Recombinant microorganism for producing L-histidine and application thereof

By overexpressing relevant enzymes and transporters in E. coli, optimizing the transport of glucose and the supply of metabolic precursors, the problems of low efficiency and high cost of traditional L-histidine production methods are solved, and efficient and economical L-histidine production is achieved.

CN120137864APending Publication Date: 2025-06-13BEIJING KANSENBIO TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311712330.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-13
Publication Date
2025-06-13

AI Technical Summary

Technical Problem

Traditional L-histidine production methods rely on natural resources such as soybeans, are inefficient and costly, and are difficult to meet the growing market demand.

Method used

By overexpressing the galactose transporter galP and glucose kinase glk in E. coli, the ptsG gene expression is reduced and the transketolase tktA, tktB, transaldeolase talA and talB are overexpressed to enhance glucose transport and the supply of metabolic precursors and increase the fermentation yield of histidine.

Benefits of technology

It significantly improves the yield and yield of L-histidine, improves industrial production efficiency, and reduces production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004605130260000061
    Figure BDA0004605130260000061
  • Figure BDA0004605130260000062
    Figure BDA0004605130260000062
Patent Text Reader

Abstract

The invention relates to the technical field of biochemical engineering, and particularly discloses a recombinant microorganism for producing L-histidine and application of the recombinant microorganism. Compared with an original strain, the recombinant microorganism has the advantages that the expression of a ptsG gene is reduced while galactose transporter protein galP and glucokinase glk are overexpressed, and / or one or more of transketolase tktA, transketolase tktB, transaldolase talA or transaldolase talB are overexpressed, and the original strain is escherichia coli capable of producing histidine. The recombinant microorganism provided by the invention can improve the production efficiency of histidine and reduce the cost of industrial production of histidine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biochemistry, and specifically, to a recombinant microorganism for producing L-histidine and its application. Background Art

[0002] L-histidine is an important essential amino acid, and plays an important role in participating in protein formation, balancing intracellular pH, etc. due to its imidazole group. L-histidine is a precursor of histamine, and histamine, as a biogenic amine, has a certain protective effect on the nervous system. Therefore, L-histidine is widely used in industries such as medicine, feed, and food. The market demand for L-histidine is increasing day by day, and the traditional production method of L-histidine is protein hydrolysis method, and its extraction method depends on natural resources rich in protein such as soybeans. Therefore, it is urgent to research an efficient and economical production method of L-histidine to meet the growing market demand.

[0003] In Escherichia coli, L-histidine can be produced through ten-step reactions using glucose as a raw material and 5-phosphoribosyl 1-pyrophosphate (PRPP) and adenosine triphosphate (ATP) as precursors. In Escherichia coli, the uptake of glucose mainly occurs through the phosphotransferase system (PTS). Although the PTS transports glucose with high efficiency, this system consumes phosphoenolpyruvate (PEP). At the same time, when the transport of glucose is too fast, glucose will accumulate in the form of pyruvate, and then by-products such as acetic acid will be produced. Therefore, it is necessary to further study the method of producing histidine by biological fermentation. Summary of the Invention

[0004] One of the purposes of the present invention is to provide a recombinant microorganism that can improve the histidine yield and its application.

[0005] To achieve this purpose, the technical solution of the present invention is as follows:

[0006] A recombinant microorganism, compared with the starting strain, overexpresses the galactose transporter galP and glucokinase glk while reducing the expression of the ptsG gene, and / or overexpresses one or more of transketolase tktA, transketolase tktB, transaldolase talA, or transaldolase talB, and the starting strain is Escherichia coli capable of producing histidine.

[0007] The present invention has found through research that in Escherichia coli, when utilizing glucose, in addition to the PTS system, there is also a glucose transport system composed of galactose transporter (GalP) and glucokinase (Glk). This system does not consume PEP, but its expression level is weak. Therefore, in the present invention, while reducing the expression of the ptsG gene, the expression of the galP and glk genes in the glucose transport system is particularly enhanced to enhance the expression of this system, thereby achieving the effect of increasing the histidine fermentation yield. In addition, the present invention has also found through research that glucose-6-phosphate generates the PRPP precursor substance ribose-5-phosphate through the pentose phosphate pathway. Therefore, the expression of one or more of the key enzymes of the pentose phosphate pathway, transketolase (tkt) and transaldolase (tal), is particularly enhanced, thereby increasing the supply of metabolic precursors and further increasing the flux of the histidine production pathway.

