Clostridium butyricum genetically engineered bacterium for producing 1, 3-propylene glycol as well as construction method and application of clostridium butyricum genetically engineered bacterium
By constructing the genetically engineered bacteria of Clostridium sarcoticus and introducing the 1,3-propylene glycol oxidoreductase-encoded gene yqhD, the high cost and low tolerance problems in the biological production of 1,3-propylene glycol were solved, and efficient and low-cost 1,3-propylene glycol was achieved.
Patent Information
- Application Number
- CN202510291379.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-12
- Publication Date
- 2025-06-13
AI Technical Summary
In the prior art, the biological method of producing 1,3-propylene glycol has problems such as high production cost, glycerol dehydrase dependence on expensive coenzyme B12, bacterial species have low tolerance to glycerol and low conversion rate, which limits the development of 1,3-propylene glycol fermentation of microbial fermentation.
By constructing a C., the exogenous 1,3-propylene glycol oxidoreductase-encoded gene yqhD was introduced into C., a 1,3-propylene glycol independent of coenzyme B12 was achieved, and the strain's tolerance and conversion rate to glycerol was improved.
It has achieved efficient production of 1,3-propylene glycol, reduced production costs, improved glycerol conversion rate, and overcome the problems of relying on expensive coenzymes and low tolerance in the original technology, which has high practicality and economic significance.
Smart Images

Figure CN120138013A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of bioengineering, and particularly relates to a Clostridium butyricum genetic engineering bacterium for producing 1,3 - propanediol, a construction method and an application thereof. Background Art
[0002] Glycerol is one of the main by - products in the production of biodiesel. For every 10 kg of biodiesel produced, 1 kg of crude glycerol will be generated. It is reported that it is expected to reach more than 5.87 billion pounds in 2020. If crude glycerol cannot be utilized and processed in a timely and effective manner, it may become a new pollution source. Therefore, it is urgent to produce glycerol into high - value - added products, and 1,3 - propanediol is a current research hotspot.
[0003] 1,3 - Propanediol (1,3 - PD) is an important platform chemical. It is widely used in fields such as food, medicine, cosmetics, and chemical industry as a solvent, antifreeze, additive, etc. For example, in the food field, 1,3 - propanediol is easy to dissolve food additives that are difficult to dissolve in water and can also be used as a food additive to improve the nutritional value, storage resistance, and stability of food; in the medical field, 1,3 - propanediol is used as a raw material for synthesizing various drugs such as immunosuppressants and sedatives; in the chemical industry, 1,3 - propanediol is mainly used for synthesizing new polyester fibers, making them have advantages such as good resilience and color fastness. In addition, 1,3 - propanediol is also used in agricultural production as a raw material for producing pesticides and insect repellents.
[0004] At present, 1,3 - propanediol can be synthesized by chemical and biological methods. However, the chemical synthesis method requires high temperature, high pressure, and expensive catalysts, with harsh production conditions, raw materials relying on non - renewable resources such as petroleum, and many by - products leading to difficult separation and purification and high production costs. In contrast, the biological production of 1,3 - propanediol has attracted much attention due to its mild conditions, environmental friendliness, and good selectivity. However, when producing 1,3 - propanediol by biological method, glycerol dehydratase depends on coenzyme B 12 , coenzyme B 12 is an expensive coenzyme, resulting in high production costs. In addition, there are also deficiencies in the microbial fermentation production of 1,3 - propanediol, such as low tolerance of the production strain to the substrate glycerol, low conversion rate of glycerol to 1,3 - propanediol, and accumulation of toxic intermediate product 3 - hydroxypropionaldehyde in the metabolic pathway, which severely restricts the development of microbial fermentation of 1,3 - propanediol. Therefore, it is necessary to develop a new genetic engineering bacterium for producing 1,3 - propanediol. Summary of the Invention
[0005] In view of some deficiencies in the prior art, the present invention provides a Clostridium butyricum genetic engineering bacterium for producing 1,3-propanediol, a construction method and an application thereof; the construction method of the Clostridium butyricum genetic engineering bacterium of the present invention includes: (1) constructing an expression vector of 1,3-propanediol oxidoreductase, transferring it into Escherichia coli containing a methylated plasmid, and obtaining a methylated 1,3-propanediol oxidoreductase expression plasmid; (2) electrotransforming the methylated 1,3-propanediol oxidoreductase expression plasmid into Clostridium butyricum to construct a Clostridium butyricum genetic engineering bacterium; the Clostridium butyricum genetic engineering bacterium of the present invention can directly use glycerol and corn steep liquor as a carbon source and a nitrogen source respectively to generate 1,3-propanediol, and it does not need to rely on expensive coenzyme B 12 , overcomes problems such as the low tolerance of production strains to the substrate glycerol and the low conversion rate of glycerol to 1,3-PD, and has good practicability.
