Recombinant bacillus subtillis capable of producing vanillin at high yield and application of recombinant bacillus subtillis

Abstract

The invention relates to recombinant bacillus subtillis for chassis transformation and path optimization, can be used for efficient production of vanillin, and belongs to the technical field of metabolic engineering. According to the invention, bacillus subtillis 168 is taken as a starting strain, and gene segments from yhfM to yhfP (No.11 segment), from kinD to motA (No.20 segment) and VdhT on a genome are knocked out, so that a chassis bacterium bacillus subtillis Bs-1120V strain for high yield of vanillin is obtained. Through verification, the knockout of the No.11 fragment is beneficial to improving the accumulation capacity of the bacterial strain to vanillin, the knockout of the No.20 fragment is beneficial to improving the endurance capacity of the bacterial strain to vanillin, on the basis, the VdhT gene for converting vanillin into vanillic acid is further knocked out, and the production capacity of the obtained bacterial strain to vanillin is remarkably improved. According to the vanillin production strain Bs-1120V-EF constructed by taking Bs-1120V as a chassis bacterium, the yield of vanillin reaches 1.64 g / L in 24 hours under 3g / L of ferulic acid.

Description

Technical Field:

[0001] The present invention relates to a recombinant Bacillus subtilis for chassis modification and pathway optimization, which can be used for the efficient production of vanillin and belongs to the field of metabolic engineering. Background Art:

[0002] Vanillin (4-hydroxy-3-methoxybenzaldehyde), also known as vanillin or vanillic aldehyde, is an important component in vanilla products. As a broad-spectrum high-grade fragrance, vanillin is widely used in the food, tobacco, pharmaceutical, and chemical industries. In the food field, vanillin is used as a flavor additive with multiple functions due to its strong sweet taste and very rich creamy vanilla flavor.

[0003] Currently, the traditional methods for producing vanillin are plant extraction method and chemical synthesis method. Due to the long time-consuming process of conventional cultivation, harvesting, and maintenance of vanilla plants and their extremely low yields, the industrial application of plant extraction method is limited, and the price of natural vanillin obtained by this method is high. Through tissue culture technology, its production is not ideal either, and the yield is not high. Currently, 99% of the vanillin on the market is prepared by chemical synthesis method, and the main production raw materials are lignin and guaiac powder. Lignin and guaiac powder are widely available. Lignin can be hydrolyzed under alkaline conditions and then oxidized to obtain vanillin, and the yield of this process is about 10%; through the Riedel reaction method, guaiac powder is first synthesized with glyoxylic acid to form 3-methoxy-4-hydroxyphenylmandelic acid sodium salt, and then oxidized and acidified to generate vanillin. However, the chemical synthesis method has the disadvantages of expensive raw materials, complex process flow, poor substrate specificity, low stereoselectivity, high energy consumption, large pollution, and non-natural products. Since the use amount of chemically synthesized vanillin is strictly restricted by the European Union Expert Committee, people are becoming more and more interested in developing alternative, sustainable, and low-cost methods for producing natural vanillin. The biotransformation method mimics the way plants produce vanillin, and uses enzyme / microorganism catalytic process to convert natural substrates to prepare natural vanillin, which meets the food safety requirements for natural flavors of the European Union (EU) and the United States (FDA), and has become a research hotspot at home and abroad. In order to achieve the continuous supply of natural vanillin, it is urgent to construct a food-grade production strain with high vanillin yield.

[0004] Bacillus subtilis is a typical model industrial microorganism, which is recognized as a host strain with generally recognized as safe (GRAS), and is widely used in multiple fields including protease preparations, fine chemicals, nutritional products, and pharmaceuticals. Although Bacillus subtilis has good application prospects, the expression of non-essential genes and the accumulation of non-target chemicals in production applications result in the loss of precursor substances and the dispersion of metabolic flux in production applications, thus leading to the waste of resources and energy. Therefore, the redundancy of some non-essential genes in the chassis cells is one of the limiting bottlenecks in industrial applications. By knocking out some non-essential genes of Bacillus subtilis, it is possible to obtain a chassis bacterium that is simultaneously tolerant to vanillin and accumulates vanillin.