[0008] Preferably, compared with the parental strain, the recombinant microorganism overexpresses transketolase tktB.

[0009] More preferably, compared with the parental strain, while reducing the expression of the ptsG gene, the recombinant microorganism overexpresses galactose transporter galP, glucokinase glk, transketolase tktA, transketolase tktB, transaldolase talA, and transaldolase talB. This method can increase the histidine yield even higher.

[0010] Compared with the parental strain, the recombinant microorganism of the present invention further overexpresses the gene fragment hisGDCBHAFI, and the nucleotide sequence of the gene fragment hisGDCBHAFI is as shown in SEQ ID NO.33.

[0011] The overexpression of the present invention can be achieved by one or more of the following methods (1) and (2):

[0012] (1) Increasing the copy number of the coding gene of the target enzyme / protein;

[0013] (2) Replacing the transcriptional or translational regulatory elements of the coding gene of the target enzyme / protein with regulatory elements having higher activity;

[0014] Preferably, the increase in the copy number of the coding gene of the target enzyme / protein is achieved by introducing a plasmid carrying the coding gene and / or integrating the coding gene into the genome;

[0015] The transcriptional or translational regulatory elements are selected from one or more of promoters, ribosome binding sites, and enhancers.

[0016] Further preferably, in the present invention, overexpression is achieved by replacing the original promoters of galactose transporter galP, glucokinase glk, transketolase tktA, transketolase tktB, transaldolase talA, and / or transaldolase talB with promoters having higher expression intensity. More preferably, the promoter having higher expression intensity is thePtrc promoter.

[0017] In the present invention, the NCBI accession number of the ptsG gene is 945651. The nucleotide sequence of the galactose transporter galP is shown as the bases at positions 58 - 1452 in SEQ ID NO.1. The nucleotide sequence of the glucokinase glk is shown as the bases at positions 58 - 1023 in SEQ ID NO.3. The nucleotide sequence of the transketolase tktA is shown as the bases at positions 58 - 2049 in SEQ ID NO.5. The nucleotide sequence of the transketolase tktB is shown as the bases at positions 58 - 2061 in SEQ ID NO.7. The nucleotide sequence of the transaldolase talA is shown as the bases at positions 58 - 1008 in SEQ ID NO.9. The nucleotide sequence of the transaldolase talB is shown as the bases at positions 58 - 1011 in SEQ ID NO.11.

[0018] The present invention also provides any one of the following applications of the above recombinant microorganism:

[0019] (1) Application in the fermentation production of L - histidine;

[0020] (2) Application in the modification of microorganisms for the production of L - histidine;

[0021] (3) Application in increasing the yield of L - histidine by biosynthesis.

[0022] The present invention further provides a method for the fermentation production of L - histidine, which includes the step of culturing the above recombinant microorganism.

[0023] The present invention further provides a method for constructing a recombinant microorganism for the production of L - histidine, which includes the steps of overexpressing the galactose transporter galP and glucokinase glk in the starting strain while reducing the expression of the ptsG gene, and / or overexpressing one or more of the transketolase tktA, transketolase tktB, transaldolase talA, or transaldolase talB, or further overexpressing the gene fragment hisGDCBHAFI.

[0024] The NCBI accession number of the ptsG gene is 945651. The nucleotide sequence of the galactose transporter galP is shown as the bases at positions 58 - 1452 in SEQ ID NO.1. The nucleotide sequence of the glucokinase glk is shown as the bases at positions 58 - 1023 in SEQ ID NO.3. The nucleotide sequence of the transketolase tktA is shown as the bases at positions 58 - 2049 in SEQ ID NO.5. The nucleotide sequence of the transketolase tktB is shown as the bases at positions 58 - 2061 in SEQ ID NO.7. The nucleotide sequence of the transaldolase talA is shown as the bases at positions 58 - 1008 in SEQ ID NO.9. The nucleotide sequence of the transaldolase talB is shown as the bases at positions 58 - 1011 in SEQ ID NO.11. The nucleotide sequence of the gene fragment hisGDCBHAFI is shown as SEQ ID NO.33.

