Genetically engineered bacterium for producing lactose-N-disaccharide as well as preparation method and application of genetically engineered bacterium

Abstract

The invention belongs to the field of genetic engineering and synthetic biology, and particularly relates to a genetically engineered bacterium for producing lactose-N-disaccharide as well as a preparation method and application of the genetically engineered bacterium. According to the invention, modified probiotic Escherichia coli Nissle1917 is used as an initial strain, galK and lnbP genes are over-expressed in the initial strain, a genetically engineered bacterium is constructed, and LNB can be efficiently catalyzed and synthesized; furthermore, nagB, nagA, manX, nagE and nagK genes and / or galT genes are knocked out from the genome of the initial strain, a recombinant expression vector containing glmS and gna1 genes is constructed, a recombinant expression vector containing galK, lnbP, lacY and lacZ genes is constructed to convert the initial strain, and the strain capable of endophytic N-acetyl glucosamine (GlcNAc) so as to efficiently synthesize the LNB is obtained. The method is simple to operate, high in fermentation yield and free of influence of risk factors such as endotoxin, and a new method and a new thought are provided for efficient, low-cost and safe industrial production of the LNB.

Description

Technical Field

[0001] The present invention belongs to the fields of genetic engineering and synthetic biology. Specifically, the present invention relates to a genetically engineered bacterium for producing lacto-N-biose, a preparation method thereof, and an application thereof. Background Art

[0002] Lacto-N-biose (LNB) is a natural oligosaccharide present in human milk and belongs to one of the human milk oligosaccharides (HMOs). LNB is a disaccharide molecule formed by linking lactose and N-acetylglucosamine through β-1,3-glycosidic bonds or β-1,4-glycosidic bonds and has good biofunctional activities. In the intestinal health of infants, LNB plays an important role, helps the growth of probiotics (Bifidobacterium), and at the same time inhibits the reproduction of harmful pathogenic bacteria, thereby enhancing the immune function and improving the intestinal microecological balance. In addition to its important role in the intestinal health of infants, LNB also has other potential biological activities and application values. Recent studies have found that LNB plays an important role in immune regulation in the intestine, helps to regulate the balance of the immune system, and reduces the risk of allergic reactions and autoimmune diseases.

[0003] Despite the obvious importance of LNB, its production still faces challenges. Since LNB mainly exists in breast milk, it cannot meet the needs of large-scale industrial production. At present, the production of lacto-N-biose (LNB) is mainly carried out through three routes: chemical synthesis, enzymatic synthesis, and microbial fermentation. Chemical synthesis involves protecting the hydroxyl groups of lactose and using a catalyst to react lactose with glucosamine to produce lacto-N-biose. This method has complex steps, prominent environmental protection problems, poor selectivity, generates more by-products, and the process is complex and costly, making it unsuitable for large-scale production; enzymatic synthesis uses enzymatic catalytic reactions, which are mild and environmentally friendly, but faces technical bottlenecks such as high enzyme prices, poor stability, and difficult optimization of reaction conditions. In recent years, with the development of synthetic biology, de novo synthesis by microorganisms has become an important strategy for LNB production. It is to genetically engineer microorganisms to express related enzyme systems and produce LNB during the fermentation process. However, the current engineered strains have problems such as poor stability, low yield, and easy production of endotoxins, and it is necessary to optimize the chassis bacteria to achieve industrial production. Therefore, it is particularly important to develop a food-safe, economical, and efficient LNB biosynthesis strain and synthesis method. Summary of the Invention

[0004] Constructing a safe and high-yield probiotic genetically engineered bacterium for LNB has become one of the problems that need to be solved urgently at present. To solve the above technical problems, the present invention provides a genetically engineered bacterium for efficiently producing Lacto-N-biose (LNB), a preparation method thereof and an application thereof, realizing the efficient production of LNB and avoiding the production of endotoxin, laying a foundation for the efficient, low-cost and safe industrial production of LNB.

[0005] To achieve this purpose, the present invention adopts the following technical solutions:

[0006] In the present invention, both "Lacto-N-biose" and "LNB" refer to "lactose-N-biosaccharide", which is a molecule formed by lactose and N-acetylglucosamine linked by β-1,3-glycosidic bond or β-1,4-glycosidic bond.

[0007] In the first aspect of the present invention, the present invention provides a genetically engineered bacterium for producing lactose-N-biosaccharide. The genetically engineered bacterium contains an expression vector, and the expression vector contains a galactokinase gene (galK) and a lacto-N-biose phosphorylase gene lnbP. The genetically engineered bacterium can overexpress galactokinase and lacto-N-biose phosphorylase by using the expression vector.

[0008] Preferably, the genetically engineered bacterium also overexpresses a lactose permease gene lacY and / or a β-galactosidase gene lacZ. Such a genetically engineered bacterium can be fermented and cultured in a medium containing lactose, galactose, glucose and N-acetylglucosamine (GlcNAc) to catalytically produce LNB. Overexpressing lacY and lacZ can strengthen the utilization of substrates by the genetically engineered bacterium.

[0009] In the second aspect of the present invention, the present invention provides a genetically engineered bacterium for producing lactose-N-biosaccharide. The genetically engineered bacterium contains an expression vector I and an expression vector II. The expression vector I contains a glucosamine synthase gene glmS and a glucosamine acetylase gene gna1, and the expression vector II contains a galactokinase gene (galK) and a lacto-N-biose phosphorylase gene lnbP. In some cases, the genetically engineered bacterium contains only one expression vector, and four genes, glmS, gna1, galK, and lnbP, are integrated on the expression vector.

[0010] At this time, the genetically engineered bacterium for producing lactose-N-biosaccharide not only enhances the expression of galactokinase and lacto-N-biose phosphorylase, the enzymes related to LNB production, but also enhances the expression of glucosamine synthase and glucosamine acetylase, the synthetic enzymes related to N-acetylglucosamine (GlcNAc). Therefore, the genetically engineered bacterium for producing LNB of the present invention can use the N-acetylglucosamine endogenous to the engineered bacterium as a substrate to produce LNB, without relying on the N-acetylglucosamine (GlcNAc) added to the culture medium. This endogenous method is more cost-effective than the method of adding N-acetylglucosamine (GlcNAc).

[0011] In one embodiment of the present invention, the expression vector II further contains the lactose permease gene lacY and / or the β-galactosidase gene lacZ. By enhancing the lactose permease and β-galactosidase, lactose in the fermentation medium of the genetically engineered bacterium can be promoted to enter the cells and hydrolyzed into galactose and glucose, improving the substrate utilization efficiency of the engineered bacterium. In some cases, the lactose permease gene lacY and / or the β-galactosidase gene lacZ can also be tandemly arranged on the expression vector I. However, those skilled in the art should understand that overexpression of lacY and lacZ by the vector in the engineered bacterium is not necessary for the production of LNB.

[0012] In one embodiment of the present invention, the galactokinase gene galK is from Escherichia coli, and its sequence is as shown in SEQ ID NO.1.

[0013] In one embodiment of the present invention, the lacto-N-biose phosphorylase gene lnbP is from any one of Bifidobacterium bifidum, Bifidobacterium longum, and Bifidobacterium castoris. Preferably, the lnbP is from Bifidobacterium castoris, and its nucleotide sequence is as shown in SEQ ID NO.2.

[0014] In one embodiment of the present invention, the lactose permease gene lacY is from Escherichia coli K12 MG1655, and its nucleotide sequence is as shown in SEQ ID NO.3.