[0006] In order to achieve the above technical objectives, the present invention adopts the following technical means:
[0007] The present invention first provides a construction method of a Clostridium butyricum genetic engineering bacterium for producing 1,3-propanediol, and the method includes:
[0008] (1) Construction of an expression vector of 1,3-propanediol oxidoreductase:
[0009] PCR amplifies the endogenous replicon pCB102 of Clostridium butyricum and replaces the pIM13 replicon on the plasmid pIMP1-Pthl to obtain the Clostridium butyricum expression plasmid pIMP1-pCB102;
[0010] PCR amplifies the Clostridium butyricum expression plasmid pIMP1-pCB102 and the 1,3-propanediol oxidoreductase encoding gene yqhD respectively, and then connects the Clostridium butyricum expression plasmid pIMP1-pCB102 and yqhD to obtain an expression vector of 1,3-propanediol oxidoreductase pIMP1-pCB102-yqhD;
[0011] (2) Preparation of methylated plasmid competent cells:
[0012] Reverse PCR processes the low-copy expression plasmid pKD46 induced by arabinose to obtain a linearized vector backbone;
[0013] PCR amplifies the kanamycin (Kan) antibiotic screening marker gene on the pANY plasmid, and uses seamless cloning technology to connect the linearized vector backbone with the Kan antibiotic screening marker gene to obtain the plasmid pKD46-Kan;
[0014] The plasmid pKD46-Kan was subjected to inverse PCR treatment and then ligated with the DNA methyltransferase gene in Clostridium butyricum to obtain the methylated plasmid pKD46-MTase;
[0015] The methylated plasmid pKD46-MTase was transformed into the host bacterium, induced to express, and then the bacterial cells were collected and competent cells were prepared by the CaCl 2 method to obtain methylated plasmid competent cells;
[0016] (3) Construction of a genetically engineered Clostridium butyricum strain producing 1,3-propanediol:
[0017] The 1,3-propanediol oxidoreductase expression vector pIMP1-pCB102-yqhD in step (1) was transformed into the methylated plasmid competent cells in step (2), and the plasmid was extracted to obtain the methylated 1,3-propanediol oxidoreductase expression plasmid;
[0018] The methylated 1,3-propanediol oxidoreductase expression plasmid was concentrated and then electrotransformed into Clostridium butyricum competent cells to obtain a genetically engineered Clostridium butyricum strain producing 1,3-propanediol.
[0019] Preferably, in step (1), the 1,3-propanediol oxidoreductase-encoding gene yqhD is derived from Escherichia coli W3110(DE3).
[0020] In step (2), the DNA methyltransferase gene includes M.6860p, M.7560p, M.5535p, M.6940p, and M.19970p, and its nucleotide sequence is as shown in SEQ ID NO.24-28.
[0021] Preferably, in step (2), the host bacterium includes Escherichia coli Top10.
[0022] The present invention also provides a genetically engineered Clostridium butyricum strain producing 1,3-propanediol constructed by the above method.
[0023] The present invention also provides the application of the above-mentioned genetically engineered Clostridium butyricum strain producing 1,3-propanediol in directly fermenting glycerol to produce 1,3-propanediol.
[0024] The present invention also provides a method for efficiently producing 1,3-propanediol, the method comprising: inoculating the secondary seed liquid of the above-mentioned genetically engineered Clostridium butyricum strain into a fermentation medium containing glycerol and fermenting to produce 1,3-propanediol.
[0025] Preferably, the method for obtaining the secondary seed liquid includes:
[0026] Inoculate the genetically engineered Clostridium butyricum strain into RCM medium and culture it overnight to obtain the primary seed solution;
[0027] Inoculate the primary seed solution into the seed medium and culture it overnight to obtain the secondary seed solution.
[0028] Preferably, the RCM medium comprises: beef extract 10 g / L, glucose 5 g / L, yeast extract 3 g / L, sodium acetate trihydrate 3 g / L, soluble starch 1 g / L, cysteine hydrochloride 0.15 g / L, NaCl 5 g / L, agar powder 15 g / L;
[0029] The seed medium comprises: glycerol 30 g / L, yeast extract 5 g / L, K 2 HPO 4 ·3H 2 O 2 g / L, KH 2 PO 4 1.5 g / L, (NH4) 2 SO 4 2 g / L, MgSO 4 ·7H 2 O 0.2 g / L, CaCl 2 ·2H 2 O 0.04 g / L, trace elements 1 ml / L, iron solution 1 ml / L.
[0030] Preferably, the fermentation medium containing glycerol comprises: glycerol, corn steep liquor, K 2 HPO 4 ·3H 2 O 2 g / L, KH 2 PO 4 1.5 g / L, (NH4) 2 SO 4 2 g / L, MgSO 4 ·7H 2 O 0.2 g / L, CaCl 2 ·2H 2 O 0.04 g / L, trace elements 1 ml / L, iron solution 1 ml / L;
[0031] The concentration of the corn steep liquor is 5 - 20 g / L, and the concentration of glycerol is 80 - 160 g / L.
[0032] Preferably, the concentration of the corn steep liquor is 10 g / L, and the concentration of glycerol is 120 g / L.
[0033] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0034] In the present invention, based on the strategy of simulating the DNA methylation pattern of target bacteria, the expression plasmid of Clostridium butyricum was methylated, overcoming the problem that foreign genes were cut by the restriction endonuclease system of Clostridium butyricum. For the first time, the expression plasmid of Clostridium butyricum was successfully transferred into Clostridium butyricum by electrotransformation, realizing the genetic manipulation of Clostridium butyricum.
[0035] In the present invention, overexpression of the exogenous 1,3-propanediol oxidoreductase-encoding gene yqhD in Clostridium butyricum was achieved, a genetically engineered strain of Clostridium butyricum was constructed, and the activity of 1,3-propanediol oxidoreductase in the glycerol disproportionation process was enhanced. At the same time, the genetically engineered strain of Clostridium butyricum constructed in the present invention contains a coenzyme B-independent 12 glycerol dehydratase, reducing production costs, and the bacterium is a non-pathogenic bacterium; relatively few by-products are produced during its fermentation production process, and no other alcohol compounds are produced, mainly some small molecule acids, which are convenient for later separation and purification.
