A method for constructing ultrasound-visualized tumor-targeting engineered bacteria and its application

Abstract

The present invention discloses a method for constructing an ultrasound-visualized tumor-targeting engineered bacterium and its application, belonging to the field of biotechnology. The construction method of the present invention comprises connecting an acoustic gene cluster to a pT7 promoter and inserting a T7RNAP gene regulated by a plac promoter and a CAP binding site in front of the pT7 promoter to obtain an acoustic reporter element; the acoustic reporter element is then inserted into the bacterial genome to construct the ultrasound-visualized tumor-targeting engineered bacterium. By integrating the acoustic gene cluster into the bacterial genome, the present invention effectively addresses the risks of plasmid transfer and the difficulty in long-term stable expression of exogenous genes, thereby improving the tumor targeting and safety of the engineered bacterium and providing a new technical approach and theoretical basis for tumor ultrasound imaging positioning and cancer treatment.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for constructing ultrasound-visualized tumor-targeting engineered bacteria and applications thereof. Background Art

[0002] In recent years, the application of bacterial therapy in cancer treatment has gained increasing attention. However, traditional bacterial therapies are plagued by drug leakage and difficulty in precise targeting. Ultrasound imaging, as a safe, noninvasive imaging technique with deep tissue penetration, holds great promise for its application. Combining ultrasound imaging with engineered bacteria can precisely localize engineered bacteria in vivo, providing support for precise drug release control. Currently, the biological components of ultrasound imaging are primarily gas vesicles, whose bubble walls are composed of protein and contain no lipids or carbohydrates. Gas vesicles were first discovered in cyanobacteria, with similar structures subsequently found in archaea and halophilic bacteria. The synthesis of gas vesicles relies on 8–14 different proteins, the genes encoding these proteins being present in acoustic reporter gene clusters. GvpA is the primary structural protein, present in nearly all acoustic reporter gene clusters. Previous studies have inserted acoustic reporter genes into plasmids and heterologously expressed them in Escherichia coli and Salmonella, enabling ultrasound visualization of engineered bacteria. However, plasmids carry the risk of horizontal transfer in vivo, and long-term stable expression of exogenous genes is difficult. Furthermore, the existing tumor-targeting strain VNP20009 still needs to be improved in terms of tumor colonization efficiency and safety. Therefore, it is of great significance to develop a stable ultrasound-visible tumor-targeting engineered bacterium for in vivo tumor diagnosis and precise drug delivery. Summary of the Invention

[0003] The present invention aims to provide a method for constructing an ultrasound-visualized tumor-targeting engineered bacterium and its application to address the aforementioned problems of the prior art. This method constructs an ultrasound-visualized tumor-targeting engineered bacterium by knocking an acoustic gene cluster into the htrA locus of the bacterial genome and regulating its expression via the pT7 promoter. Simultaneously, the T7RNAP gene, regulated by the plac promoter and CAP binding site, is inserted before the acoustic gene cluster to control the synthesis of gas vesicles. This method improves the tumor targeting and safety of the engineered bacterium, providing a new technical approach and theoretical basis for tumor ultrasound imaging localization and cancer treatment.

[0004] To achieve the above object, the present invention provides the following solutions:

[0005] The present invention provides a method for constructing an ultrasound-visualized tumor-targeting engineered bacterium, comprising connecting an acoustic gene cluster to a pT7 promoter, and inserting a T7 RNAP gene regulated by a plac promoter and a CAP binding site in front of the pT7 promoter to obtain an acoustic reporter element; and inserting the acoustic reporter element into the genome of a basal bacteria to construct the ultrasound-visualized tumor-targeting engineered bacterium.

[0006] Optionally, the acoustic gene cluster is an acoustic gene cluster derived from Anabaenaflos-aquae, Bacillus megaterium or Serratia sp. ATCC 39006.

[0007] Furthermore, the acoustic gene cluster includes double copies of gvpA gene, gvpC gene, gvpN gene, gvpF gene, gvpG gene, gvpL gene, gvpS gene, gvpK gene, gvpJ gene, gvpT gene and gvpU gene; the gvpA gene and gvpC gene are derived from Anabaenaflos-aquae, and the gvpN gene, gvpF gene, gvpG gene, gvpL gene, gvpS gene, gvpK gene, gvpJ gene, gvpT gene and gvpU gene are derived from Bacillus megaterium.

[0008] Furthermore, the process of connecting the acoustic gene cluster with the pT7 promoter is: connecting the double copies of the gvpA gene and the gvpC gene with the pT7 promoter to obtain a first acoustic genome; connecting the gvpN gene, gvpF gene, gvpG gene, gvpL gene, gvpS gene, gvpK gene, gvpJ gene, gvpT gene, and gvpU gene with another pT7 promoter to obtain a second acoustic genome; and connecting the first acoustic genome to the upstream of the second acoustic genome.

[0009] Furthermore, the insertion position of the acoustic reporter element on the chassis bacteria genome is the stress protein gene site.