[0025] As a specific embodiment, the modification method of the recombinant bacterium of the present invention includes: (1) replacing the original promoter of the galactose transporter galP with the Ptrc promoter in Escherichia coli, and replacing the original promoter of the glucokinase glk with the Ptrc promoter; (2) replacing the original promoter of the transketolase tktA with the Ptrc promoter in Escherichia coli, replacing the original sequence of the transketolase tktB with the Ptrc promoter, replacing the original promoter of the transaldolase talA with the Ptrc promoter, and replacing the original promoter of the transaldolase talB with the Ptrc promoter.

[0026] The beneficial effects of the present invention are at least as follows:

[0027] Without significantly affecting the growth performance of the bacteria, the present invention provides a recombinant microorganism that can significantly improve the yield and productivity of L - histidine. Using this recombinant microorganism for the production of histidine can improve the industrial production efficiency and reduce the production cost of histidine. Specific Embodiments

[0028] The preferred embodiments of the present invention will be described in detail below in conjunction with the examples. It should be understood that the following examples are given only for the purpose of illustration and are not used to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0029] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods. The materials, reagents, etc. used in the following examples can be obtained from commercial sources or prepared by conventional methods in the art unless otherwise specified.

[0030] Example 1: Replace the original promoters of galP and glk in Escherichia coli with thePtrc promoter

[0031] In this example, the key enzyme ptsG of the phosphotransferase system (PTS) ofEscherichia coli MG1655 ATCC 700926 was knocked out. At the same time, the originalpromoter of the galactose transporter galP (the sequence is shown as SEQ ID No. 2)was replaced with thePtrc promoter (the sequence is shown as the 1st to 57th bases of SEQ ID No. 1); the original promoter of the glucokinase glk (the sequence is shown as SEQID No. 4) was replaced with thePtrc promoter (the sequence is shown as the 1st to 57th bases of SEQ ID No. 3).

[0032] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers ptsG-UP-F (atcggttactggtggaaactgactcacc, SEQ ID No. 13) and ptsG-UP-R (ccccaacgtcttacggaaattgagagtgctcctgagtatggg, SEQ ID No. 14) to obtain a gene fragment ptsG-UP of approximately 500 bp and the PCR product was purified. Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers ptsG-DOWN-F (ggagcactctcaatttccgtaagacgttggggagactaag, SEQ ID No. 15) and ptsG-DOWN-R (gtggatgggacagtcagtaaaggggtgg, SEQ ID No. 16) to obtain a gene fragment ptsG-DOWN of approximately 500 bp and the PCR product was purified. The fragments ptsG-UP and ptsG-DOWN were subjected to overlap PCR to obtain the targeting fragment. Using plasmid pTarget (Jiang, Y., Chen, B., Duan, C. L., Sun, B. B., Yang, J. J., and Yang, S. (2015) Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol 81:2506-2514.) as a template, amplification was performed with primers ptsG-N20-F (catggttaaaaccatggccggttttagagctagaaatagcaagtta, SEQ ID No. 17) and ptsG-N20-R (cggccatggttttaaccatgactagtattatacctaggactgagctag, SEQ ID No. 18) to obtain pTarget-ptsG.The targeting fragment, plasmid pTarget-ptsG, and plasmid pCas9 (Jiang, Y., Chen, B., Duan, C. L., Sun, B. B., Yang, J. J., and Yang, S. (2015) Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol 81:2506-2514.) were electrotransformed into Escherichia coli MG1655 using an electroporator (Bio-Rad). The electroporation conditions were a voltage of 2.5 KV, a resistance of 200 Ω, and a capacitance of 25 μF (the width of the electroporation cuvette was 2 mm). The recombinant strain was screened and named E. coil-ΔptsG.

[0033] Using the genome of Escherichia coli MG1655 as a template and primers galP-UP-F (tcgttgtgaaattcaggtttcctacgca, SEQ ID No. 19) and galP-UP-R (tgtgaaattccacacattatacgagccggatgattaattgtcaatgtaacaactgtgaaaaccgaat, SEQ ID No. 20), PCR was performed to obtain a gene fragment galP-UP of approximately 500 bp, and the PCR product was purified.