[0015] In one embodiment of the present invention, the β-galactosidase gene lacZ is from Escherichia coli K12 MG1655, and its nucleotide sequence is as shown in SEQ ID NO.4.

[0016] In one embodiment of the present invention, the source of the glucosamine synthase gene glmS includes any one of Escherichia coli K-12 MG1655, Bacillus subtilis, or Corynebacterium glutamicum; preferably, the glmS gene is derived from Escherichia coli K-12 MG1655, and its nucleotide sequence is as shown in SEQ ID NO.16.

[0017] In one embodiment of the present invention, the source of the glucosamine acetylase gene gna1 includes any one of Saccharomyces cerevisiae and Caenorhabditis elegans; when the gna1 gene is derived from Saccharomyces cerevisiae, it can be optimized with Escherichia coli codons to adapt to gene expression using Escherichia coli as a host. Preferably, the gna1 gene of the present invention is derived from Saccharomyces cerevisiae and optimized with Escherichia coli codons, and its nucleotide sequence is as shown in SEQ ID NO.17.

[0018] In the present invention, as the initial bacterium of the genetically engineered bacterium, which is also called the chassis bacterium or chassis cell, strains commonly used in the art for the expression of target proteins / enzymes / macromolecules can be used. In one embodiment of the present invention, the initial bacterium can be Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, or yeast; preferably, the initial bacterium is Escherichia coli BL21(DE3) or probiotic Escherichia coli Nissle 1917.

[0019] In one embodiment of the present invention, probiotic Escherichia coli Nissle 1917 is selected as the initial bacterium of the genetically engineered bacterium. As a probiotic Escherichia coli, Nissle 1917 does not contain pathogenic factors such as enterotoxin, hemolysin, and cytotoxin, and has no safety risk to the human body. Using it as a host bacterium for biosynthesis can avoid the production of these pathogenic factors.

[0020] In one embodiment of the present invention, probiotic Escherichia coli Nissle 1917 is selected as the initial bacterium of the genetically engineered bacterium, and Nissle 1917 is genetically modified to improve its efficiency for biosynthesis. The genetic modification includes inserting a T7 RNA polymerase expression cassette into the genome of Nissle 1917, knocking out the endA gene and ompT gene on the genome, and knocking out the cryptic plasmids pMUT1 and pMUT2 of Nissle 1917; preferably, the T7 RNA polymerase expression cassette includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase sequence located downstream of the spacer sequence downstream of the RBS. Its 5' end is as shown in SEQ ID NO.24, and the T7 RNA polymerase expression cassette sequence is as shown in SEQ ID NO.5.

[0021] In one embodiment of the present invention, a gene knockout step is performed on the genome of the initial bacteria of the genetically engineered bacteria to control the metabolic flux inside the strain and improve the expression efficiency of the target product. The gene knockout can be performed before the initial bacteria are transferred into the expression vector, or after the initial bacteria are transferred into the expression vector. The gene knockout can knockout one gene or multiple genes simultaneously; the order and number of gene knockouts are not restricted. One or more genes can be knocked out first, and then one or more genes can be knocked out. One gene can be knocked out at a time, or multiple genes can be knocked out at a time. The method of gene knockout can adopt any method that can be mastered in the art, such as gene editing methods and homologous recombination methods. Representative gene editing methods include the CRISPR / Cas9 gene editing technology. Gene knockout can be carried out according to the instructions of commercially available gene editing kits and the guidance of textbooks and reference books in the art.

[0022] In one embodiment of the present invention, the following operations are performed on the genome of the initial bacteria of the genetically engineered bacteria: knockout the deaminase gene nagB, the deacetylase gene nagA, the mannose phosphate transporter gene manX, the N-acetylglucosamine transporter gene nagE, and the N-acetylglucosamine kinase gene nagK.

[0023] In one embodiment of the present invention, the following operations are performed on the genome of the initial bacteria of the genetically engineered bacteria: knockout the deaminase gene nagB, the deacetylase gene nagA, the mannose phosphate transporter gene manX, the N-acetylglucosamine transporter gene nagE, the N-acetylglucosamine kinase gene nagK, and knockout the galactose-1-phosphate uridylyltransferase gene galT.

[0024] In one embodiment of the present invention, the following operation is performed on the genome of the initial bacteria of the genetically engineered bacteria: knockout the galactose-1-phosphate uridylyltransferase gene galT. Knocking out the galactose-1-phosphate uridylyltransferase can prevent the generated galactose-1-phosphate from being converted into UDP-galactose by galactose-1-phosphate uridylyltransferase.

[0025] In the third aspect of the present invention, the present invention provides a method for preparing a genetically engineered bacterium for producing lacto-N-dibiose.

[0026] In one embodiment of the present invention, a method for preparing a genetically engineered bacterium for producing lactose-N-dibiose includes: transferring an expression vector containing a galactokinase gene (galK) and a lacto-N-biose phosphorylase gene lnbP into an initial strain of the genetically engineered bacterium to obtain a genetically engineered bacterium capable of producing lactose-N-dibiose. This genetically engineered bacterium can be fermented and cultured in a medium containing galactose or lactose, glucose, and N-acetylglucosamine (GlcNAc) to catalytically produce LNB.

[0027] In one embodiment of the present invention, a method for preparing a genetically engineered bacterium for producing lactose-N-dibiose includes: performing the following operations on the genome of the initial strain of the genetically engineered bacterium: knocking out the deaminase gene nagB, the deacetylase gene nagA, the mannose phosphate transporter gene manX, the N-acetylglucosamine transporter gene nagE, the N-acetylglucosamine kinase gene nagK, and / or knocking out the galactose-1-phosphate uridylyltransferase gene galT. Transferring an expression vector containing a galactokinase gene (galK) and a lacto-N-biose phosphorylase gene lnbP into the initial strain of the genetically engineered bacterium.

[0028] In one embodiment of the present invention, a method for preparing a genetically engineered bacterium for producing lactose-N-dibiose includes: while transferring an expression vector containing a galactokinase gene (galK) and a lacto-N-biose phosphorylase gene lnbP into the initial strain of the genetically engineered bacterium, also transferring an expression vector containing a glucosamine synthase gene glmS and a glucosamine acetylase gene gna1 into the initial strain. This genetically engineered bacterium for producing lactose-N-dibiose not only enhances the expression of the enzymes galactokinase and lacto-N-biose phosphorylase related to LNB production, but also enhances the expression of the synthases glucosamine synthase and glucosamine acetylase related to N-acetylglucosamine (GlcNAc). Therefore, the genetically engineered bacterium for producing LNB of the present invention can use the endogenous N-acetylglucosamine in the engineered bacterium as a substrate to produce LNB without relying on the N-acetylglucosamine added in the medium.

[0029] In one embodiment of the present invention, a method for preparing a genetically engineered bacterium for producing lactose-N-diaccharide includes: providing expression vector I and expression vector II, wherein expression vector I contains glucosamine synthase gene glmS and glucosamine acetylase gene gna1, and expression vector II contains galactokinase gene (galK) and lacto-N-biose phosphorylase gene lnbP; transferring expression vector I and expression vector II into the initial bacterium of the genetically engineered bacterium. Further, expression vector II also contains lactose permease gene lacY and / or β-galactosidase gene lacZ.