[0010] Furthermore, the process of inserting the acoustic reporter element into the chassis bacteria genome is: connecting the acoustic reporter element, the sgRNA that recognizes the stress protein gene site and the plasmid carrying the Cas9 gene to construct a CRISPR-Cas9 plasmid; and transferring the CRISPR-Cas9 plasmid into the chassis bacteria.

[0011] Optionally, the stress protein gene includes the htrA gene.

[0012] Optionally, the chassis bacteria include attenuated Salmonella typhimurium VNP20009.

[0013] The present invention also provides ultrasound-visible tumor-targeting engineered bacteria constructed by the above construction method.

[0014] The present invention also provides the use of the above-mentioned ultrasound-visualized tumor-targeting engineered bacteria in the preparation of ultrasound imaging products.

[0015] The present invention also provides the use of the above-mentioned ultrasound-visualized tumor-targeting engineered bacteria in the preparation of a product for treating tumors. The product for treating tumors comprises an engineered bacteria using the above-mentioned ultrasound-visualized tumor-targeting engineered bacteria as a base bacteria and carrying a drug gene.

[0016] The present invention discloses the following technical effects:

[0017] The present invention knocks an acoustic gene cluster consisting of gvpA, gvpC, and gvpN-gvpU into the htrA site of the attenuated Salmonella typhimurium VNP20009 genome, and regulates its expression by the pT7 promoter. Simultaneously, the T7RNAP gene, regulated by the plac promoter and CAP binding site, is inserted before the acoustic gene cluster to control the synthesis of gas vesicles. The insertion of the acoustic gene cluster destroys the htrA gene, thereby improving the tumor targeting and safety of the engineered bacteria, ultimately successfully constructing an ultrasound-visualized tumor-targeted engineered bacterium.

[0018] The principle of using the engineered bacteria constructed by the present invention for tumor diagnosis and treatment is as follows Figure 1 As shown in the in vitro ultrasound contrast imaging mode, the ultrasound signal of the engineered bacteria is consistent with that of the strain carrying the acoustic gene cluster plasmid pTD-ARG1. While ensuring the ultrasound imaging effect, it solves the problems of plasmid transfer risk and the difficulty of long-term stability of exogenous gene expression. The engineered bacteria of the present invention can still stably synthesize gas vesicles after continuous passage and freezing and thawing; with 5×10 8 When 100 μL was injected into the tumor at a concentration of 5×10 8 When 100 μL of the engineered bacteria was injected into a tumor mouse model at a concentration of cfu / mL, ultrasound signals were observed within the mouse tumors four days after injection. The engineered bacteria of this invention demonstrated a 100-fold improvement in tumor targeting compared to VNP20009, and a 10-fold increase in the safe dose. Furthermore, the engineered bacteria of this invention are compatible with plasmids carrying drug genes, allowing them to simultaneously express and secrete drug proteins while synthesizing gas vesicles, achieving integrated tumor diagnosis and treatment. This invention provides a new technical approach and theoretical foundation for tumor ultrasound imaging and cancer treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0020] Figure 1 This is a schematic diagram of the ultrasound-visualized tumor-targeted engineered bacteria used for tumor diagnosis and treatment of the present invention;

[0021] Figure 2 The construction process and performance test results of the ultrasound-visualized tumor-targeted engineered bacteria in Example 1; wherein, A is the position of the acoustic gene cluster on the pTD103-ARG plasmid and the transmission electron micrograph of the gas vesicles synthesized by the engineered bacteria plasmid: ARG; B is the position of the acoustic gene cluster on the engineered bacteria genome: ARG-A1 and the transmission electron micrograph of the gas vesicles synthesized by the genome: ARG-A1; C is the transcription efficiency test results of gvpA and gvpN in the engineered bacteria plasmid: ARG and genome: ARG-A1; D is the position of the acoustic gene cluster on the engineered bacteria genome: ARG-A2 and the transmission electron micrograph of the gas vesicles synthesized by the genome: ARG-A2; E is the gvpA and gvpN in the engineered bacteria plasmid: ARG and genome: ARG-A2 N is the transcription efficiency test result; F is the location of the acoustic gene cluster on the engineered bacteria YQAP16 and the transmission electron micrograph of the gas vesicles synthesized by the engineered bacteria YQAP16; G is the transcription efficiency test result of gvpA and gvpN in the engineered bacteria plasmid: ARG and the engineered bacteria YQAP16; H is the ultrasonic signal of the engineered bacteria YQAP16, plasmid: ARG and the chassis bacteria VNP20009; I is the ultrasonic imaging result of the gas vesicles in the engineered bacteria YQAP16 before and after focused ultrasonic blasting; J is the ultrasonic imaging result before and after the injection of the engineered bacteria YQAP16 and the chassis bacteria VNP20009 into the tumor cells, and after the ultrasonic blasting; K is the ultrasonic imaging result before and after the tail vein injection of the engineered bacteria YQAP16 in the tumor mouse model, and after the ultrasonic blasting;

