methods were as follows.

[0063] Carmine dye gavage experiment: The mice were fasted for 12 h before gavage. Each mouse was gavaged with 200 μL of carmine dye (6% carmine + 0.5% methylcellulose dissolved in sterile water), and then the mice were placed separately in clean cage boxes. Observe and record the time for the mice to excrete the first red feces. The longer the excretion time, the weaker the intestinal motility ability of the mice.

[0064] Fecal water content experiment: The mice were placed individually in cage boxes lined with absorbent paper, and the feces were collected and weighed as the wet weight. After freeze-drying, it was the dry weight. According to the formula: calculate the fecal water content. Fecal water content (%) = (fecal wet weight - fecal dry weight) / fecal wet weight. The fecal water content reflects the quality of the feces and the degree of constipation. The lower the water content, the more obvious the constipation symptoms.

[0065] The results are as Figure 4 shown. The experimental results show that the intestinal motility of the LH mouse group treated with Lactobacillus brevis was significantly enhanced, confirming that this functional bacterium can enhance the intestinal motility of mice; while there was no obvious change in the intestinal motility of the normal mouse group after gavaging with Lactobacillus brevis, indicating that Lactobacillus brevis does not affect the normal intestinal function of mice. At the same time, the fecal water content of the LH group of mice given Lactobacillus brevis was significantly higher than that of the normal saline group; while there was no obvious change in the fecal water content of normal mice after gavaging with Lactobacillus brevis, indicating that Lactobacillus brevis does not affect the normal intestinal function of mice.

[0066] Example 5: Lactobacillus brevis colonization relieves the constipation-like phenotype in mice caused by chronic unpredictable stress (CUMS) Twenty-eight 6- to 8-week-old SPF-grade male C57 / B6j mice (purchased from Jicuiyaokang) were randomly divided into four groups. One group was normal mice + normal saline group (7 mice), one group was CUMS mice + normal saline group (7 mice), one group was normal mice + Lactobacillus brevis group (7 mice), and one group was CUMS mice + Lactobacillus brevis group (7 mice). After adapting to the environment, starting from day 0, the CUMS mouse group received chronic, unpredictable mild stimuli within 4 weeks to simulate the chronic low-intensity stress experienced in human daily life. One type of stimulus was selected from daytime and nighttime each day to treat the mice, with a random order and no repetition, so that the mice could not predict the occurrence of the stimulus.

[0067] After successful modeling, 200 μL of normal saline was given to the mice in the normal saline group by gavage, and 200 μL of Lactobacillus brevis suspension (10 9 CFU) was given to the mice in the Lactobacillus brevis group by gavage. The gavage frequency was once a day for two weeks. After 2 weeks, the intestinal motility and fecal water content of the mice were detected, and the specific method was the same as that in Example 4.

[0068] The results are as Figure 5 shown. After CUMS modeling, the defecation time of the mice increased significantly (normal mice + normal saline group VS. CUMS mice + normal saline group, p <0.001), and the fecal water content decreased significantly (normal mice + normal saline group VS. CUMS mice + normal saline group, p <0.0001), proving that the constipation phenotype modeling was successful. After gavage with Lactobacillus brevis, the defecation time decreased significantly (CUMS mice + normal saline group VS. CUMS mice + Lactobacillus brevis group, p <0.001), and the fecal water content increased significantly (CUMS mice + normal saline group VS. CUMS mice + Lactobacillus brevis group, p <0.001), proving that the constipation phenotype was significantly alleviated; and there was no significant difference from the non-model group (normal mice + Lactobacillus brevis group VS. CUMS mice + Lactobacillus brevis group, p >0.05), proving that after gavage with Lactobacillus brevis, the mice had returned to the normal mouse state.

[0069] Example 6: Lactobacillus brevis colonization relieves the constipation-like phenotype in mice caused by amino acid diet (AAD) This AAD food-simulating deeply hydrolyzed milk powder does not contain macromolecular antigens. The protein components contained in the food are all hydrolyzed into amino acid forms, without changing the original protein ratio, and at the same time do not affect the forms and ratios of other nutritional elements. The specific formula is shown in Table 1.

[0070] Table 1 Comparison of the formulas of amino acid diet (AAD) and normal diet (NCD) *. Customized and purchased from Nantong Trofi Feed Technology Co., Ltd. The eighteen kinds of compound amino acids include: glycine, proline, arginine, histidine, lysine, tyrosine, tryptophan, phenylalanine, methionine, cystine, threonine, leucine, isoleucine, valine, glutamic acid, alanine, aspartic acid, serine; **. Purchased from Nantong Trofi Feed Technology Co., Ltd., feed code LAD 0020.

[0071] Twenty-four 6-week-old SPF C57 / B6j male mice (purchased from Jicuiyaokang) were randomly divided into 4 groups. One group was normal mice + normal saline group (6 mice), one group was AAD mice + normal saline group (6 mice), one group was normal mice + Lactobacillus brevis group (6 mice), and one group was AAD mice + Lactobacillus brevis group (6 mice). After adapting to the environment, starting from day 0, the AAD mice group and the normal mice group were fed the AAD diet and the normal diet shown in Table 1 respectively within 4 weeks.