[0036] The present invention explored replacing yeast extract in the fermentation medium with inexpensive biological waste corn steep liquor as a nitrogen source to achieve green and low-cost synthesis of 1,3-propanediol. In addition, on this basis, high-concentration glycerol was further utilized to achieve high-value utilization of the by-product glycerol of biodiesel, which conforms to the concept of green and sustainable development. Therefore, the present invention has great economic and practical significance.
[0037] The yield of 1,3-propanediol obtained by the batch fermentation method using glycerol and corn steep liquor as carbon and nitrogen sources respectively in the present invention reached 62.35 g / L, which was 18% higher than that of the original strain, and had a high substrate glycerol tolerance of up to 120 g / L; the conversion rate of 1,3-propanediol reached 50-65%, leading the current level of efficiently using glycerol to produce high-value products, effectively reducing the process cost and increasing the yield of 1,3-propanediol. Description of the Drawings
[0038] Figure 1 It is a diagram of the PCR amplification products of the pCB102 and the expression vector backbone of Clostridium butyricum described in the present invention.
[0039] Figure 2 It is a diagram of the digestion products of the exogenous 1,3-propanediol oxidoreductase expression gene yqhD and the expression vector of Clostridium butyricum described in the present invention; a in the figure is the yqhD gene, and b is the double digestion verification diagram of the pIMP1-pCB102-yqh recombinant plasmid.
[0040] Figure 3 It is the construction of the methylated plasmid; a in the figure is the pKD46 vector backbone and the Kan gene, b is the colony verification of the methylated plasmid, c is the 5 endogenous methyltransferases of Clostridium butyricum, and d is the double digestion verification diagram of the methylated recombinant plasmid.
[0041] Figure 4 Transfer and verification of the recombinant plasmid of 1,3 - propanediol oxidoreductase; in the figure, a is the colony PCR verification of the transfer of the 1,3 - propanediol oxidase plasmid into Clostridium butyricum, and b is the reverse transcription verification of the expression of 1,3 - propanediol oxidoreductase.
[0042] Figure 5 Enzyme activity determination of 1,3 - propanediol oxidase in Clostridium butyricum and the genetically engineered strain of Clostridium butyricum.
[0043] Figure 6 Yield of 1,3 - propanediol during fermentation at different concentrations of corn steep liquor.
[0044] Figure 7 Yield of 1,3 - propanediol during batch fermentation with different concentrations of glycerol and corn steep liquor. Specific implementation mode
[0045] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, but the protection scope of the present invention is not limited thereto. In the following embodiments, various processes and methods not described in detail are all conventional methods well known in the art. The sources, trade names of the reagents used, and those for which it is necessary to list their components are indicated when they first appear, and the same reagents used later are the same as those indicated for the first time without special instructions.
[0046] In the following embodiments, the Clostridium butyricum involved was constructed by the method described in the literature Yun J, Yang M, Magocha TA et al. Production of 1,3 - propanediol using a novel 1,3 - propanediol dehydrogenase from isolated Clostridium butyricum and cobiotransformation of whole cells [J]. Bioresource Technology, 2018, 247: 838–843.
[0047] Example 1: Construction of the expression vector of 1,3 - propanediol oxidoreductase
[0048] In this example, the resistance sensitivity test of Clostridium butyricum was first carried out, and then the expression vector of Clostridium butyricum was modified according to the test results, and further the expression vector of 1,3 - propanediol oxidoreductase was constructed. The specific steps are as follows:
[0049] S1. Resistance sensitivity test of Clostridium butyricum:
[0050] The Clostridium butyricum preserved at -80°C was inoculated into 5 mL of RCM medium and statically cultured in an anaerobic jar at 37°C for 12 h. Then, the cultured bacterial solution was respectively spread on RCM plates containing different concentrations of spectinomycin (Spec), chloramphenicol (Cm), and erythromycin (Em), and colony counting was performed after statically culturing in an anaerobic jar at 37°C for 48 h.
[0051] Among them, the concentrations of spectinomycin were 25 mg / L, 50 mg / L, 100 mg / L, and 150 mg / L respectively, the concentrations of chloramphenicol were 5 mg / L, 15 mg / L, 25 mg / L, and 50 mg / L respectively, and the concentrations of erythromycin were 5 mg / L, 10 mg / L, 15 mg / L, and 20 mg / L respectively.
[0052] The bacterial solution was diluted and spread on a plate without any antibiotics as a positive control, and colony counting was performed after culturing under the same conditions. The counting results showed that when the concentration of spectinomycin (Spec) was less than 50 mg / L and the concentration of chloramphenicol (Cm) was less than 25 mg / L, only a small number of colonies grew on the plate; when the concentration of erythromycin (Em) was less than 5 mg / L, no colonies grew on the plate; when the bacterial solution was spread on an antibiotic-free plate, colonies still grew after the bacterial solution was diluted 10 6 times. This indicates that Clostridium butyricum has a certain sensitivity to common antibiotics. Among them, erythromycin (Em) has the best resistance and is commonly used in the transformation of Clostridium. Therefore, Em was selected as the plasmid resistance marker.
[0053] S2. Modification of the Clostridium butyricum expression vector:
[0054] S21. The plasmid pIMP1-Pthl (purchased from Addgene: #90485) was selected as the expression vector, and primers pIMP1-up and pIMP1-dn were designed. The plasmid pIMP1-Pthl was amplified by primer PCR to obtain a PCR amplification product. Among them, the PCR reaction parameters were: pre-denaturation: 98°C, 3 min; denaturation: 98°C, 10 s; annealing: 56°C, 60 s; extension: 72°C, 45 s; final extension: 72°C, 10 min, for 35 cycles.