[0022] Figure 3The figures are the test results of the safety and tumor targeting of the ultrasound-visualized tumor-targeting engineered bacteria in Example 2; wherein, A is the survival curve of mice injected with different doses of the engineered bacteria YQAP16 and the chassis bacteria VNP20009; B is the weight change curve of mice injected with different doses of the engineered bacteria YQAP16 and the chassis bacteria VNP20009; C is the determination result of the residual amount of the engineered bacteria YQAP16 and the chassis bacteria VNP20009 in different organs; D is the determination result of inflammatory factors in the blood of mice after injection of the engineered bacteria YQAP16 and the chassis bacteria VNP20009; E is the determination result of the residual amount of the engineered bacteria YQAP16 and the chassis bacteria VNP20009 in different organs of tumor-bearing mice; F is the conversion result of the tumor targeting specificity of the engineered bacteria YQAP16 and the chassis bacteria VNP20009;

[0023] Figure 4 The following are the compatibility test results of the ultrasound-visualized tumor-targeted engineered bacteria with the therapeutic elements in Example 3; wherein, A is the genetic modification circuit diagram of the engineered bacteria carrying the therapeutic elements (nbPD1 and nbCTLA-4 nanobody elements); B is the measurement results of the nanobody protein expressed by the engineered bacteria TnbPD1 and TnbPD1-nbCTLA-4; C is a transmission electron micrograph of the gas vesicles synthesized by the engineered bacteria TnbPD1-nbCTLA-4; D is the measurement results of the transcription levels of key genes of the acoustic gene cluster in the engineered bacteria plasmid: ARG and genome: YQAP16T9 / plasmid: therapeutic element; E is the ultrasound imaging results of the gas vesicles in the engineered bacteria TnbPD1-nbCTLA-4 before and after focused ultrasound blasting;

[0024] Figure 5 The figure shows the therapeutic effect of tumor-targeted engineered bacteria carrying therapeutic elements on tumors visualized by ultrasound; A is a schematic diagram of the experimental process of engineered bacteria for treating tumors; B is the weight change curve of mice after injection of PBS, engineered bacteria YQAP16 and engineered bacteria TnbPD1-nbCTLA-4; C is the tumor volume growth curve of mice after injection of PBS, engineered bacteria YQAP16 and engineered bacteria TnbPD1-nbCTLA-4; D is a real picture of the tumor after injection of PBS, engineered bacteria YQAP16 and engineered bacteria TnbPD1-nbCTLA-4; E is the survival curve of mice after injection of PBS, engineered bacteria YQAP16 and engineered bacteria TnbPD1-nbCTLA-4; F is the measurement of nanoantibody protein expression in the tumors of mice injected with engineered bacteria YQAP16 and engineered bacteria TnbPD1-nbCTLA-4. DETAILED DESCRIPTION

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0027] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0028] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0029] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0030] The reagents and materials used in the following examples of the present invention are as follows:

[0031] Recombinase and high-fidelity DNA polymerase were purchased from Shanghai Yisheng Biotechnology Co., Ltd., agarose gel recovery kits and plasmid miniprep kits were purchased from Beijing Quanshijin Biotechnology Co., Ltd., all DNA and gene fragments were synthesized at Shanghai Sangon Biotechnology Co., Ltd., and antibiotics and other chemicals were purchased from Sigma-Aldrich. All plasmid constructions were performed in Escherichia coli DH5α. Plasmid pTD103-ARG1, carrying the acoustic gene cluster, was purchased from Addgene, USA. Plasmid pMA-thermal_CTLA-4, carrying the drug module, was purchased from Addgene, USA. Plasmid pSEX81 was purchased from PROGEN.

[0032] The DNA fragments to be amplified by polymerase chain reaction (PCR) in the following examples of the present invention were prepared using a PCR reaction system consisting of: 12.5 μL buffer, 10 μL ddH₂O, 0.5 μL dNTPs, 0.5 μL primers, 0.5 μL template, and 0.5 μL high-fidelity DNA polymerase. The PCR protocol was as follows: 98°C denaturation for 8 minutes, 95°C denaturation for 20 seconds, 56°C annealing for 20 seconds, and 72°C extension for 1 minute / 1000 bp. The 95°C denaturation and extension process was cycled 30 times, followed by 72°C extension for 10 minutes and cooling to 4°C. PCR products were recovered from gel using a gel recovery kit.

[0033] The homologous recombination reactions performed in the following examples of the present invention used a recombination reaction system consisting of 6 μL of homologous recombination enzyme, 4 μL of the target gene (if multiple gene fragments were present, the same volume of each gene fragment was added, for a total of 4 μL), and 2 μL of the plasmid backbone fragment. Recombination reaction conditions were as follows: incubate in a 50°C water bath for 25 minutes, incubate on ice for 5 minutes, add to DH5α competent cells, incubate on ice for 30 minutes, then heat shock at 42°C for 90 seconds. Incubate on ice for 3 minutes, then add 800 μL of LB medium, activate on a shaker at 37°C, 220 rpm for 1 hour, plate onto LB solid medium plates containing the corresponding antibiotics, and culture overnight at 37°C. Single clones were selected for sequencing verification.