[0072] After successful modeling, 200 μL of normal saline was given to the mice in the normal saline group by gavage, and 200 μL of Lactobacillus brevis suspension (10 9 CFU) was given to the mice in the Lactobacillus brevis group by gavage. The gavage frequency was once a day for two weeks. After 2 weeks, the intestinal peristalsis and fecal water content of the mice were detected. The specific method was the same as that in Example 4.

[0073] The results are as Figure 6 shown. After AAD modeling, the defecation time of the mice increased significantly (normal mice + normal saline group VS. AAD mice + normal saline group, p <0.0001), and the fecal water content decreased significantly (normal mice + normal saline group VS. AAD mice + normal saline group, p <0.0001), proving that the constipation phenotype modeling was successful. After gavage with Lactobacillus brevis, the defecation time decreased significantly (AAD mice + normal saline group VS. AAD mice + Lactobacillus brevis group, p <0.0001), and the fecal water content increased significantly (AAD mice + normal saline group VS. AAD mice + Lactobacillus brevis group, p <0.001), proving that the constipation phenotype was significantly alleviated; and there was no significant difference from the non-model group (normal mice + Lactobacillus brevis group VS. AAD mice + Lactobacillus brevis group, p >0.05), proving that after gavage with Lactobacillus brevis, the mice had returned to the normal mouse state.

[0074] Example 7: Effect of Lactobacillus brevis on the body weight of mice Twenty 6-8-week-old SPF-grade C57 / B6j male mice (purchased from Jicuiyaokang) were randomly divided into four groups: one group was normal mice + normal saline group (5 mice), one group was normal mice + Lactobacillus brevis group (5 mice), one group was CUMS mice + normal saline group (5 mice), and one group was CUMS mice + Lactobacillus brevis group (5 mice). After adapting to the environment, starting from day 0, the CUMS mouse group received chronic, unpredictable mild stimuli within 21 days to simulate the chronic low-intensity stress experienced in human daily life. One type of stimulus was selected from daytime and nighttime each day to treat the mice, with the order being random and non-repeating continuously, so that the mice could not predict the occurrence of the stimulus.

[0075] Lactobacillus brevis was cultured in MRS medium, centrifuged at 3000 rpm for 10 min, and resuspended in 1xPBS to an OD of 1.0 (600 nm). A 200 μL suspension of Lactobacillus brevis (10 7 CFU) was given to the mice in the Lactobacillus brevis group by gavage, and 200 μL of normal saline was given to the mice in the normal saline group. Gavage was performed once every two days for 2 weeks. Starting from the beginning of gavage with Lactobacillus brevis, the body weight data of the mice were recorded every day, and a body weight curve was plotted.

[0076] The results are as Figure 7 shown. There were no significant differences in the body weight changes of the four groups of mice, indicating that Lactobacillus brevis does not affect the body weight growth of mice and has good safety.

[0077] The specific embodiments described above further elaborate on the purpose, technical solutions, and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. Use of Lactobacillus brevis ( Lactobacillus brevis ) ibiome003 in the preparation of a medicament for treating, alleviating and preventing constipation It is characterized in that: The Lactobacillus brevis ( Lactobacillus brevis ) ibiome003 is deposited at the China Center for Type Culture Collection, located at the China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The deposit date is March 21, 2023, and the deposit number is CCTCC No. M2023387.

2. The use according to claim 1, It is characterized in that: The drug further comprises a pharmaceutically acceptable excipient.

3. The use according to claim 2, It is characterized in that: The pharmaceutically acceptable excipient includes at least one of adjuvant, stabilizer or protective agent, bacteriostatic agent, excipient, solubilizer, flavoring agent, diluent, buffer.

4. The use according to claim 1, It is characterized in that: The drug also includes a combined drug, which is another drug that Lactobacillus brevis acts synergistically with Lactobacillus brevis ibiome003.

5. The use according to claim 1, It is characterized in that: The drug is any one of powder, granule, capsule, tablet, pill, suppository.

6. Use of Lactobacillus brevis ( Lactobacillus brevis ) ibiome003 in the preparation of a fermenting agent, a functional bacterial agent or a nutritional composition for relieving constipation, It is characterized in that: The Lactobacillus brevis ( Lactobacillus brevis ) ibiome003 is deposited at the China Center for Type Culture Collection, located at the China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The deposit date is March 21, 2023, and the deposit number is CCTCC No. M2023387.

7. The use according to claim 6, It is characterized in that: The nutritional composition is food, nutritional product, supplement, probiotic or symbiotic bacterium.

8. The use according to claim 7, It is characterized in that: The food includes ordinary food and special food.

9. The use according to claim 8, It is characterized in that: The special food includes health food, foods for special medical purposes and infant formula foods.

10. The use according to any one of claims 1-9, It is characterized in that: The use is to enhance intestinal peristalsis and / or increase fecal water content.

Images