[0055] pIMP1-up: GTTTTTAACAAAATATATTGATA (SEQ ID NO.1);
[0056] pIMP1-dn: ATTCACAAAAAATAGGTACACG (SEQ ID NO.2).
[0057] The PCR amplification product was detected by agarose gel electrophoresis with a mass fraction of 1%, and an electrophoresis band with a size of approximately 4.0 Kb was obtained, as Figure 1As shown. It can be seen from the figure that Lane 2 is the product obtained by PCR amplification, and its size is consistent with the expected plasmid pIMP1-Pthl backbone (3973 bp). This indicates that the pIMP1-Pthl backbone has been obtained. The PCR amplification product was purified using a product purification kit to obtain the purified pIMP1-Pthl backbone.
[0058] S22. According to the characteristics of plasmid pIMP1-Pthl and the endogenous replicon pCB102 of Clostridium butyricum, primers pCB102-up and pCB102-dn were designed. Using the genomic DNA of Clostridium butyricum (Clostridium butyricum YJH-09, the screening method refers to Yun J, Yang M, Magocha T A et.al. Production of 1,3-propanediol using a novel
[0059] 1,3-propanediol dehydrogenase from isolated Clostridium butyricum and co-biotransformation of whole cells [J]. Bioresource Technology, 2018, 247: 838–843) stored in the laboratory through screening as the template, primers pCB102-up and pCB102-dn were used to PCR amplify the target gene pCB102. Among them, the PCR reaction parameters were: pre-denaturation: 98 °C, 3 min; denaturation: 98 °C, 10 s; annealing: 58 °C, 30 s; extension: 72 °C, 85 s; final extension: 72 °C, 10 min, for 35 cycles.
[0060] Among them, pCB102-up: TGTACCTATTTTTTGTGAAT CGATAATTTACAGAAAAGAAAATT (SEQ ID NO.3);
[0061] pCB102-dn: CAATATATTTTGTTAAAAA CTGCAGCACATTAAGTATATACTAT (SEQ ID NO.4);
[0062] The wavy line sequence is the homologous arm sequence of the pIMP1-Pthl plasmid, and the underlined sequence is the specific binding sequence of the replicon pCB102.
[0063] The product after PCR amplification was detected by 1% agarose gel electrophoresis, and an electrophoretic band with a size of approximately 1.5 Kb was obtained, as Figure 1As shown, Lane 1 is the product of PCR amplification, which is the same size as the expected target gene pCB102 (1485 bp), indicating that the replicon pCB102 is obtained.
[0064] The PCR amplification product was purified using a product purification kit to obtain the purified pCB102 replicon, and its nucleotide sequence is as shown in SEQ ID NO.5.
[0065] S23. The pIMP1-Pthl backbone obtained in step S21 and the pCB102 replicon obtained in step S22 were ligated according to the method of a one-step seamless cloning kit to construct the recombinant plasmid pIMP1-pCB102, which is the modified Clostridium butyricum expression vector.
[0066] S3. Construction of the 1,3-propanediol oxidoreductase expression vector:
[0067] S31. According to the coding gene yqhD of 1,3-propanediol oxidoreductase isozyme and the characteristics of the modified Clostridium butyricum expression vector pIMP1-pCB102 in step S2, primers yqhD-up and yqhD-dn were designed. Using the Escherichia coli W3110(DE3) genome as a template, the target gene yqhD was PCR amplified using primers yqhD-up and yqhD-dn. The PCR reaction parameters were as follows: pre-denaturation: 98 °C, 3 min; denaturation: 98 °C, 10 s; annealing: 58 °C, 30 s; extension: 72 °C, 30 s; final extension: 72 °C, 10 min, for 35 cycles.
[0068] yqhD-up: TTCAGGGGGGATCCACTAGT ATGAACAACTTTAATCTGCACAC (SEQ ID NO.6);
[0069] yqhD-dn: AACTGCAGGAGCTCCCATGGT TTAGCGGGCGGCTTCGTAT (SEQ ID NO.7), where the wavy line sequence is the homologous arm sequence of the pIMP1-pCB102 plasmid, and the underlined sequence is the yqhD-specific binding sequence.
[0070] The product after PCR amplification was detected by 1% agarose gel electrophoresis, and an electrophoresis band of about 1.5 Kb was obtained. As Figure 2 (a) shows, Lane 1 is the product obtained by PCR amplification, which is the same size as the expected target gene (1164 bp), indicating that the coding gene yqhD of 1,3-propanediol oxidoreductase isozyme is obtained.
[0071] S32. The modified Clostridium butyricum expression vector pIMP1-pCB102 was digested with BamH I and Kpn I to obtain a linear vector, which was then purified using a product purification kit to obtain the purified pIMP1-pCB102 backbone vector. The pIMP1-pCB102 backbone vector and the coding gene yqhD of 1,3-propanediol oxidoreductase isozyme were ligated according to the method of the one-step seamless cloning kit to construct the recombinant plasmid pIMP1-pCB102-yqhD.