[0034] The RED homologous recombination technology used in the following examples of the present invention is as follows: the target strain containing pKD46 is grown in LB medium containing 0.2% arabinose to an OD of 600 The concentration of the culture medium was approximately 0.6 (30°C, 220 rpm). Competent cells were prepared by washing three times with pre-cooled 10% glycerol. The DNA fragment to be knocked in was electroporated at an electric field strength of 12.5 kV / cm for 4 ms to transform into competent cells. The cells were activated at 37°C for 2.5 hours and the target strain was screened for resistance.

[0035] The principle of using the engineered bacteria constructed by the present invention for tumor diagnosis and treatment is as follows Figure 1 shown.

[0036] Unless otherwise specified, the reagents and materials involved in the following examples of the present invention can be purchased through conventional channels; the experimental procedures involved in the following examples of the present invention can be carried out using conventional methods in the art unless otherwise specified.

[0037] Example 1

[0038] In this example, Salmonella typhimurium VNP20009 was used as the base bacteria to construct ultrasound-visualized tumor-targeting engineered bacteria. The specific process is as follows:

[0039] 1. Using the CRISPR-Cas9 system to knock in acoustic gene clusters into bacterial genomes

[0040] Using plasmid pTD103-ARG1 as a template, primers ARGs-F1 / ARGs-R1 and ARGs-F2 / ARGs-R2 were used to amplify two pTD103-ARG1 plasmid fragments, which were then homologously recombined to construct plasmid pTD103-ARG without the gvpR gene.

[0041] Using the plasmid pTD103-ARG as a template, the acoustic gene cluster (including two copies of the gvpA, gvpC, gvpN, gvpF, gvpG, gvpL, gvpS, gvpK, gvpJ, gvpT, and gvpU genes) was amplified using F1 / R1 primers. During amplification of the acoustic gene cluster, the strong promoter ptac was added to regulate the expression of the entire gene cluster within the genome. The F1 / R1 primers contain partial sequences of the upper and lower homology arms for CRISPR-Cas9 knock-in. Overlapping PCR ligated the upstream homology arms, the amplified acoustic gene cluster, and the downstream homology arms to obtain the target fragment of the acoustic gene cluster and its upper and lower homology arms. A sgRNA was designed based on the htrA gene of the basal bacteria to cleave the htrA gene. The sgRNA, the acoustic gene cluster, and its target fragment of upper and lower homology arms were inserted into the pKC1139 plasmid vector carrying the Cas9 gene to construct the CRISPR-Cas9 plasmid.

[0042] The constructed CRISPR-Cas9 plasmid was electroporated into the VNP20009 strain and cultured at 37°C. The CRISPR-Cas9 plasmid cleaves a specific sequence in the htrA gene and simultaneously introduces an acoustic gene cluster containing upstream and downstream homologous sequences of htrA. This allows the bacteria with the cleaved genome to repair the nick through homologous recombination, ultimately knocking the acoustic gene cluster into the htrA locus of the VNP20009 genome and disrupting the htrA gene.

[0043] Upstream primer F2 was selected 100 bp upstream of the upstream homology arm of VNP20009, and downstream primer R2 was selected in the acoustic gene cluster gvpN to verify the success of the acoustic gene cluster knock-in. After the successful knock-in strain was subcultured to lose the plasmid, the engineered strain with the acoustic gene cluster knocked into the genome was obtained and named genome: ARG-A1.

[0044] The sequence involved in the above process is as follows:

[0045] ARGs-F1:cattatcttcacgtttgccttttagcgc(SEQ ID NO.1);

[0046] ARGs-R1:ctttattaaccaaagatactcacaaacaaatcctg(SEQ ID NO.2);

[0047] ARGs-F2:gtgagtatctttggttaataaagcgataagatggcaggaggaacgtaaaaatg(SEQ IDNO.3);

[0048] ARGs-R2:gcgctaaaaggcaaacgtgaagataatg(SEQ ID NO.4);

[0049] F1(5'-3'):

[0050] CTTTTTCCAGAAACTTTATTCCGGAACTTCGCGTTGACAATTAATCATCGGCTCGTATAATGGGAACGAAAACTCAGGGTTTTCCCAG(SEQ ID NO.5);

[0051] R1(5'-3'):

[0052] GTTTCACAGAAGTGTTGCCCCCTTCCATATGAAGGTTGCCTCTAGTTATGAACTCTTTTTA C(SEQID NO.6);

[0053] Height (5'-3'):

[0054]

[0055] Lower homology arm sequence (5'-3'):

[0056]

[0057] sgRNA recognition sequence (5'-3'): CGTCGTCACCAACAACCACG (SEQ ID NO. 9);

[0058] F2(5'-3'): CGGAAGATGCGGAAAGTCAGCC (SEQ ID NO. 10);

[0059] R2(5'-3'): CAGCACGCCTTCTTTCTAATATCGATAGAAAG (SEQ ID NO. 11).