[0034] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers galP-DOWN-F (tcgtataatgtgtggaatttcacacaggaaacagaccatgcctgacgctaaaaaacaggg, SEQ ID No. 21) and galP-DOWN-R (gtgtagctgaaggcggtatcagaaagata, SEQ ID No. 22) to obtain a gene fragment galP-DOWN of approximately 500 bp, and the PCR product was purified. The fragments galP-UP and galP-DOWN were subjected to overlapping PCR to obtain a targeting fragment. Using plasmid pTarget as a template, PCR was performed with primers galP-N20-F (gaacagcaacttccgccgcggttttagagctagaaatagcaagtta, SEQ ID No. 23) and galP-N20-R (cgcggcggaagttgctgttcactagtattatacctaggactgagctag, SEQ ID No. 24) to obtain pTarget-galP. The targeting fragment, plasmid pTarget-galP, and plasmid pCas9 were electrotransformed into Escherichia coli E.coil-△ptsG using an electroporator (Bio-Rad). The electroporation conditions were a voltage of 2.5 KV, a resistance of 200 Ω, and a capacitance of 25 μF (the width of the electroporation cuvette was 2 mm). The recombinant bacterium was screened and named E.coil-△ptsG-Ptrc-galP. The key feature of this recombinant bacterium is the upregulation of the expression of the galP gene and contains the sequence shown in SEQ ID No. 1 (the tandem sequence of the Ptrc promoter and the galP gene).

[0035] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers glk-UP-F (cgccgcaacaggagtgccaaacagtg, SEQ ID No. 25) and glk-UP-R (tgtgaaattccacacattatacgagccggatgattaattgtcaaacatgctccatccgcgagccaga, SEQ ID No. 26) to obtain a gene fragment glk-UP of approximately 500 bp, and the PCR product was purified.

[0036] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers glk-DOWN-F (tcgtataatgtgtggaatttcacacaggaaacagaccatgacaaagtatgcattagtcgg, SEQ ID No. 27) and glk-DOWN-R (ctattcggcgcaaaatcaacgtgaccgcctt, SEQ ID No. 28) to obtain a gene fragment glk-DOWN of approximately 500 bp and the PCR product was purified. The fragments glk-UP and glk-DOWN were subjected to overlap PCR to obtain the targeting fragment. Using plasmid pTarget as a template, PCR was performed with primers glk-N20-F (tttctcacactgtaaataccgttttagagctagaaatagcaagtta, SEQ ID No. 29) and glk-N20-R (ggtatttacagtgtgagaaaactagtattatacctaggactgagctag, SEQ ID No. 30) to obtain pTarget-glk. The targeting fragment, plasmid pTarget-glk and plasmid pCas9 were electrotransformed into Escherichia coli E.coil-△ptsG-Ptrc-galP using an electroporator (Bio-Rad). The electroporation conditions were a voltage of 2.5 KV, a resistance of 200 Ω, and a capacitance of 25 μF (the width of the electroporation cuvette was 2 mm). The recombinant bacterium was screened and named E.coil-△ptsG-Ptrc-galP-glk. The key feature of this recombinant bacterium is the upregulation of the expression of galP and glk genes and it contains the sequences shown in SEQ ID No. 1 and SEQ ID No. 3 (the tandem sequence of the Ptrc promoter and the glk gene).

[0037] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers hisG-F (gaattcgagctcatgttgaaaatcgctgtcccaaacaaaggctcg, SEQ ID No. 31) and hisI-R (ctctagaggatcctcactgatgccgtttacgcaggttctcaattaccgtcgtt, SEQ ID No. 32) to obtain the gene fragment hisGDCBHAFI (SEQ ID No. 33). This fragment was ligated to the vector pTrc99a through the restriction enzyme sites SacI and BamHI, and the resulting recombinant plasmid was named pTrc99a-hisGDCBHAFI. The recombinant plasmid pTrc99a-hisGDCBHAFI was transformed into MG1655 and E.coil-△ptsG-Ptrc-galP-glk by electroporation (conditions as above), and the resulting recombinant strains were named E.coil MG1655 / pTrc99a-hisGDCBHAFI and E.coil-△ptsG-Ptrc-galP-glk / pTrc99a-hisGDCBHAFI.