[0005] Based on the construction of vanillin-tolerant Bacillus subtilis and vanillin-accumulating Bacillus subtilis, the present invention constructs a Bacillus subtilis chassis bacterium that is simultaneously tolerant to vanillin and accumulates vanillin, constructs the vanillin production pathway for this chassis bacterium, and successfully obtains Bacillus subtilis that produces vanillin using ferulic acid as a substrate. On this basis, the vanillin production process is optimized to achieve an increase in vanillin production. Summary of the invention:

[0006] The purpose of the present invention is to provide a Bacillus subtilis chassis bacterium that is simultaneously tolerant to vanillin and accumulates vanillin, as well as a high-yield recombinant vanillin bacterium constructed therefrom, to overcome the problems of product intolerance, difficulty in accumulation, and unbalanced metabolic flux during the vanillin production process.

[0007] One of the technical solutions provided by the present invention is a method for increasing the vanillin production of Bacillus subtilis, which is achieved by knocking out at least one of the following fragments on the Bacillus subtilis genome:

[0008] (1) Knock out a sequence on the genome containing genes yhfM to yhfP;

[0009] (2) Knock out a sequence on the genome containing genes kinD to motA;

[0010] (3) Knock out a sequence on the genome containing VdhT;

[0011] Furthermore, the sequence of genes yhfM to yhfP is the sequence at positions 1102560bp - 1107516bp on the Bacillus subtilis genome NC_000964.3, as shown in SEQ ID NO.1 in the sequence listing;

[0012] Furthermore, the sequence of genes kinD to motA is the sequence at positions 1431486bp - 1435245bp on the Bacillus subtilis genome NC_000964.3, as shown in SEQ ID NO.2 in the sequence listing;

[0013] Furthermore, the VdhT, GeneID: 938788, is as shown in SEQ ID NO.3 of the sequence listing.

[0014] The second technical solution provided by the present invention is a recombinant Bacillus subtilis strain with high vanillin production. The recombinant strain is obtained by knocking out at least one of the following fragments on the genome using Bacillus subtilis 168 as the starting strain:

[0015] (1) Knock out a sequence on the genome containing genes yhfM to yhfP;

[0016] (2) Knock out a sequence on the genome containing genes kinD to motA;

[0017] (3) Knock out a sequence on the genome containing VdhT.

[0018] Preferably, the recombinant Bacillus subtilis strain with high vanillin production is obtained by knocking out the fragment of yhfM to yhfP shown in SEQ ID NO.1, the fragment of kinD to motA shown in SEQ ID NO.2, and the VdhT gene shown in SEQ ID NO.3 on the genome using Bacillus subtilis 168 as the starting strain, and is named Bacillus subtilis 1120V strain, Bs-1120V.

[0019] The third technical solution provided by the present invention is the application of the strain described in the second technical solution; in particular, the application in vanillin production; or the application as a chassis bacterium for vanillin or its derivative production strains;

[0020] Furthermore, the vanillin derivatives include but are not limited to: vanillic acid, vanillyl alcohol, ethyl vanillin, cinnamic acid, etc.

[0021] The fourth technical solution provided by the present invention is a recombinant Bacillus subtilis strain with high vanillin production. The recombinant strain is obtained by constructing a synthesis pathway from ferulic acid to vanillin using the above strain Bs-1120V as the chassis bacterium;

[0022] Furthermore, the synthesis pathway from ferulic acid to vanillin is achieved by expressing the feruloyl-CoA synthase gene fcs from Amycolatopsis sp. and the enoyl-CoA hydratase gene ech from Pseudomonas fluorescens in the Bs-1120V chassis bacterium;

[0023] Furthermore, the fcs gene, NCBI RefSeq: WP_020422604.1, has a nucleotide sequence as shown in SEQ ID NO.4;

[0024] Furthermore, the ech gene, GenBank: AAZ23790.1, has a nucleotide sequence as shown in SEQ ID NO.5;

[0025] Preferably, the high vanillin-producing strain obtained by expressing the fcs gene and the ech gene using Bs-1120V as the chassis bacterium is named the Bs-1120V-EF strain.

[0026] The fifth technical solution provided by the present invention is the application of the Bs-1120V-EF strain in the production of vanillin.

[0027] Beneficial effects:

[0028] In the present invention, Bacillus subtilis 168 is used as the starting strain, and the yhfM to yhfP (fragment 11), kinD to motA (fragment 20), and the VdhT gene fragment on the genome are knocked out to obtain the chassis bacterium Bacillus subtilis Bs-1120V strain with high vanillin production. After verification, the knockout of fragment 11 helps to improve the vanillin accumulation ability of the strain, and the knockout of fragment 20 helps to improve the vanillin tolerance ability of the strain. On this basis, the VdhT gene that converts vanillin into vanillic acid is further knocked out, and the vanillin production ability of the obtained strain is significantly improved. The vanillin-producing strain Bs-1120V-EF constructed with Bs-1120V as the chassis bacterium has a vanillin yield of 1.64 g / L at 24 h under 3 g / L ferulic acid. Description of the drawings:

[0029] Figure 1 Gel map of the construction of Bacillus subtilis Bs-1120V

[0030] Among them, Figure (a) is the colony PCR verification of the Bs-11 strain; Figure (b) is the colony PCR verification of the Bs-1120 strain; Figure (c) is the colony PCR verification of the Bs-1120V strain.