[0060] In addition, the plasmid pTD103-ARG was transformed into the chassis bacteria VNP20009 by the heat shock method to obtain an engineered bacterium with the acoustic gene cluster knocked into the plasmid, which was named plasmid: ARG.

[0061] The transcription of the acoustic gene cluster in the engineered bacteria genome: ARG-A1 and plasmid: ARG was analyzed by transmission electron microscopy and transcriptional level. The results are as follows Figure 2 As shown in AC, it can be seen that after the acoustic gene cluster was knocked into the genome, its transcription level decreased significantly, resulting in a weakened ability of the engineered bacteria to synthesize gas vesicles.

[0062] 2. Optimization of acoustic gene cluster transcription

[0063] To enhance transcription of the acoustic gene cluster, a segmented expression strategy was employed, with gvpA and gvpN regulated by the ptac promoter, and gvpN-gvpU regulated by a separate ptac promoter. This resulted in the construction of the engineered bacterial genome, ARG-A2. The specific process involved amplifying the kanR resistance gene using the pET28a plasmid as a template. The upstream primers for this amplification incorporated homology arms and the ptac promoter, while the downstream primers were used to connect the gvpA and gvpC DNA fragments. Furthermore, double copies of gvpA and gvpC were amplified using pTD103-ARG1 as a template. The upstream primers for this amplification incorporated homology arms and the ptac promoter, while the downstream primers incorporated the terminator, the ptac promoter, and homology arms (partial gvpN sequence). The two amplified DNA fragments were subjected to overlapping PCR to generate the DNA-1 fragment to be knocked in. Using the engineered bacterial genome: ARG-A1 as the base bacteria, the DNA-1 fragment was knocked into the genome of the base bacteria using RED homologous recombination technology to obtain a new engineered bacterium, named genome: ARG-A2.

[0064] The sequence involved in the above process is as follows:

[0065] DNA-1 fragment (5'-3'):

[0066]

[0067] The transcription of the acoustic gene cluster in the engineered bacteria genome: ARG-A2 and plasmid: ARG was analyzed by transmission electron microscopy and transcriptional level. The results are as follows Figure 2 As shown in D and E, it can be seen that the genome: ARG-A2 has increased in both gas vesicle synthesis and gene transcription levels, but still has not reached the level of plasmid expression.

[0068] 3. Further optimization of acoustic gene cluster transcription

[0069] To further improve transcription efficiency and enable the expression of acoustic genes to be dynamically regulated by inducers, the promoter regulating the acoustic gene cluster was replaced from ptac to pT7, and the T7 RNAP gene sequence regulated by the CAP-plac promoter was knocked in to construct strain YQAP16. The specific process is as follows:

[0070] The aprR resistance gene was amplified using the pKC1139 plasmid as a template. The upstream primer for amplification contained a homology arm and the ptac promoter, while the downstream primer contained a terminator and a fragment for ligating the T7 RNAP DNA sequence. The T7 RNAP gene was amplified using Escherichia coli BL21 as a template. The upstream primer contained a fragment for ligating the aprR resistance gene, the plac promoter, and a CAP binding site, while the downstream primer contained a terminator, pT7, and a fragment for ligating gvpA and gvpC. Double copies of gvpA and gvpC were amplified using pTD103-ARG1 as a template. The upstream primer contained a fragment for ligating the T7 RNAP DNA fragment, while the downstream primer contained a terminator, pT7, and a homology arm (partial gvpN sequence). Finally, the three amplified DNA fragments were subjected to overlapping PCR to obtain the DNA-2 fragment to be knocked into the genome. Using the engineered bacterial genome: ARG-A2 as the base bacteria, the DNA-2 fragment was knocked into the genome of the base bacteria using RED homologous recombination technology to obtain a new engineered bacterium named YQAP16.

[0071] The sequence involved in the above process is as follows:

[0072] DNA-2 fragment (5'-3'):

[0073]

[0074] The transcription of acoustic gene clusters in the engineered bacteria YQAP16 and ARG was analyzed by transmission electron microscopy and transcriptional level. Figure 2 As shown in F and G, it can be seen that the gas vesicle synthesis level and gene transcription level of the engineered bacteria YQAP16 were greatly improved, reaching a level comparable to that of the plasmid expression in plasmid: ARG.

[0075] By comparing 1×10 9 The ultrasonic signals of the engineered bacteria YQAP16, plasmid ARG and chassis bacteria VNP20009 at a concentration of cfu / mL are as follows. Figure 2 As shown in H, it can be seen that YQAP16 has similar ultrasound output signals to the engineered bacteria carrying the plasmid plasmid: ARG at the same concentration. In addition, the gas vesicles in YQAP16 were blasted by focused ultrasound, as shown in Figure 2 As shown in Figure 1, the disappearance of the ultrasonic signal can be observed, confirming that the ultrasonic signal comes from the gas vesicles.