[0038] Example 2 Replacement of the original promoters of Escherichia coli tktA, tktB, talA, and talB with the Ptrc promoter

[0039] In this example, the original promoter sequences of tktA, tktB, talA, and talB in Escherichia coli MG1655 ATCC 700926 and E.coil-△ptsG-Ptrc-galP-glk (sequences shown in SEQ ID No. 6, 8, 10, and 12 respectively) were replaced with the Ptrc promoter (the first 57 bases of the sequences shown in SEQ ID No. 5, 7, 9, and 11).

[0040] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers tktA-UP-F (tttcacatggcctaacgccacgtgc, SEQ ID No. 34) and tktA-UP-R (tgtgaaattccacacattatacgagccggatgattaattgtcaaatactgagactgagcgtcgattc, SEQ ID No. 35) to obtain a gene fragment tktA-UP of approximately 500 bp and the PCR product was purified.

[0041] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers tktA-DOWN-F (tcgtataatgtgtggaatttcacacaggaaacagaccatgtcctcacgtaaagagcttgc, SEQ ID No. 36) and tktA-DOWN-R (caaacttcgtgggagatgccttccatcat, SEQ ID No. 37) to obtain a gene fragment tktA-DOWN of approximately 500 bp, and the PCR product was purified. The fragments tktA-UP and tktA-DOWN were subjected to overlap PCR to obtain a targeting fragment. Using plasmid pTarget as a template, PCR was performed with primers tktA-N20-F (actccagatcggatgatgaagttttagagctagaaatagcaagttaa, SEQ ID No. 38) and tktA-N20-R (ttcatcatccgatctggagtactagtattatacctaggactgagctag, SEQ ID No. 39) to obtain pTarget-tktA. The targeting fragment, plasmid pTarget-tktA, and plasmid pCas9 were electrotransformed into Escherichia coli MG1655 and E.coil-△ptsG-Ptrc-galP-glk using an electroporator (Bio-Rad). The electroporation conditions were a voltage of 2.5 KV, a resistance of 200 Ω, and a capacitance of 25 μF (the width of the electroporation cuvette was 2 mm). Recombinant bacteria were screened and named E.coil-Ptrc-tktA and E.coil-△ptsG-Ptrc-galP-glk-tktA. The key feature of this recombinant bacterium is the upregulation of the expression of the tktA gene and contains the sequence shown in SEQ ID No. 5 (the tandem sequence of the Ptrc promoter and the tktA gene).

[0042] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers tktB-UP-F (actgcaacctgacgctgctgttttcttttg, SEQ ID No. 40) and tktB-UP-R (tgtgaaattccacacattatacgagccggatgattaattgtcaattatagtttggcggcaagaagat, SEQ ID No. 41) to obtain a gene fragment tktB-UP of approximately 500 bp, and the PCR product was purified.

[0043] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers tktB-DOWN-F (tcgtataatgtgtggaatttcacacaggaaacagaccatgtcccgaaaagaccttgccaatg, SEQ ID No. 42) and tktB-DOWN-R (gaacagacttcgtgggaaatacctt, SEQ ID No. 43) to obtain a gene fragment tktB-DOWN of approximately 500 bp, and the PCR product was purified. The fragments tktB-UP and tktB-DOWN were subjected to overlap PCR to obtain a targeting fragment. Using plasmid pTarget as a template, PCR was performed with primers tktB-N20-F (gccaaactataaaccagccagttttagagctagaaatagcaagtta, SEQ ID No. 44) and tktB-N20-R (tggctggtttatagtttggcactagtattatacctaggactgagctag, SEQ ID No. 45) to obtain pTarget-tktB. The targeting fragment, plasmid pTarget-tktB, and plasmid pCas9 were electrotransformed into Escherichia coli MG1655 and E.coil-△ptsG-Ptrc-galP-glk-tktA using an electroporator (Bio-Rad). The electroporation conditions were a voltage of 2.5 KV, a resistance of 200 Ω, and a capacitance of 25 μF (the width of the electroporation cuvette was 2 mm). Recombinant bacteria were screened and named E.coil-Ptrc-tktB and E.coil-△ptsG-Ptrc-galP-glk-tktA(B). The key feature of this recombinant bacterium is the upregulation of the expression of the tktB gene, and it contains the sequence shown in SEQ ID No. 7 (the tandem sequence of the Ptrc promoter and the tktB gene).