[0030] In one embodiment of the present invention, a method for preparing a genetically engineered bacterium for producing lactose-N-diaccharide includes: providing expression vector I and expression vector II, wherein expression vector I contains glucosamine synthase gene glmS and glucosamine acetylase gene gna1, expression vector II contains galactokinase gene (galK), lacto-N-biose phosphorylase gene lnbP, and lactose permease gene lacY and / or β-galactosidase gene lacZ; transferring expression vector I and expression vector II into the initial bacterium of the genetically engineered bacterium. The following operations are performed on the genome of the initial bacterium of the genetically engineered bacterium: knocking out deaminase gene nagB, deacetylase gene nagA, mannose phosphate transporter gene manX, N-acetylglucosamine transporter gene nagE, N-acetylglucosamine kinase gene nagK, and / or knocking out galactose-1-phosphate uridylyltransferase gene galT.

[0031] In one embodiment of the present invention, a method for preparing a genetically engineered bacterium for producing lactose-N-diaccharide, the method includes:

[0032] (1) Preparing a Nissle 1917 engineered bacterium integrated with a T7 RNA polymerase expression cassette;

[0033] (2) On the basis of the Nissle 1917 engineered bacterium obtained in step (1), knocking out deaminase gene nagB, deacetylase gene nagA, mannose phosphate transporter gene manX, N-acetylglucosamine transporter gene nagE, N-acetylglucosamine kinase gene nagK to obtain a modified engineered bacterium;

[0034] (3) Preparing expression vector I and expression vector II, wherein expression vector I contains glucosamine synthase gene glmS and glucosamine acetylase gene gna1, and expression vector II contains galactokinase gene galK and lacto-N-biose phosphorylase gene lnbP;

[0035] (4) Transfer the expression vector I and the expression vector II into the engineered bacterium obtained in step (2) to obtain an expression bacterium.

[0036] In one embodiment of the present invention, a method for preparing a genetically engineered bacterium for producing lactose-N-ditose, the method comprising:

[0037] (1) Prepare an engineered Nissle 1917 bacterium integrated with the T7 RNA polymerase expression cassette;

[0038] (2) Based on the Nissle 1917 engineered bacterium obtained in step (1), knockout the deaminase gene nagB, the deacetylase gene nagA, the mannose phosphate transporter gene manX, the N-acetylglucosamine transporter gene nagE, and the N-acetylglucosamine kinase gene nagK to obtain a modified engineered bacterium;

[0039] (3) Prepare an expression vector I and an expression vector II. The expression vector I contains the glucosamine synthase gene glmS and the glucosamine acetylase gene gna1. The expression vector II contains the galactokinase gene galK and the lacto-N-biose phosphorylase gene lnbP, and the lactose permease gene lacY and / or the β-galactosidase gene lacZ;

[0040] (4) Transfer the expression vector I and the expression vector II into the modified engineered bacterium in step (2) to obtain an expression bacterium;

[0041] Optionally, knockout the galactose-1-phosphate uridylyltransferase gene galT based on the modified engineered bacterium or the expression bacterium.

[0042] In one embodiment of the present invention, the expression vector includes pRSFDuet, pACYCDuet, pETDuet1, pCDFDuet.

[0043] In one embodiment of the present invention, the engineered Nissle 1917 bacterium integrated with the T7 RNA polymerase expression cassette has undergone genetic modification, and the genetic modification includes inserting the T7 RNA polymerase expression cassette into the genome of Nissle 1917, knocking out the endA gene and the ompT gene on the genome, and knocking out the cryptic plasmids pMUT1 and pMUT2 of Nissle 1917; preferably, the T7 RNA polymerase expression cassette includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase sequence located downstream of the spacer sequence downstream of the RBS. Its 5' end is as shown in SEQ ID NO.24, and the T7 RNA polymerase expression cassette sequence is as shown in SEQ ID NO.5.

[0044] In the fourth aspect of the present invention, the present invention provides a genetically engineered bacterium for producing lactose-N-dibiose according to the first and second aspects of the present invention, and the application of the genetically engineered bacterium prepared according to the method of the third aspect of the present invention in the production and preparation of lactose-N-dibiose (LNB).

[0045] In the fifth aspect of the present invention, the present invention provides a method for producing lactose-N-dibiose (LNB), the method comprising: fermenting and culturing the genetically engineered bacterium for producing lactose-N-dibiose according to the first and second aspects of the present invention, or the genetically engineered bacterium prepared according to the method of the third aspect of the present invention, and separating and purifying the fermentation product to obtain lactose-N-dibiose (LNB).

[0046] It can be understood that, based on the present invention, a probiotic Escherichia coli genetically engineered strain for producing LNB is successfully constructed, and the production of LNB can be achieved by using the general culture method and product purification method in the art.

[0047] It can be understood that when using the strain of the present invention in which only the galactokinase gene (galK) and the lacto-N-biose phosphorylase gene lnbP are enhanced, N-acetylglucosamine (GlcNAc) needs to be added externally to the culture medium to achieve the production of LNB, and this production mode is also referred to as whole-cell catalytic synthesis of LNB.

[0048] Preferably, the fermentation medium for the fermentation culture of the present invention contains glucose, lactose, yeast powder, Na 2 HPO 4 ·12H 2 O, KH 2 PO 4 、NH 4 C1, ferric citrate, zinc sulfate heptahydrate, copper sulfate pentahydrate, manganese sulfate monohydrate, sodium borate decahydrate, ammonium molybdate, calcium chloride dihydrate and magnesium sulfate.

[0049] Preferably, the temperature of the fermentation culture is 25 - 35 °C.

[0050] Preferably, the step of adding or not adding an inducer is further included during the fermentation culture.

[0051] Preferably, the inducer includes IPTG.

[0052] Preferably, the working concentration of the inducer is 0.1 - 1 mM.

[0053] Beneficial effects:

[0054] Compared with the prior art, the present invention has at least the following beneficial effects:

[0055] The present invention constructs an LNB genetically engineered bacterium by using an overexpression vector and a gene knockout method, realizing high-efficiency production of LNB while avoiding the production of endotoxins. The fermentation LNB yield is high, providing a new method and new idea for the high-efficiency, low-cost and safe industrial production of LNB. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1A It is the HPLC result diagram of the GlcNAc standard product;

[0057] Figure 1B It is the HPLC result diagram of the GlcNAc fermentation broth sample;

[0058] Figure 1C It is the MS result diagram of the GlcNAc fermentation broth sample;

[0059] Figure 2 It is the OD of Escherichia coli TCBJ118 in a 1.5 L tank 600nm and the GlcNAc yield diagram;

[0060] Figure 3A It is the HPLC result of the LNB standard product;

[0061] Figure 3B It is the HPLC result diagram of the LNB fermentation broth sample;

[0062] Figure 3C It is the MS result diagram of the LNB fermentation broth sample;

[0063] Figure 4 It is the schematic diagram of the sequencing result after the galT locus of the genome of strain TCBJ-007-G is knocked out;

[0064] Figure 5 It is the OD of the genetically engineered strain TCBJ122 in a 1.5 L tank 600nm and the LNB yield diagram;

[0065] Figure 6 It is the yield diagram of the whole-cell catalysis of the genetically engineered strain TCBJ117-1. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0066] The technical solution of the present invention will be further described below in conjunction with the drawings and through specific embodiments. However, the following examples are only simple examples of the present invention, and do not represent or limit the scope of the protection of the rights of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0067] For those technical or conditions not specified in the examples, they shall be carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. For the reagents or instruments whose manufacturers are not specified, they are all conventional products that can be obtained through regular channels.

[0068] Example 1

[0069] In this example, the construction and yield verification of Escherichia coli TCBJ117 and TCBJ118 were carried out.