[0076] By injecting 100 μL of 5×10 8 cfu / mL of engineered bacteria YQAP16 and chassis bacteria VNP20009, as Figure 2 As shown in Figure 1, obvious ultrasound signals can be observed; after the same dose and concentration of YQAP16 were injected into the tail vein of the B16F10 tumor mouse model, as shown in Figure 1, Figure 2 As shown in Figure K, significant ultrasound signals were also detected at the tumor site on day 4.

[0077] Example 2

[0078] This example verifies the safety and tumor targeting of the engineered bacteria YQAP16 constructed in Example 1. The specific process is as follows:

[0079] 1. Using C57BL / 6 mice as experimental subjects, the engineered bacteria YQAP16 and chassis bacteria VNP20009 were injected through the tail vein to verify the tolerance dose of the engineered bacteria in mice. Figure 3 As shown in A and B, the injected dose is 2.5×10 7 -1×10 8 cfu / mouse, the mice injected with engineered bacteria YQAP16 did not die, and their body weight increased in the later period; while VNP20009 injected with 6.3×10 6 cfu / mouse, the mice died and their body weight continued to decrease.

[0080] Further testing of the residual status of engineered bacteria in various organs, such as Figure 3As shown in Figure C, one day after injection, the concentration of YQAP16 in various organs was approximately 10% of that of VNP20009, indicating that YQAP16 was more easily cleared; on the 7th day after injection, the colonization amount of YQAP16 in various organs was further reduced.

[0081] The levels of inflammation in mice were assessed by measuring the concentrations of TNF-α and IL-6 in the blood, and healthy mice not injected with engineered bacteria were used as controls (Blank). Figure 3 As shown in D, the inflammatory response induced by YQAP16 was significantly lower than that induced by VNP20009, and at an injection dose of 5×10 7 cfu / animal, the inflammation level remained at a low level.

[0082] 2. B16F10 tumor cells were inoculated into the upper armpits of C57BL / 6 mice and the tumor volume grew to 50-100 mm. 3 After that, tumor mouse models were established. 5×10 7 The tumor targeting ability of the engineered bacteria was verified by measuring the cfu / unit of the engineered bacteria YQAP16 and the chassis bacteria VNP20009. Figure 3 As shown in Figures E and F, in the tumor mouse model, the tumor colonization efficiency of YQAP16 was significantly lower than that of VNP20009. The colonization concentration of YQAP16 at the tumor site on the first day was less than 1×10 7 cfu / g, and then gradually increased to 1×10 8 cfu / g; while VNP20009 can reach 1×10 9 cfu / g. However, in non-tumor tissues, YQAP16 demonstrated stronger clearance efficiency. By calculating the ratio of colonization concentrations at the tumor site to those in the spleen or liver, the tumor-targeting specificity of YQAP16 was found to be approximately 100-fold higher than that of VNP20009. This indicates that the engineered bacterium YQAP16 possesses strong tumor-targeting specificity, reducing the residual engineered bacteria in non-target areas during ultrasound visualization, lowering background signal, and facilitating tumor site identification.

[0083] Example 3

[0084] This example verifies the compatibility of the engineered bacteria YQAP16 constructed in Example 1 with therapeutic elements (Therapy), and the therapeutic elements select drug modules expressing nbPD1 and nbCTLA-4 nanoantibodies. Figure 4 The genetic modification circuit diagram shown in A was used to construct an engineered bacterium carrying the nbPD1 and nbCTLA-4 nanoantibody elements. The specific process is as follows:

[0085] Using the pMA-thermal_CTLA-4 plasmid as a template, the replicon p15 was amplified using primers pMA-p15-ori-F and pMA-p15-ori-R. The resistance gene ampr was amplified using the pSEX81 plasmid as a template using primers pSEX-amp-F2 and pSEX-amp-R2. The thyA gene was amplified using the genome of Salmonella VNP20009 using primers thyA-pJ23115-F, thyA-pJ23115-R1, and thyA-pJ23115-R2. The promoter pRpL was amplified using the pBV220 plasmid as a template using primers pRpL-link-pMA-F and pRpL-link-pMA-R. The nbPD1 gene was synthesized. The five fragments were homologously recombined to generate the drug plasmid pMA-15thyA_nbPD1, which contains a single nbPD1 insertion.

[0086] Using pMA-15thyA_nbPD1 as a template, primers pMA-nbPD1-F and pMA-nbPD1-R were used to amplify the plasmid backbone containing thyA and nbPD1. Using the pMA-thermal_CTLA-4 plasmid as a template, primers CTLA4-link-pMA-PD1-F and CTLA4-link-pMA-PD1-R were used to amplify nbCTLA-4. The two fragments were homologously recombined to generate the drug plasmid pMA-15thyA_nbPD1_nbCTLA-4, which contains both nbPD1 and nbCTLA-4.