[0044] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers talA-UP-F (tgtcttcgaggttgatgccgccgaagg, SEQ ID No. 46) and talA-UP-R (tgtgaaattccacacattatacgagccggatgattaattgtcaacggcagggtaataatgtgcgcca, SEQ ID No. 47) to obtain a gene fragment talA-UP of approximately 500 bp, and the PCR product was purified.

[0045] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers talA-DOWN-F (tcgtataatgtgtggaatttcacacaggaaacagaccatgaacgagttagacggcatcaa, SEQ ID No.48) and talA-DOWN-R (gcacaggcccgtgcctgtgcaaaagaaaac, SEQ ID No.49) to obtain a gene fragment talA-DOWN of approximately 500 bp and the PCR product was purified. The fragments talA-UP and talA-DOWN were subjected to overlap PCR to obtain the targeting fragment. Using plasmid pTarget as a template, PCR was performed with primers talA-N20-F (atctaacactttacttttcagttttagagctagaaatagcaagtta, SEQ ID No.50) and talA-N20-R (tgaaaagtaaagtgttagatactagtattatacctaggactgagctag, SEQ ID No.51) to obtain pTarget-talA. The targeting fragment, plasmid pTarget-talA, and plasmid pCas9 were electrotransformed into Escherichia coli MG1655 and E.coil-△ptsG-Ptrc-galP-glk-tktA(B) using an electroporator (Bio-Rad). The electroporation conditions were a voltage of 2.5 KV, a resistance of 200 Ω, and a capacitance of 25 μF (the width of the electroporation cuvette was 2 mm). Recombinant bacteria were screened and named E.coil-Ptrc-talA and E.coil-△ptsG-Ptrc-galP-glk-tktA(B)-talA. The key feature of this recombinant bacterium is the upregulation of the expression of the talA gene and it contains the sequence shown in SEQ ID No.9 (the tandem sequence of the Ptrc promoter and the talA gene).

[0046] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers talB-UP-F (cagcgcatccccagcccgcgcgcc, SEQ ID No.52) and talB-UP-R (tgtgaaattccacacattatacgagccggatgattaattgtcaacgtagcgtatatacttcttaaac, SEQ ID No.53) to obtain a gene fragment talB-UP of approximately 500 bp and the PCR product was purified.

[0047] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers talB-DOWN-F (tcgtataatgtgtggaatttcacacaggaaacagaccatgacggacaaattgacctccct, SEQ ID No.54) and talB-DOWN-R (caagcacgagcctgagcgaaggaga, SEQ ID No.55) to obtain a gene fragment talB-DOWN of approximately 500 bp and purify the PCR product. The fragments talB-UP and talB-DOWN were subjected to overlap PCR to obtain the targeting fragment. Using plasmid pTarget as a template, amplification was performed with primers talB-N20-F (gtgatatcatcagggcagacgttttagagctagaaatagcaagttaa, SEQ ID No.56) and talB-N20-R (gtctgccctgatgatatcacactagtattatacctaggactgagctag, SEQ ID No.57) to obtain pTarget-talB. The targeting fragment, plasmid pTarget-talB, and plasmid pCas9 were electrotransformed into Escherichia coli MG1655 and E.coil-△ptsG-Ptrc-galP-glk-tktA(B)-talA using an electroporator (Bio-Rad). The electroporation conditions were a voltage of 2.5 KV, a resistance of 200 Ω, and a capacitance of 25 μF (the width of the electroporation cuvette was 2 mm). Recombinant bacteria were screened and named E.coil-Ptrc-talB and E.coil-△ptsG-Ptrc-galP-glk-tktA(B)-talA(B). The key feature of this recombinant bacterium is the upregulation of the expression of the talB gene, which contains the sequence shown in SEQ ID No.11 (the tandem sequence of the Ptrc promoter and the talB gene).