[0070] 1.1 Preparation of Escherichia coli TCBJ117, namely EcNcΔattB(lacUV5-T7)ΔendAΔompT (this method is also described in CN202310516515.6, and as part of the present invention, its full text is incorporated into the present invention)

[0071] (1) In the original strain, probiotic Escherichia coli Nissle1917 (E. coli Nissle1917), based on the CRISPR / Cas9 gene editing technology, using a homologous recombination kit (Pro Ligation-Free Cloning Kit, abm company, product number E086), the Cas9 fragment was ligated with the double-digested fragment of the NcoI / XhoI enzymes of the pKD46 plasmid to construct the pKD-Cas9 plasmid. The pKD-Cas9 plasmid was transformed into the E. coli Nissle1917 strain, and positive clones were screened and named EcN-Cas9.

[0072] (2) While preparing EcN-Cas9, sgRNAs of the cryptic plasmids pMTU1 and pMTU2 were designed and prepared respectively, and transferred into EcN-Cas9 for the knockout of the cryptic plasmids, thereby constructing an Escherichia coli strain with the cryptic plasmids removed, named EcNc.

[0073] Among them: sgRNA-pMTU1: agttaccggataaggcgcagcgg; sgRNA-pMTU2: gtttggcgcagaacctcggacgg.

[0074] (3) The optimized T7RNAP expression cassette was inserted into the genome of the Nissle 1917 bacterium, and the insertion site of the expression cassette was the attB site on the genome.

[0075] The optimized T7RNAP expression cassette (abbreviated as "lacUV5-T7") includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and the T7 RNA polymerase (Gene ID: 1261050) sequence located downstream of the spacer sequence downstream of the RBS. The 5' end of the T7RNAP expression cassette sequence is tttacactttatgcttccggctcgtataatgtgtggaattgtgagcggataacaaGGCCACTACTAGAGAAAGAGGAGAAATACTAG ATGAACACGATTAACATCGCTAAGAAC (SEQ ID NO.24), where the promoter sequence is "tttacactttatgcttccggctcgtataatg", the operator sequence is "ttgtgagcggataacaa", the RBS sequence is "AAAGAGGAGAAA", the spacer sequences are "GGCCACTACTAGAG" (the spacer sequence upstream of RBS) and "TACTAG" (the spacer sequence downstream of RBS), "ATGAACACGATTAACATCGCTAAGAAC" is the upstream partial sequence of the gene encoding T7 RNA polymerase (Gene ID: 1261050), and ATG is the start codon. The complete optimized T7 RNAP expression cassette sequence is SEQ ID NO.5.

[0076] Referring to step (1), EcNc-Cas9 was constructed, and then the pUC-sgRNA-attB plasmid and the Donor fragment (the Donor fragment contains the T7 RNAP fragment (i.e., the T7 RNAP expression cassette) and homologous arms of about 300 bp in length upstream and downstream of the attB site) were co-transformed into EcNc-Cas9 cells. The T7 RNAP fragment was integrated into the attB site of the EcNc strain using the CRISPR / Cas9 system to obtain the strain EcNcΔattB(lacUV5-T7), simply referred to as EcNc-T7.

[0077] Among them, the sgRNA nucleotide sequence targeting the attB site is sgRNA-attB: ctaacttgagcgaaacgggaagg; the Donor fragment contains the T7 RNAP fragment (i.e., the T7 RNAP expression cassette) and homologous arms of about 300 bp in length upstream and downstream of the attB site, and the sequence is as shown in SEQ ID NO.25.

[0078] (4) Based on the CRISPR / Cas9 gene editing technology, the endA and ompT genes in the probiotic Escherichia coli EcNc-T7 strain were knocked out to prepare EcNcΔattB(lacUV5-T7)ΔendAΔompT.

[0079] Design sgRNAs for genes endA and ompT respectively. The nucleotide sequence of the sgRNA for endA is sgRNA-endA: tttttctcaagcgaaagccgcgg; the nucleotide sequence of the sgRNA for ompT is sgRNA-ompT: tactcctgacaacataaatgcgg. Transform it into the target strain EcNc-T7 using the CRISPR / Cas9 knockout system, that is, knockout the target genes in EcNc-T7 to obtain EcNcΔattB(lacUV5-T7)ΔendAΔompT, and name it "TCBJ117".

[0080] In addition to using the CRISPR / Cas9 gene editing technology, homologous recombination technology can also be used to knockout related genes and plasmids, and the finally obtained strain is the same as TCBJ117.

[0081] 1.2 Construction of engineering strain TCBJ118

[0082] (1) Also using the CRISPR / Cas9 gene editing technology, further knockout the nagB, nagA, manX, nagE and nagK genes in the strain EcNcΔattB(lacUV5-T7)ΔendAΔompT(TCBJ117) to obtain the chassis strain (EcNcΔattB(lacUV5-T7)ΔendAΔompTΔnagBΔnagAΔmanXΔnagEΔnagK, named TCBJ-007-0, Table 1). Using the genome of Escherichia coli K-12 MG1655 as a template, clone the gene fragment of EcglmS (SEQ ID NO.16); synthesize the gna1 gene derived from Saccharomyces cerevisiae, named Scgna1 (SEQ ID NO.17). Connect the EcglmS and Scgna1 gene fragments to the vector pRSFDuet by homologous recombination to construct the expression plasmid pRSF-EcglmS-Scgna1. Transfer pRSF-EcglmS-Scgna1 into the strain TCBJ-007-0 to obtain the probiotic Escherichia coli engineering strain EcNcΔattB(lacUV5-T7)ΔendAΔompTΔnagBΔnagAΔmanXΔnagEΔnagK / pRSF-EcglmS-Scgna1 (named TCBJ118) for producing GlcNAc.

[0083] (2) Yield verification of TCBJ118: Inoculate TCBJ118 into 2 mL of LB medium containing Kan, and culture it overnight at 37 °C with a shaking speed of 220 rpm for about 15 h to obtain a seed solution; Take 1 mL of the overnight-cultured seed solution and inoculate it into 50 mL of 2YT medium containing Kan, add glucose with a final concentration of 80 g / L, and culture it at 30 °C with a shaking speed of 250 rpm for about 6 h (OD of the bacterial solution 600 is about 0.8). Add IPTG with a final concentration of 0.1 mM, and continue the induced fermentation at 25 °C with a shaking speed of 250 rpm for 48 h. After the fermentation is completed, centrifuge to collect the fermentation supernatant. The supernatant is boiled at 100 °C for 10 min, centrifuged again, take the supernatant and dilute it 10 times with sterile water. The sample is filtered through a 0.22 μm filter membrane, and the content of GlcNAc is detected by the external standard method using liquid chromatography. The results show that after 48 h of fermentation, the GlcNAc yield of strain TCBJ118 reaches 10.23 g / L.