[0087] The kanR resistance gene was amplified using pET28a as a template. Homology arms were introduced into the upstream and downstream primers used for amplification, resulting in a DNA-3 fragment. Using the engineered strain YQAP16 as the base strain, the DNA-3 fragment was knocked into the genome of the base strain using RED homologous recombination technology, replacing the thyA gene in the YQAP16 genome. This resulted in a new engineered strain, designated YQAP16T9. The engineered strain YQAP16T9 was cultured in LB medium supplemented with 100 μg / mL adenosine until ready for use.

[0088] The drug plasmid pMA-15thyA_nbPD1 and the drug plasmid pMA-15thyA_nbPD1_nbCTLA-4 were respectively transferred into the engineered bacteria YQAP16T9 by the heat shock method to construct the engineered bacteria TnbPD1 and the engineered bacteria TnbPD1-nbCTLA-4.

[0089] The sequence involved in the above process is as follows:

[0090] pMA-p15-ori-F:gaccccgtagaaaaagatcaaaggatgatctcttgagatcgttttggtctgc(SEQ ID NO.14);

[0091] pMA-p15-ori-R:cataaaaaaacccgcttgcgggcttttcacactacgctcggtcgttcgactg(SEQ ID NO.15);

[0092] pSEX-amp-F2:ggatctcgaccgctgttgtttgtcggttaacgtcgacc(SEQ ID NO.16);

[0093] pSEX-amp-R2:ctgttgtttgtcggttaacgtcgacc(SEQ ID NO.17);

[0094] thyA-pJ23115-F:gacgctcaaagaggagaaatataccatgaaatacctgctgccgaccg(SEQ IDNO.18);

[0095] thyA-pJ23115-R1:

[0096] cccctcaagacccgtttagaggccccaaggggttatgctagttattgctcagcggtggttagatagcgaccggcgctttaatacc(SEQ ID NO.19);

[0097] thyA-pJ23115-R2:cacgcacggtgttagatatttatggatatagttcctccttcagcaaaaaacccctcaagacccgtttagagg(SEQ ID NO.20);

[0098] pRpL-link-pMA-F:cataaatatctaacaccgtgcgtgttgactattttacctctg(SEQ IDNO.21);

[0099] pRpL-link-pMA-R:ggtatttctctctctttgagcgtcaccttcatggtggtc(SEQ IDNO.22);

[0100] pMA-nbPD1-F: ctcacctcggtaccaaattccagaaaagagg (SEQ ID NO.23);

[0101] pMA-nbPD1-R: ctaacttacattaattgcgttgcgctcagtgatgatgatggtggtgaccacc (SEQ ID NO.24);

[0102] CTLA4-link-pMA-PD1-F:

[0103] catcatcatcactgagcgcaacgaaagaggagaaatttctaatgaaatacctgctgccgaccg (SEQ ID NO.25);

[0104] CTLA4-link-pMA-PD1-R: cttttctggaatttggtaccgaggtgagctaactcatgcgtagtcaggcacatcataggg (SEQ ID NO.26);

[0105] nbPD1 gene (5'-3'):

[0106] ATGAAATACCTGCTGCCGACCGCCGCTGCCGGTCTGCTGCTGCTGGCTGCTCAGCCGGCTATGGCTCAGGTTCAGCTGGTTGAATCTGGTGGCGGCTCTGTTCAGGCTGGTGGTTCTCTGCGTCTGTCTTGCGCTGCTTCTGGTTACGCTTCTTCTTCTTACTCTATGGGTTGGTTCCGTCAGGCTCCGGGTAAAGAACGTGAAGCTGTTGCTGGTGTTAACCGTGACGGTTCTACCCGTTACGCTGACTCTGTTAAAGGTCGTTTCACCATCTCTAAAGACAACGCTAAAAACACCCTGTACCTGCAGATGAACTCTCTGAAACCGGAAGACACCGCTATGTACTACTGCGCTGCTGACCGTGGTTGGGTTCTGCCGCGTCGTCCGGACTACTGGGGTCAGGGTACCCAGGTTACCGTTTCTTCTGGTGGTCTGCCGGAAACCGGTGGTCACCACCATCATCATCACTGA (SEQ ID NO.27);

[0107] DNA-3 fragment (5'-3'):

[0108] GAAACAGTATTTAGAACTGATGCAAAAAGTGCTCGACGAAGGCACACAGAAAAACGCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCGGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGTCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCGGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGTATGCCCGACGGCGAGGATCTCGTCGTGACCCACGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGAATCCATCTTCGACTACCGTTTCGAAGACTTTGAGATTGAAGGCTACGATCCGCATCCG(SEQ ID NO.28)。