[0072] After the recombinant plasmid pIMP1-pCB102-yqhD was digested with BamH I and Kpn I, two bands of 1.2 kb and 5.5 kb were obtained. After digestion verification, the electrophoresis results were as Figure 2 (b) shown. It can be seen from the figure that the digestion result was consistent with the expectation. The electrophoresis result preliminarily indicated that the yqhD gene had been successfully inserted into the expression vector pIMP1-pCB102, which indicated that the 1,3-propanediol oxidoreductase expression vector was successfully obtained.
[0073] Example 2. Preparation of methylated plasmid competent cells:
[0074] In this example, a methylated plasmid was first constructed and then transferred into E. coli Top10 competent cells to obtain methylated plasmid competent cells. The specific steps are as follows:
[0075] S1. Construction of methylated plasmid:
[0076] S11. According to the plasmid pKD46 (purchased from addgene) and its characteristics, primers Backbone-up and Backbone-dn were designed and synthesized using bioinformatics software. The plasmid pKD46 was amplified by PCR using these primers. The PCR reaction parameters were: pre-denaturation: 98 °C, 3 min; denaturation: 98 °C, 10 s; annealing: 58 °C, 30 s; extension: 72 °C, 90 s; final extension: 72 °C, 10 min, for 35 cycles.
[0077] Backbone-up: CTGTCAGACCAAGTTTACTCATATA (SEQ ID NO.8);
[0078] Backbone-dn: ACTCTTCCTTTTTCAATATTATTGAAG (SEQ ID NO.9).
[0079] The amplified product was detected by 1% agarose gel electrophoresis, and electrophoresis bands with sizes of approximately 5.5 kb were obtained ( Figure 3a), which is consistent with the theoretical size of plasmid pKD46 (5537 bp), indicating that plasmid pKD46 was successfully obtained.
[0080] S12. According to the kanamycin antibiotic marker on plasmid pANY1, primers Kan-up and Kan-dn were designed and synthesized using bioinformatics software, and these primers were used to PCR amplify the kanamycin antibiotic marker. The PCR reaction parameters were as follows: pre-denaturation: 98 °C, 3 min; denaturation: 98 °C, 10 s; annealing: 58 °C, 30 s; extension: 72 °C, 30 s; final extension: 72 °C, 10 min, for 35 cycles.
[0081] Kan-up: TATATGAGTAAACTTGGTCTGACAG TTAGAAAAACTCATCGAGCATCAAA (SEQ ID NO.10);
[0082] Kan-dn: GCTTCAATAATATTGAAAAAGGAAGAGT ATGAGCCATATTCAACGGGA (SEQ ID NO.11).
[0083] The amplified product was detected by 1% agarose gel electrophoresis, and electrophoresis bands with sizes of approximately 0.8 kb were obtained ( Figure 3 a), which is consistent with the theoretical size of the Kan gene (816 bp), indicating that the Kan gene was successfully obtained.
[0084] The amplified plasmid pKD46 and the Kan gene were assembled by Gibson assembly at 50 °C for 30 min using 2×MultiF Seamless Assembly Mix to obtain the recombinant plasmid pKD46-Kan, which is the methylation-modified plasmid.
[0085] S13. The methylation-modified plasmid was transformed into competent cells of E. coli Top10 (Invitrogen), spread on an LB-Kan resistant plate, and then some single colonies on the plate were picked. Colony PCR was performed using Kan-up and Kan-dn as primers, and the electrophoresis results were consistent with the expected results, indicating that the recombinant plasmid pKD46-Kan was successfully constructed ( Figure 3 b).
[0086] According to the gene sequences encoding methyltransferases of Clostridium butyricum published in The Restriction Enzyme Database (REBASE, http: / / rebase.neb.com / ), primers were designed using bioinformatics software (Table 1); pKD46-Kan was amplified by PCR using primers Backone-F and Backone-R, and the methyltransferase genes M.6860p (SEQ ID NO.24), M.7560p (SEQ ID NO.25), M.5535p (SEQ ID NO.26), M.6940p (SEQ ID NO.27), and M.19970p (SEQ ID NO.28) of Clostridium butyricum were amplified by PCR using the primers in Table 1. The PCR reaction parameters were as follows: pre-denaturation: 98°C, 3 min; denaturation: 98°C, 10 s; annealing: 58°C, 60 s; extension: 72°C, 30 - 60 s; final extension: 72°C, 10 min, for 35 cycles.
[0087] Backone-F: TTTTTATAACCTCCTTAGAGCTCGAAT (SEQ ID NO.12);
[0088] Backone-R: CGCATCCTCACGATAATATCCGG (SEQ ID NO.13).
[0089] Table 1. Design of primers for methyltransferases of Clostridium butyricum
[0090]
[0091] Note: The wavy line sequences are used for seamless cloning of homologous arm sequences, and the underlined sequences represent sequences specifically binding to the target genes.
[0092] The products after PCR amplification were detected by 1% agarose gel electrophoresis, and the detection results are as Figure 3 shown in c. It can be seen from the figure that a linear vector with a size of 4400 bp and five methyltransferase genes with sizes of approximately 760 bp, 760 bp, 1200 bp, 1500 bp, and 2100 bp were obtained, which is consistent with the theoretical sizes of the linear vector pKD46-Kan (4399 bp) and the methyltransferase genes (M.6860p: 756 bp), (M.7560p: 756 bp), (M.5535p: 1218 bp), (M.6940p: 1458 bp), (M.19970p: 2112 bp).