[0048] The plasmid pTrc99a-hisGDCBHAFI was introduced into E.coil-Ptrc-tktA, E.coil-Ptrc-tktB, E.coil-Ptrc-talA, E.coil-Ptrc-talB, E.coil-△ptsG-Ptrc-galP-glk-tktA(B)-talA(B) by electroporation (conditions as in Example 1), and the obtained recombinant strains were named E.coil-Ptrc-tktA / pTrc99a-hisGDCBHAFI, E.coil-Ptrc-tktB / pTrc99a-hisGDCBHAFI, E.coil-Ptrc-talA / pTrc99a-hisGDCBHAFI, E.coil-Ptrc-talB / pTrc99a-hisGDCBHAFI, E.coil-△ptsG-Ptrc-galP-glk-tktA(B)-talA(B) / pTrc99a-hisGDCBHAFI.

[0049] Example 3 Fermentation culture of recombinant Escherichia coli for the production of L-histidine

[0050] The recombinant strains E.coil MG1655 / pTrc99a-hisGDCBHAFI, E.coil-△ptsG-Ptrc-galP-glk / pTrc99a-hisGDCBHAFI, E.coil-Ptrc-tktA / pTrc99a-hisGDCBHAFI, E.coil-Ptrc-tktB / pTrc99a-hisGDCBHAFI, E.coil-Ptrc-talA / pTrc99a-hisGDCBHAFI, E.coil-Ptrc-talB / pTrc99a-hisGDCBHAFI, E.coil-△ptsG-Ptrc-galP-glk-tktA(B)-talA(B) / pTrc99a-hisGDCBHAFI were cultured overnight on an LB plate. A single colony was inoculated from this fresh plate into a test tube containing 5 ml of LB medium and cultured at 37 °C and 200 rpm for 12 hours.

[0051] Inoculate into a 500 ml baffled shake flask containing 50 ml of fermentation medium at an inoculation amount of 5%, and culture at 37 °C and 200 rpm until the OD600 reaches 0.6, then add 0.1 mM IPTG and co-culture for 48 h.

[0052] The fermentation medium formulation includes (g / L): glucose 20 g, magnesium sulfate heptahydrate 0.8 g, diammonium hydrogen phosphate 4 g, potassium dihydrogen phosphate 6.67 g, potassium citrate 1.35 g, 3-morpholinopropanesulfonic acid 20.9 g, yeast powder 2.5 g, ferrous sulfate heptahydrate 50 mg, calcium chloride dihydrate 10 mg, zinc sulfate heptahydrate 11 mg, manganese sulfate tetrahydrate 2.5 mg, copper sulfate pentahydrate 5 mg, ammonium molybdate 0.5 mg, sodium borate decahydrate 0.1 mg.

[0053] During the fermentation process, the product concentration and the growth of the strain were detected by liquid chromatography, and the results are shown in Table 1 and Table 2. As can be seen from Table 1 and Table 2, after introducing Ptrc-galP-glk, Ptrc-tktA, Ptrc-tktB, Ptrc-talA, and Ptrc-talB respectively, compared with the control strain E.coilMG1655 / pTrc99a-hisGDCBHAFI, the yield and production efficiency of L-histidine of the strains E.coil-△ptsG-Ptrc-galP-glk / pTrc99a-hisGDCBHAFI, E.coil-Ptrc-tktA / pTrc99a-hisGDCBHAFI, E.coil-Ptrc-tktB / pTrc99a-hisGDCBHAFI, E.coil-Ptrc-talA / pTrc99a-hisGDCBHAFI, and E.coil-Ptrc-talB / pTrc99a-hisGDCBHAFI were improved without affecting the cells. On the basis of introducing Ptrc-galP-glk, after introducing Ptrc-tktA(B)-talA(B), the yield and production efficiency of L-histidine of the strain E.coil-△ptsG-Ptrc-galP-glk-tktA(B)-talA(B) / pTrc99a-hisGDCBHAFI were further improved.