[0109] The protein expression of engineered bacteria TnbPD1 and engineered bacteria TnbPD1-nbCTLA-4 was analyzed by western-blot. Figure 4 As shown in B, it can be seen that the engineered bacteria can normally express the nanoantibody drug protein. The gas vesicles synthesized by the engineered bacteria TnbPD1-nbCTLA-4 were further analyzed by transmission electron microscopy. Figure 4 As shown in C, it can be seen that the synthesis level of gas vesicles did not decrease after carrying the drug module; the results of gene transcription level analysis are as follows Figure 4 As shown in D, compared with the engineered bacteria plasmid:ARG, the transcription level of the key acoustic gene in the engineered bacteria TnbPD1-nbCTLA-4 (i.e., YQAP16T9 / plasmid:therapeutic element) did not decrease after carrying the drug module; the ultrasound imaging results showed that the strain carrying the drug module still had obvious ultrasound signals ( Figure 4 The above results show that the engineered bacteria constructed with engineered bacteria YQAP16 as the chassis bacteria can stably express the nbPD1-nbCTLA-4 nanoprotein, indicating that the engineered bacteria YQAP16 has excellent compatibility with the drug module and can be used to carry the drug module to achieve integrated diagnosis and treatment.

[0110] Example 4

[0111] This example verifies the therapeutic effect of the engineered bacteria TnbPD1-nbCTLA-4 constructed in Example 3 on tumors. The specific process is as follows:

[0112] according to Figure 5 As shown in Figure A, B16F10 tumor cells were inoculated into the upper armpits of C57BL / 6 mice and the tumor volume grew to 50-100 mm. 3 Afterwards, 5×10 7 The engineered bacteria YQAP16 or TnbPD1-nbCTLA-4 were injected at a dose of 100 cfu / mouse. An equal volume of PBS was injected as a control. To enhance colonization efficiency, the same dose of engineered bacteria or PBS was injected again the day after injection. Following the initial injection, mouse body weight and tumor volume were measured.

[0113] The results are as follows Figure 5 As shown in the BE, it can be seen that after the injection of engineered bacteria YQAP16, the weight of the mice did not decrease significantly, and the tumor growth was significantly inhibited, with an inhibition rate of 50%, indicating that the ultrasound-visualized engineered bacteria have a strong tumor inhibition effect when used alone. When the engineered bacteria TnbPD1-nbCTLA-4, that is, the engineered bacteria carry nbPD1 and nbCTLA-4 drugs, were injected, the tumor inhibition rate increased to 65%, and the survival time of the mice was more than doubled. Further drug analysis was performed by western-blot, and the results are shown as follows Figure 5As shown in F, it can be seen that the engineered bacteria TnbPD1-nbCTLA-4 can effectively express drug proteins in vivo.

[0114] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A method for constructing ultrasound-visualized tumor-targeting engineered bacteria, characterized in that: The pT7 promoter is sequentially connected to the double-copy gvpA gene and the gvpC gene to obtain a first acoustic genome; another pT7 promoter is sequentially connected to the gvpN gene, gvpF gene, gvpG gene, gvpL gene, gvpS gene, gvpK gene, gvpJ gene, gvpT gene and gvpU gene to obtain a second acoustic genome; the first acoustic genome is connected to the upstream of the second acoustic genome; A T7 RNAP gene regulated by a CAP binding site and a plac promoter is inserted before the pT7 promoter in the first acoustic genome to obtain an acoustic reporter element; the acoustic reporter element is inserted into the base bacteria genome to replace the htrA gene on the base bacteria genome, thereby constructing the ultrasound-visible tumor-targeting engineered bacteria; The base bacteria is attenuated Salmonella typhimurium ( Salmonella typhimurium )VNP20009.

2. The construction method according to claim 1, characterized in that The process of inserting the acoustic reporter element into the genome of the bottom bacteria is as follows: connecting the acoustic reporter element, the sgRNA that recognizes the stress protein gene htrA gene site, and the plasmid carrying the Cas9 gene to construct a CRISPR-Cas9 plasmid; and transferring the CRISPR-Cas9 plasmid into the bottom bacteria; The sgRNA recognition sequence is shown in SEQ ID NO.

9.

3. Ultrasound-visible tumor-targeting engineered bacteria constructed by the construction method according to claim 1 or 2.

4. Use of the ultrasound-visualized tumor-targeting engineered bacteria according to claim 3 in the preparation of ultrasound imaging reagents.

5. Use of the ultrasound-visualized tumor-targeting engineered bacteria according to claim 3 in the preparation of a drug for treating melanoma, characterized in that: The ultrasound-visualized tumor-targeted engineered bacteria described in claim 3 are used as the chassis bacteria, and the DNA-3 fragment is knocked into the genome of the chassis bacteria using RED homologous recombination technology to replace the thyA gene on the chassis bacteria genome, and at the same time, plasmids expressing nbPD1 and nbCTLA-4 are introduced into the engineered bacteria; The nucleotide sequence of the DNA-3 fragment is shown in SEQ ID NO.28; The nucleotide sequence of nbPD1 is shown in SEQ ID NO.27.

Images