[0084] The HPLC-MS results of the GlcNAc standard and the sample are shown in Figure 1A - Figure 1C Figure 1A The peak elution time of the GlcNAc standard in Figure 1B is 13.024 min, Figure 1C and the peak elution time of the product peak in the fermentation broth sample in

[0085] (3) Fermentation of strain TCBJ118 to synthesize GlcNAc in a 1.5 L fermenter: The fermentation medium is an inorganic salt medium: 2 g / L of yeast powder, Na 2 HPO 4 ·12H 2 O 15.6 g / L, KH 2 PO 4 3 g / L, NH 4 C1 1 g / L. Add during inoculation: 1 g / L of magnesium sulfate, 1 mL / L of nutrient solution (containing 10 g / L of ferric citrate, 2.25 g / L of zinc sulfate heptahydrate, 1 g / L of copper sulfate pentahydrate, 0.35 g / L of manganese sulfate monohydrate, 0.23 g / L of sodium borate decahydrate, 0.11 g / L of ammonium molybdate, and 2 g / L of calcium chloride dihydrate), 10 g / L of glucose, and the inoculation amount is 0.75%. The initial fermentation temperature is 30 °C, OD 600 nmInduce when reaching 16, the IPTG induction concentration is 0.2 mM, and the induction temperature is 25 °C. The feeding ingredients are 600 g / L glucose, 1 g / L magnesium sulfate heptahydrate, and 1 mL / L nutrient solution. The base addition is ammonia water plus an equal volume of sterile water, and the fermentation time is 86 h. Centrifuge the strain fermentation broth at 10,000 rpm for 1 min to obtain the fermentation broth supernatant; dilute the fermentation broth supernatant 10 times and filter it through a 0.22 μm aqueous filter membrane. Detect the diluted fermentation supernatant by HPLC. According to Figure 2 The results showed that after 86 h of fermentation in a 1.5 L fermenter, the yield of GlcNAc reached 97 g / L.

[0086] Example 2

[0087] Construction and optimization of the LNB synthesis pathway in this example.

[0088] 2.1 Construction of the LNB synthesis pathway:

[0089] Synthesize the galactokinase gene galK from Escherichia coli MG1655 (named EcgalK, SEQ ID NO.1), amplify the EcgalK gene fragment with primers EcgalK-F (5’AAGGAGATATACCATGGgcATGAGTCTGAAAGAAA3’) and EcgalK-R (5’ATCTCCTTCTTGGATCCTCAGCACTGTCCTGCT3’), and ligate it to pCDFDuet1 through homologous recombination to obtain the recombinant plasmid pCDF-EcgalK; synthesize the lacto-N-biose phosphorylase gene lnbP from Bifidobacterium bifidum optimized with Escherichia coli codons (named BblnbP, SEQ ID NO.18), amplify the BblnbP gene fragment with primers BblnbP-F (5’GGAGATATAgaattcATGACCAGCACCGGG3’) and BblnbP-R (5’AGGCGCGCCGAGCTCTCACAGATTACGCCA3’), and ligate it to pCDF-EcgalK through homologous recombination to obtain pCDF-EcgalK-BblnbP. The gene sequence of BblnbP is shown in SEQ ID NO.18.

[0090] The constructed recombinant plasmid was transformed into the competent cells of strain TCBJ118 constructed in Example 1 to obtain an engineered strain TCBJ118 / pCDF-EcgalK-BblnbP with the ability to produce LNB, named TCBJ118-1. The shake flask culture process of TCBJ118-1: The strain was inoculated into 2 mL of LB medium containing the corresponding antibiotic, and cultured overnight at 37 °C and 220 rpm for about 15 h to obtain a seed culture; 1 mL of the overnight-cultured seed culture was inoculated into 50 mL of 2YT medium containing the corresponding antibiotic, and glucose with a final concentration of 80 g / L and lactose with a final concentration of 20 g / L were added, and cultured at 30 °C and a shaker speed of 250 rpm for about 6 h (the OD 600 of the bacterial solution was about 0.8). IPTG with a final concentration of 0.1 mM was added, and the induction fermentation was continued at 25 °C and a shaker speed of 250 rpm for 48 h. After the fermentation was completed, the fermentation supernatant was collected by centrifugation. The supernatant was boiled at 100 °C for 10 min, centrifuged again, and the supernatant was diluted 10 times with sterile water. The sample was filtered through a 0.22 μm filter membrane, and HPLC-MS was used to determine the production of LNB and HPLC was used to determine the content of LNB. The results showed that after 48 h of fermentation, the yield of TCBJ118-1 reached 0.05 g / L. The HPLC-MS diagrams of the LNB standard and the sample are as shown in Figure 3A - Figure 3C . The peak elution time of the LNB standard was 9.9 min, and the peak elution time of the product peak in the LNB sample was the same as that of the LNB standard; and in the MS results of the sample, m / z 366.0, 222.0 and 204.1 were mainly produced, which were the daughter ion peaks of LNB, consistent with the MS results of LNB reported in the literature, proving that the product of the present invention was indeed LNB.

[0091] 2.2 Screening of different expression vectors:

[0092] Using plasmid pCDF-EcgalK-BblnbP as a template, the gene fragment of EcgalK-BblnbP was cloned with primers EcgalK-F and BblnbP-R in step 2.1 of Example 2 and ligated to vector pACYCDuet (Qiyunbio, QP1093) or pETDuet (Qiyunbio, QP1923) by homologous recombination to construct a series of expression plasmids, including: pAC-EcgalK-BblnbP, pET-EcgalK-BblnbP.

[0093] The constructed recombinant plasmids were transformed into the strain TCBJ118 constructed in Example 1 to obtain the engineering strains TCBJ118 / pAC-EcgalK-BblnbP and TCBJ118 / pET-EcgalK-BblnbP for producing LNB, which were named TCBJ118-2 and TCBJ118-3, respectively. The shake flask culture process of TCBJ118-1, TCBJ118-2 and TCBJ118-3: The strains were inoculated into 2 mL of LB medium containing the corresponding antibiotics, cultured overnight at 37 °C and 220 rpm in a shake flask for about 15 h to obtain the seed liquid; 1 mL of the overnight cultured seed liquid was inoculated into 50 mL of 2YT medium containing the corresponding antibiotics, added with glucose at a final concentration of 80 g / L and lactose at 20 g / L, and cultured at 30 °C with a shaker speed of 250 rpm for about 6 h (the OD of the bacterial liquid 600 was about 0.8). IPTG with a final concentration of 0.1 mM was added, and the induction fermentation was continued at 25 °C with a shaker speed of 250 rpm for 48 h. After the fermentation was completed, the fermentation supernatant was collected by centrifugation. The supernatant was boiled at 100 °C for 10 min, centrifuged again, the supernatant was diluted 10 times with sterile water, the sample was filtered through a 0.22 μm filter membrane, and the content of GlcNAc was detected by the external standard method in liquid chromatography. The results showed that after 48 h of fermentation, the yield of TCBJ118-3 was 4.3 times that of TCBJ118-1, reaching 0.26 g / L.

[0094] Table 1 LNB yields of each strain (optimized vector)

[0095]

[0096] 2.3 Optimization of lnbP genes from different sources

[0097] The lnbP gene from Bifidobacterium longum was synthesized, first codon-optimized for Escherichia coli, named BllnbP (SEQ ID NO.19); then the BllnbP gene fragment was amplified with primers BllnbP-F’ (5’AGGAGATATAgaattcATGACGAGCACCGGC3’) and BllnbP-R’ (5’CAGGCGCGCCGAGCTCTTACGCTTCGCGCCACG3’), and the BllnbP gene fragment was ligated to pET-EcgalK-BblnbP by homologous recombination to replace the BblnbP gene, obtaining the recombinant plasmid pET-EcgalK-BllnbP. The gene sequence of BllnbP is shown in SEQ ID NO.19.

[0098] Synthesize the lnbP gene from Bifidobacterium castoris, first perform codon optimization for Escherichia coli, and name it BclnbP; then use primers BclnbP-F’(5’AGGAGATATAGAATTCATGAACACCACCGGCCG3’) and BclnbP-R’(5’CAGGCGCGCCGAGCTCTTATTCCAGGCCTTTC 3’) to amplify the BclnbP gene fragment, and ligate it to pET-EcgalK-BblnbP to replace BblnbP, obtaining the recombinant plasmid pET-EcgalK-BclnbP. The BclnbP gene sequence is shown in SEQ ID NO.2.