[0093] The linear vector pKD46-Kan was separately ligated with the methyltransferase gene fragment to construct pKD46-MTase. After double digestion of the recombinant pKD46-MTase with BmH I and Acc I, there were two bands, namely the vector backbone and the methyltransferase gene fragment. The enzyme digestion verification results were as Figure 3 shown in d, and the enzyme digestion results were consistent with the expectations. The electrophoresis results preliminarily indicated that the methyltransferase had been successfully inserted into pKD46-Kan, and the methylation-modified plasmid pKD46-MTase was successfully constructed. The recombinant methylation plasmids were named pKD-7560p, pKD-6860p, pKD-5535p, pKD-6940p, and pKD-19970p respectively.
[0094] S2. Preparation of competent cells of methylation-modified plasmids:
[0095] The 5 constructed pKD46-MTase methylation-modified plasmids were transferred into E.coli Top10 competent cells. When the OD 600 reached 0.2 - 0.3, 0.4% arabinose was added to induce the expression of its methyltransferase. After 1 - 2 h of induction, when the OD 600 reached 0.6 - 0.8, 5 kinds of competent cells containing methylation-modified plasmids were respectively prepared according to the method of standardized competent cell preparation.
[0096] Example 3. Construction of a genetically engineered Clostridium tyrobutyricum strain producing 1,3 - propanediol:
[0097] (1) The 1,3 - propanediol oxidoreductase expression plasmid pIMP1 - pCB102 - yqhD obtained in Example 1 was separately transferred into the 5 kinds of competent cells containing methyltransferase prepared in Example 2, and they were spread on a double - antibiotic plate of Kan - Amp - LB and cultured at 30 °C for 24 h. After the culture ended, single colonies were picked and cultured at 30 °C for 12 h to extract plasmids. During the culture of E.coli, the methyltransferase was expressed, and the shuttle - type pIMP1 - pCB102 - yqhD plasmid transferred into it was methylated. Since the replicon of the plasmid pKD46-MTase is a low - copy replicon, most of the plasmids extracted were the methylated Clostridium shuttle plasmids.
[0098] (2) The preserved Clostridium tyrobutyricum was anaerobically cultured in RCM medium until the OD value reached 0.8 - 1.0, and the cells were collected. Using an electroporation buffer (0.27 mol / L sucrose, 0.6 mmol / L Na 2 HPO 4 , 4.4 mmol / L NaH 2 PO 4 , 10 mmol / L MgCl 2) Wash twice, and finally resuspend the cells in buffer to obtain competent cells.
[0099] (3) Concentrate the methylated pIMP1-pCB102-yqhD plasmid extracted in step (1) to 4 μg / μL. Take 10 μL of the concentrated plasmid and mix it evenly with 190 μL of the competent cells prepared in step (2). Then add it to a 2 mm electroporation cuvette and incubate on ice for 10 min. Place the electroporation cuvette in the electroporator, set the electroporation voltage to 2.0 kv, and the electroporation time to 5 - 6 s. Then add 1 mL of RCM medium and recover at 37°C for 6 - 8 h. After centrifugation, collect the bacterial liquid and spread it on a resistance plate containing 20 mg / L of Em. Use 10 μL of sterilized water to replace the plasmid and electroporate Clostridium tyrobutyricum and spread it on the Em resistance plate as a negative control, and spread it on an RCM plate without antibiotics as a positive control. Check the growth of colonies on the plate after anaerobic culture at 37°C for 2 - 3 d.
[0100] When the methylated plasmid is transferred into Clostridium tyrobutyricum, only the plate after electroporation of the expression plasmid modified by pKD46-19970p expressing methyltransferase has 21 single colonies. Pick some of the colonies and perform PCR verification with yqhD-up and yqhD-dn as primers ( Figure 4 a), confirm that pIMP1-pCB102-yqhD has been successfully electroporated into Clostridium tyrobutyricum, is not interfered by the restriction endonuclease system, replicates autonomously, and successfully expresses the resistance gene.
[0101] Inoculate the colonies with successful verification into Em-RCM liquid medium and culture for 24 h; culture Clostridium tyrobutyricum in RCM liquid for 24 h, collect the cells respectively, extract RNA, and reverse transcribe it into cDNA. Use yqhD-up and yqhD-dn as primers to verify the expression of exogenous 1,3-propanediol oxidoreductase. The results are as Figure 4 shown in b. It can be seen from the figure that the target band appears in Lane 2, indicating that pIMP1-pCB102-yqhD has been successfully transferred into Clostridium tyrobutyricum and successfully expressed. This shows that a genetically engineered Clostridium tyrobutyricum strain producing 1,3-propanediol has been successfully constructed. The genetically engineered Clostridium tyrobutyricum strain producing 1,3-propanediol contains an expression plasmid modified by pKD46-19970p expressing methyltransferase.
[0102] Example 4. Determination of the enzyme activity of 1,3-propanediol oxidoreductase:
[0103] In this example, the original strain of Clostridium tyrobutyricum was used as a control group to determine the enzyme activity of 1,3-propanediol oxidoreductase of the genetically engineered Clostridium tyrobutyricum strain producing 1,3-propanediol obtained in Example 3. The specific steps are as follows:
[0104] Clostridium butyricum and genetically engineered Clostridium butyricum were cultured in RCM medium for 12 h to obtain the primary seed solution; the primary seed solution was transferred to glycerol medium and fermented for 12 h to obtain the secondary seed solution; the secondary seed solution was transferred to the fermentation medium and fermented for 24 h. After fermentation, 2 mL of the fermentation broth was taken, and the cells were collected by centrifugation at 12,000 rpm, resuspended and washed with 50 mmol / L Tris-HCl twice; the cells were disrupted by an ultrasonic disruptor under the treatment conditions of 300 W, pulse 1 s, interval 3 s, and treated for 15 min; the supernatant was collected after centrifugation at 12,000 rpm for 10 min, which was the crude enzyme solution.