[0054] Table 1 Growth of different strains (OD600)

[0055]

[0056] Table 2 L-histidine yield of different strains (g / L)

[0057]

[0058] Although the present invention has been described in detail above with general descriptions and specific embodiments, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection required by the present invention.

Claims

1. A recombinant microorganism, characterized in that, compared with the starting strain, the recombinant microorganism overexpresses the galactose transporter galP and glucokinase glk while reducing the expression of the ptsG gene, and / or overexpresses one or more of transketolase tktA, transketolase tktB, transaldolase talA or transaldolase talB, and the starting strain is Escherichia coli capable of producing histidine.

2. The recombinant microorganism according to claim 1, characterized in that, compared with the starting strain, the recombinant microorganism overexpresses transketolase tktB.

3. The recombinant microorganism according to claim 1, characterized in that, compared with the starting strain, while reducing the expression of the ptsG gene, the recombinant microorganism overexpresses the galactose transporter galP, glucokinase glk, transketolase tktA, transketolase tktB, transaldolase talA and transaldolase talB.

4. The recombinant microorganism according to any one of claims 1-3, characterized in that, compared with the starting strain, the recombinant microorganism further overexpresses the gene fragment hisGDCBHAFI, and the nucleotide sequence of the gene fragment hisGDCBHAFI is as shown in SEQ ID NO.

33.

5. The recombinant microorganism according to any one of claims 1-4, characterized in that, overexpression is achieved by replacing the original promoter of galactose transporter galP, glucokinase glk, transketolase tktA, transketolase tktB, transaldolase talA and / or transaldolase talB with a promoter with higher expression intensity.

6. The recombinant microorganism according to claim 5, characterized in that, the promoter with higher expression intensity is the Ptrc promoter.

7. The recombinant microorganism according to any one of claims 1-6, characterized in that, the NCBI accession number of the ptsG gene is 945651, the nucleotide sequence of the galactose transporter galP is as shown by the bases at positions 58-1452 in SEQ ID NO.1, the nucleotide sequence of glucokinase glk is as shown by the bases at positions 58-1023 in SEQ ID NO.3, the nucleotide sequence of transketolase tktA is as shown by the bases at positions 58-2049 in SEQ ID NO.5, the nucleotide sequence of transketolase tktB is as shown by the bases at positions 58-2061 in SEQ ID NO.7, the nucleotide sequence of transaldolase talA is as shown by the bases at positions 58-1008 in SEQ ID NO.9, and the nucleotide sequence of transaldolase talB is as shown by the bases at positions 58-1011 in SEQ ID NO.

11.

8. Any one of the following applications of the recombinant microorganism according to any one of claims 1-7: (1) Application in fermentative production of L-histidine; (2) Application in microbial transformation for producing L-histidine; (3) Application in increasing the yield of L-histidine by biosynthesis.

9. A method for fermentative production of L-histidine, characterized in that, Comprising the step of culturing the recombinant microorganism according to any one of claims 1-7.

10. A method for constructing a recombinant microorganism for producing L-histidine, characterized in that it comprises the steps of overexpressing galactose transporter galP and glucokinase glk in a starting strain while reducing the expression of the ptsG gene, and / or overexpressing one or more of transketolase tktA, transketolase tktB, transaldolase talA or transaldolase talB, or further overexpressing the gene fragment hisGDCBHAFI; the NCBI accession number of the ptsG gene is 945651, the nucleotide sequence of galactose transporter galP is shown as the bases at positions 58-1452 in SEQ ID NO.1, the nucleotide sequence of glucokinase glk is shown as the bases at positions 58-1023 in SEQ ID NO.3, the nucleotide sequence of transketolase tktA is shown as the bases at positions 58-2049 in SEQ ID NO.5, the nucleotide sequence of transketolase tktB is shown as the bases at positions 58-2061 in SEQ ID NO.7, the nucleotide sequence of transaldolase talA is shown as the bases at positions 58-1008 in SEQ ID NO.9, the nucleotide sequence of transaldolase talB is shown as the bases at positions 58-1011 in SEQ ID NO.11, and the nucleotide sequence of the gene fragment hisGDCBHAFI is shown as SEQ ID NO.33.