[0099] Perform gel electrophoresis and excise and recover the DNA fragment. Respectively replace the BblnbP gene in the plasmid pET-EcgalK-BblnbP constructed in step (2) with the recovered BllnbP and BclnbP gene fragments through homologous recombination to construct a series of expression plasmids, including: pET-EcgalK-BllnbP and pET-EcgalK-BclnbP.

[0100] Transform the recombinant plasmid into the competent cells of strain TCBJ118 to obtain the engineered strains TCBJ118 / pET-EcgalK-BllnbP and TCBJ118 / pET-EcgalK-BclnbP for producing LNB, which are named TCBJ118-3-1 and TCBJ118-3-2 respectively. The shake flask fermentation process is the same as in step (2).

[0101] The LNB production results of the engineered strains are shown in Table 3. After 48 hours of fermentation, compared with TCBJ118-3, the production of TCBJ118-3-2 increased by 85%, and the LNB production reached 0.48 g / L.

[0102] Table 2 LNB production of each strain (optimized lnbP gene)

[0103]

[0104] Example 3

[0105] In this example, the LNB synthesis pathway was optimized.

[0106] 3.1 Knock out the galT gene

[0107] To prevent the generated galactose-1-phosphate from being converted into UDP-galactose by galactose-1-phosphate uridylyltransferase GalT, knock out the galactose-1-phosphate uridylyltransferase gene galT (SEQ ID NO.20).

[0108] Using the CRISPR / Cas9 gene editing technology, the sgRNA1 sequence of galT (SEQ ID NO.21: 5’GCAATTTAATCCCGTTGATC 3’) and sgRNA2 (SEQ ID NO.22: 5’GCGATATCCATTTTCGCGAATC 3’) were designed, and the Donor sequence (SEQ ID NO.23) was cloned into the gene editing vector Donor plasmid. The specific experimental procedures include the following steps:

[0109] Donor sequence of galT (SEQ ID NO.23):

[0110] tccagtgaagcggaagaacttaaccctgcaccctgcggcacattgccgctgatcaccatgtccacaccgccgaagctgttgttacgcagttgca

[0111] gatgtttcaccacgccacgaacgtagttagcccattgatagttttcatgcgcgacaatgggcgcatcgagggaaaactcgtcgagctgattttcat

[0112] aatcggctgccattacgcgaactttacggtcatcgcgtggcgcacagctgatcacggtttgataatcaatcgcgcagggcagaacgaaaccgtc

[0113] gttgtagtcggtgtgttcaccaatcaaattcacgcggccaggcgcctgaatggtgtgagtggcagggtagccaaatgcgttggcaaacagagat

[0114] tgtgttttttctttcagactcatttcttacactccggattcgcgaaaatggatatcgctgactgcgcgcaaacgctctgctgcctgttctgcggtcaggt

[0115] ctcgctgggtttctgcggtcgttccttaatcgggatatccctgtggatggcgtgactgccagtgccaggtgtcctgcgccatttcatcgagtgtgcg

[0116] cgttacgcgccagttcagttcacggtcggctttgctggcgtccgcccagtaggccggaaggtcgccctcgcgacgcggtgcaaaatgataatta

[0117] accggtttgccgcaggctttgctgaaggcattaaccacgtccagcacgctgctgcctacgccagcgccgaggttatagatgtgtacgcctggctt

[0118] gttcgccagtttttccatcgccacgacgtgaccgtccgccagatccattacgtggatgtaatcgcgcacgccagtaccgtcttcggtcggataatc

[0119] gttaccaaaaatcgccagcgagtcgcgacggcctacagcaacctgggcgatgtatggcatcaggttattcggaatgccttgcggatcttcgccc

[0120] atatcgcccgacggatgcgcgccaactgggttgaagtagcgcagcagggcaa

[0121] 1) Preparation of electrocompetent cells of strain TCBJ-007-0;

[0122] 2) Transform the pSynbio-Cas9 plasmid into TCBJ-007-0 cells, spread the bacterial solution on a Kan-resistant plate, and culture at a constant temperature of 37°C;

[0123] 3) Pick monoclonal colonies the next day for PCR verification, and prepare electrocompetent cells EcNcΔattB(lacUV5-T7)ΔendAΔompTΔnagBΔnagAΔmanXΔnagEΔnagK-Cas9 from the positive clones;

[0124] 4) Transfer the pSynbio-sgRNA-galT and donor fragments into the electrocompetent cells of EcNcΔattB(lacUV5-T7)ΔendAΔompTΔnagBΔnagAΔmanXΔnagEΔnagK-Cas9, spread the bacterial solution on a Kan+Spec+DAP (2,6-diaminopimelic acid)-resistant plate, and culture at a constant temperature of 37°C;

[0125] 5) Pick monoclonal colonies the next day for expanded culture. Use primers (galT-donor-F’ 5’aggtaaggctgtgaatactcgtgt 3’ and galT-donor-R’ 5’cgcattactgatggcttcgctat 3’) to amplify the target gene fragment, and identify it by agarose gel electrophoresis and sequencing; Recover the correct band from the agarose gel and verify it by sequencing. The sequence of the knockout fragment is consistent with the donor fragment.

[0126] The sequencing identification result after the galT gene knockout of strain TCBJ-007-0 is shown in Figure 3. After sequencing verification, the sequence of the knockout fragment is consistent with the designed donor fragment, and strain EcNcΔattB(lacUV5-T7)ΔendAΔompTΔnagBΔnagAΔmanXΔnagEΔnagKΔgalT is obtained, named TCBJ-007-G. Co-transform pRSF-EcglmS-Scgna1 and pET-EcgalK-BclnbP into TCBJ-007-G to obtain strain TCBJ-007-G / pRSF-EcglmS-Scgna1 / pET-EcgalK-BclnbP, named TCBJ-007-G-1. Verify the yield of TCBJ-007-G-1 by shake flask culture. Compared with TCBJ118-3-2, the yield of TCBJ-007-G-1 increased by 29% and reached 0.67 g / L.

[0127] Table 3 LNB yields of each strain (galT knockout)

[0128]

[0129] (2) Overexpress the lacY and lacZ genes

[0130] To promote the entry of lactose into the cell, the lactose permease gene lacY was overexpressed: Using Escherichia coli K12 MG1655 as a template, the lacY sequence was amplified with primers lacY-F’ (5’ACATATGGCAGATCTcATGTACTATTTAAAAAA3’) and lacY-R’ (5’CAGACTCGAGGGTACCTTAAGCGACTTCATTC3’). Using homologous recombination, lacY was ligated to pET-EcgalK-BclnbP to obtain the recombinant plasmid pET-EcgalK-BclnbP-lacY. pET-EcgalK-BclnbP-lacY and pRSF-EcglmS-Scgna1 were co-transformed into the competent cells of TCBJ117-007-G to obtain the strain TCBJ117-007-G / pRSF-EcglmS-Scgna1 / pET-EcgalK-BclnbP-lacY, named TCBJ-007-G-2. To promote the hydrolysis of lactose into galactose and glucose, the lactose hydrolase lacZ was overexpressed: Using Escherichia coli K12 MG1655 as a template, the lacZ sequence was amplified with primers lacZ-F’ (5’AGTCGCTTAAGGTACCAAGAAGGAGAtataATGACCATGATTACGGAT3’) and lacZ-R’ (5’TCTTTACCAGACTCGAGTTATTTTTGACACCAGA3’). Using homologous recombination, lacZ was ligated to pET-EcgalK-BclnbP-lacY to obtain the recombinant plasmid pET-EcgalK-BclnbP-lacY-lacZ. pRSF-EcglmS-Scgna1 and pET-EcgalK-BclnbP-lacY-lacZ were co-transformed into the competent cells of TCBJ117-007-G constructed in Example 3 to obtain the strain TCBJ117-007-G / pRSF-EcglmS-Scgna1 / pET-EcgalK-BclnbP-lacY-lacZ, named TCBJ122.