[0105] The obtained crude enzyme solution was mixed with 100 mmol / L 1,3-PD or glycerol, 2 mmol / L NAD+, 2 mmol / L dithiothreitol, 100 mmol / L potassium carbonate (pH 9.0), and 30 mmol / L ammonium sulfate to obtain a reaction mixture, and then the 1,3-propanediol oxidoreductase activity of the reaction mixture was measured at 340 nm by spectrophotometry. The measurement results are as Figure 5 shown. It can be seen from the figure that compared with the original strain Clostridium butyricum (1.22 U / mg), the genetically engineered Clostridium butyricum producing 1,3-propanediol was increased by 2.12 times (2.58 U / mg).
[0106] Example 5. Optimization of the conditions for fermentative production of 1,3-propanediol:
[0107] In this example, the concentration of corn steep liquor in the medium for fermentative production of 1,3-propanediol by the genetically engineered Clostridium butyricum obtained in Example 3 was optimized, and glycerol and corn steep liquor were used as carbon and nitrogen sources for batch fermentation to produce 1,3-propanediol. The specific steps are as follows:
[0108] (1) Optimization of the corn steep liquor concentration:
[0109] The genetically engineered Clostridium butyricum was inoculated into RCM medium (beef extract 10 g / L, glucose 5 g / L, yeast extract 3 g / L, sodium acetate trihydrate 3 g / L, soluble starch 1 g / L, cysteine hydrochloride 0.15 g / L, NaCl 5 g / L, agar powder 15 g / L) and cultured for 12 h to obtain the primary seed solution.
[0110] The primary seed solution was inoculated into the seed medium (glycerol 30 g / L, yeast extract 5 g / L, K 2 HPO 4 ·3H 2 O 2 g / L, KH 2 PO 4 1.5 g / L, (NH4) 2 SO 42 g / L, MgSO 4 ·7H 2 O 0.2 g / L, CaCl 2 ·2H 2 O 0.04 g / L, trace elements 1 ml / L, iron solution 1 ml / L), and cultured overnight to obtain the secondary seed liquid.
[0111] Prepare fermentation media with different concentrations of corn steep liquor (CSL) at 2.5 g / L, 5 g / L, 10 g / L, 15 g / L, and 20 g / L (80 g / L glycerol, corn steep liquor, K 2 HPO 4 ·3H 2 O 2 g / L, KH 2 PO 4 1.5 g / L, (NH4) 2 SO 4 2 g / L, MgSO 4 ·7H 2 O 0.2 g / L, CaCl 2 ·2H 2 O 0.04 g / L, trace elements 1 ml / L, iron solution 1 ml / L), and use the fermentation medium with yeast extract replacing corn steep liquor as the control group.
[0112] Inoculate the genetically engineered Clostridium butyricum into different fermentation media and perform shake flask fermentation at 37 °C for 24 h. The fermentation results are as Figure 6 shown. It can be seen from the figure that the 1,3-PD production shows an upward trend with the increase of corn steep liquor. When the concentration of corn steep liquor is 10 g / L, the 1,3-PD production is the highest. When the concentration of corn steep liquor in the medium is 15 g / L and 20 g / L, the 1,3-PD production shows a downward trend instead, probably because the overly rich nutrient components in corn steep liquor affect the growth of the bacteria. Therefore, 10 g / L of corn steep liquor is selected to replace yeast extract for the synthesis of 1,3-PD.
[0113] (2) Batch fermentation of 1,3-propanediol using glycerol and corn steep liquor as carbon and nitrogen sources:
[0114] Take Clostridium butyricum stored in a -80 °C ultra-low temperature refrigerator, streak plate and anaerobically culture at 37 °C for 24 h; pick a single colony and inoculate it into 5 mL of RCM medium and anaerobically statically culture at 37 °C for 24 h to obtain the primary seed liquid. Inoculate the primary seed liquid into the seed medium at an inoculation amount of 5% and continue to culture until the exponential phase to obtain the secondary seed liquid.
[0115] Inoculate 500 mL of secondary seed liquid into a 10 L fermenter, and charge 5 L of fermentation medium into it. After sterilizing the fermenter and the medium, introduce nitrogen for 30 min, adjust the fermentation parameters, with an aeration rate of 0.1 vvm, a stirring rate of 200 rpm, and a temperature of 37 °C. During the fermentation process, add 5 mol / L NaOH dropwise to control the pH at 7.0. Take samples regularly, centrifuge at 8000 rmp for 10 min, and use the supernatant for glycerol. The concentrations of the substrate and metabolites are determined by the high-performance liquid chromatography (HPCL) method. The fermentation results are as Figure 7 shown.
[0116] As can be seen from Figure 7 it, when the glycerol concentration is 120 g / L and the corn steep liquor concentration is 10 g / L, the yield of 1,3-PD of the genetically engineered strain is 62.35 g / L, and the production intensity is 2.23 g / L / h, with a 18% increase in yield compared to the original strain.
[0117] In summary, the Clostridium butyricum genetically engineered bacterium of the present invention can directly utilize glycerol and corn steep liquor as a carbon source and a nitrogen source respectively to produce 1,3-propanediol, and it does not need to rely on expensive coenzyme B 12 , overcomes problems such as the low tolerance of the production strain to the substrate glycerol and the low conversion rate of glycerol to 1,3-PD, and has good practicability.