[0131] The yield verification of the strain TCBJ118 / pET-EcgalK-BclnbP-lacY-lacZ was the same as the step (2) of Example 2. Compared with TCBJ118 / pET-EcgalK-BclnbP, the yield of TCBJ118 / pET-EcgalK-BclnbP-lacY-lacZ increased by 75% and reached 1.14 g / L.

[0132] Table 4 LNB yields of each strain (enhanced galactose supply)

[0133]

[0134] Fermentation production of LNB using a 1.5 L fermenter

[0135] The fermentation medium is an inorganic salt medium: 2 g / L yeast powder, Na 2 HPO 4 ·12H 2 O 15.6 g / L, KH 2 PO 4 3 g / L, NH 4 C1 1 g / L. When inoculating, add: 1 g / L magnesium sulfate, 1 mL / L nutrient solution (containing 10 g / L ferric citrate, 2.25 g / L zinc sulfate heptahydrate, 1 g / L copper sulfate pentahydrate, 0.35 g / L manganese sulfate monohydrate, 0.23 g / L sodium borate decahydrate, 0.11 g / L ammonium molybdate, and 2 g / L calcium chloride dihydrate), 10 g / L glucose, and the inoculation amount is 0.75%. The initial fermentation temperature is 30 °C. When OD 600nm reaches 16, induction is carried out, the IPTG induction concentration is 0.2 mM, and the induction temperature is 25 °C. The feeding is 600 g / L glucose, 200 g / L lactose, 1 g / L magnesium sulfate heptahydrate, 1 mL / L nutrient solution, and the alkali supplement is ammonia water plus an equal volume of sterile water. The fermentation time is 68 h.

[0136] The results are as Figure 5 shown. After 68 h of fermentation in a 1.5 L fermenter, the LNB yield reaches 10.23 g / L.

[0137] Example 4

[0138] This example verified the method for producing LNB using the engineered strain overexpressing the EcgalK and BclnbP genes with GlcNAc and galactose as substrates, that is, whole-cell catalytic synthesis of LNB.

[0139] (1) Preparation of wet cells: Prepare pET-EcgalK-BclnbP according to the method of Example 2, and then transform pET-EcgalK-BclnbP into the competent cells of TCBJ117 to obtain the strain TCBJ117 / pET-EcgalK-BclnbP, named TCBJ117-1. Inoculate the TCBJ117-1 strain into 10 mL of LB liquid medium containing 100 mg / L Amp, shake flask culture at 37 °C and 200 rpm for 12 h, and then transfer it to 200 mL of LB liquid medium containing 100 mg / L Amp at an inoculation amount of 1% (volume fraction), shake flask culture at 37 °C and 200 rpm until OD 600 is about 0.6, then add IPTG with a final concentration of 0.1 mM for induction, and shake flask culture at 16 °C and 200 rpm for 20 h. After the induction is completed, centrifuge at 4 °C and 8000 rpm for 5 min to collect the bacterial cells.

[0140] (2) The fermentation broth for producing GlcNAc in Example 1 was dried and concentrated 5 times by a freeze-vacuum dryer to obtain approximately 45 g / L GlcNAc (approximately 2 M).

[0141] (3) Whole-cell catalysis system: 200 mM GlcNAc (the concentrated fermentation broth was diluted 10 times), 300 mM galactose, 40 g / L glucose, 50 g / L wet cells of TCBJ117-1, 10 mM MgCl 2 , 50 mM Tris-HCl buffer, and the pH was adjusted to 7.0 with ammonia water; at 30 °C, 200 rpm, react for 5 h. After the reaction, the reaction supernatant was collected by centrifugation. The supernatant was boiled at 100 °C for 10 min, centrifuged again, and the supernatant was diluted 10 times with sterile water. The sample was filtered through a 0.22 μm filter membrane, and the content of LNB was detected by the external standard method in liquid chromatography.

[0142] (4) The results of whole-cell catalysis are as Figure 6 shown: After 5 h of whole-cell catalytic reaction synthesis, the LNB yield reached 16.2 g / L.

[0143] Although the method of whole-cell catalytic synthesis of LNB has a higher yield than the method of de novo synthesis of GlcNAc in cells and its conversion to LNB, the culture medium for the method of de novo synthesis of GlcNAc in cells and its conversion to LNB can directly use lactose and glucose, and the cost is significantly lower than that of using a culture medium containing GlcNAc.

[0144] Example 5

[0145] (1) HPLC-MS and HPLC detection of GlcNAc.

[0146] HPLC detection conditions: Chromatographic column: EclipsePlus C18 RRHD 1.8 μm 2.1×50 mm; Mobile phase: Pump A was H 2 O + 0.1% formic acid, and pump B was methanol; Elution gradient was as shown in Table 5; Column temperature was 30 °C.

[0147] Table 5 Liquid phase elution conditions of GlcNAc

[0148] Time min A％ B％ Flow rate ml / min Upper pressure limit bar 0 40 60 0.3 600 1 40 60 0.3 600 4.5 2 98 0.3 600 7 2 98 0.3 600 7.1 40 60 0.3 600 10 40 60 0.3 600

[0149] MS detection conditions: Ionization mode: Electrospray positive ion mode; Detection mode: Product Ion; Nebulizing gas pressure: 40 psi; Ion spray voltage: 4000 V; Dryer temperature: 350 °C; Dry gas flow rate: 8 L / min. Qualitative ion pairs, fragmentation voltage, and collision energy are shown in Table 6.

[0150] Table 6 Qualitative ion pairs, fragmentation voltages and collision energies of GlcNAc

[0151]

[0152] (2) HPLC-MS and HPLC detection of LNB

[0153] The fermentation broth containing GlcNAc obtained in the examples of the present invention was centrifuged at 10,000 rpm for 1 minute to obtain the supernatant of the fermentation broth; the supernatant of the fermentation broth was diluted 200 times and then passed through a 0.22 μm aqueous filter membrane. The diluted fermentation supernatant was subjected to HPLC-MS and HPLC detection.

[0154] HPLC-MS detection method of LNB:

[0155] HPLC detection conditions: Chromatographic column: Waters ACQUITY, BEH Amide, 100×2.1, 1.7 μm; Mobile phase: Pump A is 5 mM ammonium acetate aqueous solution, Pump B is acetonitrile; Elution gradient is shown in Table 7; Column temperature is 30 °C, injection volume is 2 μL.

[0156] Table 7

[0157] Time (minutes) A％ B％ Flow rate mL / min Upper pressure limit bar 0 10 90 0.2 600 2 10 90 0.2 600 8 2 50 0.2 600 10 2 50 0.2 600 12 40 90 0.2 600 15 40 90 0.2 600

[0158] MS detection conditions: Ionization mode: Electrospray negative ion mode; Detection mode: MRM; Nebulizing gas pressure: 40 psi; Ion spray voltage: 4000 V; Dryer temperature: 350 °C; Dry gas flow rate: 8 L / min. Qualitative ion pairs, fragmentation voltages and collision energies are shown in Table 8:

[0159] Table 8

[0160]

[0161] (1) HPLC detection method:

[0162] HPLC detection conditions: Chromatographic column: AMINEX-87H Organic Acid Analysis Column 300×7.8; Mobile phase: 5 mM H 2 SO 4 ; Isocratic elution; Detection wavelength is 210 nm; Column temperature is 40 °C, injection volume is 5 μL. The peak elution time of the LNB standard is 9.9 min. The sample has the same peak elution at 9.9 min.