[0118] The described embodiments are the preferred embodiments of the present invention, but the present invention is not limited to the above embodiments. Without departing from the essence of the present invention, any obvious improvements, substitutions or modifications that those skilled in the art can make all fall within the protection scope of the present invention.
Claims
1. A method for constructing a genetically engineered bacterium of Clostridium butyricum that produces 1,3-propylene glycol, characterized in that: The method comprises: (1) Construction of 1,3-propanediol oxidoreductase expression vector: PCR amplified the endogenous replicon pCB102 of Clostridium butyricum, and made it replace the pIM13 replicon on the plasmid pIMP1-Pthl to obtain the Clostridium butyricum expression plasmid pIMP1-pCB102; The expression plasmid pIMP1-pCB102 of Clostridium butyricum and the gene yqhD encoding 1,3-propanediol oxidoreductase were amplified by PCR, and then the expression plasmid pIMP1-pCB102 of Clostridium butyricum and yqhD were connected to obtain the expression vector pIMP1-pCB102-yqhD of 1,3-propanediol oxidoreductase; (2) Preparation of methylation-modified plasmid competent cells: The arabinose-inducible low-copy expression plasmid pKD46 was treated with inverse PCR to obtain the linearized vector backbone; The Kan antibiotic selection marker gene on the pANY plasmid was amplified by PCR, and the linearized vector backbone was connected with the Kan antibiotic selection marker gene using seamless cloning technology to obtain the plasmid pKD46-Kan; The plasmid pKD46-Kan was treated by inverse PCR and then ligated with the DNA methyltransferase gene from Clostridium butyricum to obtain the methylation-modified plasmid pKD46-MTase; The methylation-modified plasmid pKD46-MTase was transformed into the host bacteria, induced to express, and then the bacteria were collected and prepared to be competent using the CaCl2 method to obtain methylation-modified plasmid competent cells; (3) Construction of genetically engineered Clostridium butyricum producing 1,3-propanediol: The 1,3-propanediol oxidoreductase expression vector pIMP1-pCB102-yqhD in step (1) is transformed into the methylation-modified plasmid competent cells in step (2), and the plasmid is extracted to obtain the methylation-modified 1,3-propanediol oxidoreductase expression plasmid; The methylated 1,3-propanediol oxidoreductase expression plasmid was concentrated and then electroporated into Clostridium butyricum competent cells to obtain Clostridium butyricum genetically engineered bacteria producing 1,3-propanediol.
2. The method for constructing a genetically engineered Clostridium butyricum bacteria producing 1,3-propylene glycol according to claim 1, characterized in that: In step (1), the 1,3-propanediol oxidoreductase encoding gene yqhD is derived from Escherichia coli W3110 (DE3).
3. The method for constructing the Clostridium butyricum genetically engineered bacteria producing 1,3-propylene glycol according to claim 1, characterized in that: In step (2), the DNA methyltransferase genes include M.6860p, M.7560p, M.5535p, M.6940p and M.19970p, and their nucleotide sequences are shown in SEQ ID NOs.24 to 28.
4. The method for constructing the Clostridium butyricum genetically engineered bacterium producing 1,3-propylene glycol according to claim 1, characterized in that: In step (2), the host bacteria includes Escherichia coli Top10.
5. The genetically engineered bacterium Clostridium butyricum producing 1,3-propanediol constructed by the method according to any one of claims 1 to 4.
6. Use of the genetically engineered Clostridium butyricum producing 1,3-propylene glycol according to claim 5 in direct fermentation of glycerol to produce 1,3-propylene glycol.
7. A method for efficiently producing 1,3-propylene glycol, characterized in that: The method comprises: inoculating the secondary seed liquid of the genetically engineered Clostridium butyricum according to claim 5 into a fermentation medium containing glycerol, and fermenting to produce 1,3-propanediol.
8. The method for efficiently producing 1,3-propylene glycol according to claim 7, characterized in that: The method for obtaining the secondary seed solution comprises: The genetically engineered Clostridium butyricum was inoculated into RCM medium and cultured overnight to obtain a first-level seed solution; The first-level seed solution is inoculated into the seed culture medium and cultured overnight to obtain the second-level seed solution.
9. The method for efficiently producing 1,3-propylene glycol according to claim 8, characterized in that: The RCM culture medium comprises: 10 g / L beef extract, 5 g / L glucose, 3 g / L yeast extract, 3 g / L sodium acetate trihydrate, 1 g / L soluble starch, 0.15 g / L cysteine hydrochloride, 5 g / L NaCl, and 15 g / L agar powder; The seed culture medium comprises: 30 g / L glycerol, 5 g / L yeast extract, 2 g / L K2HPO4·3H2O, 1.5 g / L KH2PO4, 2 g / L (NH4)2SO4, 0.2 g / L MgSO4·7H2O, 0.04 g / L CaCl2·2H2O, 1 ml / L trace elements, and 1 ml / L iron solution.
10. The method for efficiently producing 1,3-propylene glycol according to claim 8, characterized in that: The fermentation medium containing glycerol comprises: glycerol, corn steep liquor, K2HPO4·3H2O 2g / L, KH2PO4 1.5g / L, (NH4)2SO4 2g / L, MgSO4·7H2O 0.2g / L, CaCl2·2H2O 0.04g / L, trace elements 1ml / L, and iron solution 1ml / L; The corn steep liquor concentration is 5-20 g / L, and the glycerol concentration is 80-160 g / L.