[0163] Table 9 List of genetically engineered strains involved in the present invention

[0164]

[0165]

[0166] In summary, on the basis of constructing a probiotic engineering strain with high-yield N-acetylglucosamine, the present invention further constructs a genetic engineering bacterium with high-yield LNB, realizing the efficient production of LNB while avoiding the production of endotoxin. The fermentation yield of LNB can reach 10.23 g / L, providing a new method and new idea for the efficient, low-cost and safe industrial production of LNB.

[0167] The applicant declares that the above description is only the specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and the disclosure scope of the present invention.

Claims

1. A genetically engineered bacterium for producing lactose-N-disaccharide, characterized in that: The genetically engineered bacteria contain an expression vector, which contains a galactokinase gene ( galK ) and lacto-N-biose phosphorylase genes LqCy Preferably, the genetically engineered bacteria also overexpresses the lactose permease gene lacY and / or β-galactosidase gene lacZ.

2. A genetically engineered bacterium for producing lactose-N-disaccharide, characterized in that: The genetically engineered bacteria overexpresses the glucosamine synthase gene glmS , glucosamine acetyltransferase gene gna1, Galactokinase gene ( galK ) and lacto-N-biose phosphorylase genes lnbP; Preferably, the genetically engineered bacteria contain expression vector I and expression vector II, wherein the expression vector I contains the glucosamine synthase gene glmS and glucosamine acetylase gene gna1, The expression vector II contains the galactokinase gene ( galK ) and lacto-N-biose phosphorylase genes lnbP.

3. The genetically engineered bacterium according to claim 2, characterized in that: The expression vector II also contains a lactose permease gene lacY and / or β-galactosidase gene lacZ.

4. The genetically engineered bacterium according to claim 1 or 2, characterized in that: The initial bacteria of the genetically engineered bacteria are Escherichia coli; preferably, the initial bacteria are Escherichia coli BL21 (DE3) or probiotic Escherichia coli Nissle 1917; more preferably, the initial bacteria are Nissle 1917 engineered bacteria integrated with a T7 RNA polymerase expression frame.

5. The genetically engineered bacterium according to claim 4, characterized in that: The initial bacterium is a Nissle 1917 engineered bacterium with a T7 RNA polymerase expression frame, and its genetic modification includes inserting a T7 RNA polymerase expression frame into the genome of Nissle 1917 and knocking out a endA Genes and ompT Gene, knockout cryptic plasmid pMUT1 and pMUT2 ; Preferably, the T7 RNA polymerase expression cassette includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase sequence located downstream of the RBS downstream spacer sequence, the 5' end of which is shown in SEQ ID NO.24, and the T7 RNA polymerase expression cassette sequence is shown in SEQ ID NO.

5.

6. The genetically engineered bacterium according to claim 4, characterized in that: Perform the following operations on the genome of the initial strain of genetically engineered bacteria: Knock out the deaminase gene nagB , deacetylase gene nagA mannose phosphate transporter gene manX , acetylglucosamine transporter gene nagE , acetyl glucosamine kinase gene nak , and / or, knockout of the galactose-1-phosphate uridyltransferase gene galT.

7. The genetically engineered bacterium according to claim 1 or 2, characterized in that: The expression vectors include pRSFDuet, pACYCDuet, pETDuet1, and pCDFDuet; Preferably, the glucosamine synthase gene glmS The source includes any one of Escherichia coli K-12 MG1655, Bacillus subtilis or Corynebacterium glutamicum; Preferably, the glucosamine acetylase gene gna1 The sources include Saccharomyces cerevisiae, Caenorhabditis elegans, or any one of Saccharomyces cerevisiae after being codon-optimized in Escherichia coli; Preferably, the lacto-N-biose phosphorylase gene LqCy Sources include Bifidobacterium bifidum ( Bifidobacterium bifidum ) 、 Bifidobacterium longum ( Bifidobacterium longum ) 、Bifidobacterium castoris Any one of .

8. A method for preparing a genetically engineered bacterium for producing lactose-N-disaccharide, characterized in that: The galactokinase gene ( galK ) and lacto-N-biose phosphorylase genes LqCy The expression vector is transferred into the initial strain of genetically engineered bacteria to obtain genetically engineered bacteria capable of producing lactose-N-disaccharide; Preferably, the galactokinase gene ( galK ) and lacto-N-biose phosphorylase genes LqCy The expression vector of the gene was transferred into the initial strain of genetically engineered bacteria, and the glucosamine synthase gene was also transferred into the initial strain of genetically engineered bacteria. glmS and glucosamine acetylase gene gna1 The expression vector was transferred into the initial strain; Preferably, it contains a galactokinase gene ( galK ) and lacto-N-biose phosphorylase genes LqCy The expression vector also contains the lactose permease gene lacY and / or β-galactosidase gene lacZ ; Preferably, the glucosamine synthase gene glmS The source includes any one of Escherichia coli K-12 MG1655, Bacillus subtilis or Corynebacterium glutamicum; more preferably, glmS The gene originated from Escherichia coli K-12 MG1655, and its nucleotide sequence is shown in SEQ ID NO.16; Preferably, the glucosamine acetylase gene gna1 The source includes any one of Saccharomyces cerevisiae and Caenorhabditis elegans; more preferably, the glucosamine acetylase gene The nucleotide sequence of gna1 is as As shown in SEQ ID NO.17; Preferably, the source of the lacto-N-biose phosphorylase gene lnbP includes Bifidobacterium bifidum ( Bifidobacterium bifidum ) 、 Bifidobacterium longum ( Bifidobacterium longum ) 、Bifidobacterium castoris Any one of; Preferably, the initial bacteria is Escherichia coli BL21 (DE3) or probiotic Escherichia coli Nissle 1917; more preferably, the initial bacteria is Nissle 1917 engineered bacteria integrated with a T7 RNA polymerase expression frame; Preferably, the initial bacteria is a Nissle 1917 engineered bacterium into which a T7 RNA polymerase expression cassette is integrated, and the genetic modification comprises inserting a T7 RNA polymerase expression cassette into the genome of Nissle 1917 and knocking out a endA Genes and ompT Gene, knockout cryptic plasmid pMUT1 and pMUT2 More preferably, the T7 RNA polymerase expression cassette includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase sequence located downstream of the RBS downstream spacer sequence, the 5' end of which is as shown in SEQ ID NO.24, and the T7 RNA polymerase expression cassette sequence is as shown in SEQ ID NO.5; Preferably, the following operations are performed on the genome of the initial strain of genetically engineered bacteria: deaminase gene is knocked out nagB , deacetylase gene nagA mannose phosphate transporter gene manX , acetylglucosamine transporter gene nagE , acetyl glucosamine kinase gene nak , and / or, knockout of the galactose-1-phosphate uridyltransferase gene galT .

9. Use of the genetically engineered bacteria for producing lactose-N-disaccharide according to any one of claims 1 to 7 in producing lactose-N-disaccharide.

10. A method for producing lactose-N-disaccharide, characterized in that: The method comprises: Fermentation and cultivation of the genetically engineered bacteria for producing lactose-N-disaccharide according to any one of claims 1 to 7, separation and purification of the fermentation product, and obtaining LNB.

Images