[0031] Figure 2 Vanillin yield map of Bacillus subtilis Bs-168-EF and Bs-11V-EF strains.

[0032] Figure 3 Vanillin production yield map of Bs-11V-EF and Bs-1120V-EF under the condition of 3 g / L ferulic acid concentration.

[0033] Figure 4 Effect of whole-cell catalysis on vanillin yield.

[0034] Figure 5 Comparison of the vanillin accumulation ability between wild-type Bacillus subtilis 168 and Bacillus subtilis Bs-11.

[0035] Figure 6 Tolerance Capacity Diagram of Bacillus subtilis Strain No. 20 to Vanillin

[0036] Among them, Figure (a) is the growth curves of Bacillus subtilis strain 168 and strain No. 20 under 2.5 g / L vanillin;

[0037] Figure (b) is the growth curves of Bacillus subtilis strain No. 20 under different concentrations of vanillin. Specific Embodiment:

[0038] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.

[0039] Unless otherwise specified, the materials, reagents, etc. used in the following examples can all be obtained from commercial channels.

[0040] The following examples are detailed descriptions and explanations of the technical solutions of the present invention and are not used to limit the present invention.

[0041] Table 1 Some Primers and Sequences Involved in the Embodiments of the Present Invention

[0042]

[0043]

[0044]

[0045] The Bacillus subtilis strain 168 in the present invention and its embodiments has been publicly disclosed in a large amount in the prior art. For example, it was disclosed in the literature "Harwood CR, Wipat A. Sequencing and functional analysis of the genome of Bacillus subtilis strain 168. FEBS Lett. 1996 Jun 24; 389(1): 84-7. doi: 10.1016 / 0014-5793(96)00524-8. PMID: 8682212." and is also a commonly used model bacterium in the field of biotechnology. The public can also obtain it from the Enzymology and Metabolic Engineering Laboratory of Beijing Institute of Technology.

[0046] The following further explains and illustrates the present invention through specific examples.

[0047] Example 1: Construction of Bacillus subtilis Production Chassis Bs-1120V

[0048] This example is used to illustrate the construction method of the Bacillus subtilis production chassis Bs-1120V.

[0049] (1) In this example, Bacillus subtilis 168 was used as the starting strain. A large fragment of 4,957 bp in length from yhfM to yhfP on the genome (the sequence shown in Sequence Listing SEQ ID NO.1, located at positions 1,102,560 bp - 1,107,516 bp on the genome NC_000964.3 of Bacillus subtilis 168), a large fragment of 3,760 bp in length from kinD to motA on the genome (the sequence shown in Sequence Listing SEQ ID NO.2, located at positions 1,431,486 bp - 1,435,245 bp on the genome NC_000964.3 of Bacillus subtilis 168), and VdhT (GeneID: 938788, SEQ ID NO.3) were knocked out to obtain the chassis strain Bacillus subtilis Bs - 1120V strain with high - yield vanillin (abbreviated as Bs - 1120V strain).

[0050] The genes and their functions contained in the regions of 1,102,560 bp - 1,107,516 bp, 1,431,486 bp - 1,435,245 bp knocked out on the genome of Bacillus subtilis 168 strain, and the VdhT fragment are specifically shown in Table 2 as follows:

[0051] Table 2

[0052]

[0053]

[0054] For the above - mentioned genomic fragments, the CRISPR / Cas9 technology was applied to construct a large - fragment deletion strain Bs - 1120V based on Bacillus subtilis 168 (Bs - 168) strain. The construction of Bs - 1120V requires three rounds of iterative knockout of the Bs - 168 strain.

[0055] Among them, in the first round, a sequence on the genome from yhfM to yhfP (as shown in SEQ ID NO.1 in the sequence listing, the sequence located at positions 1102560bp - 1107516bp on the Bacillus subtilis 168 genome NC_000964.3) was knocked out based on the Bs-168 strain to obtain the Bs-11 strain. See steps (2)-(14) for details; in the second round, a sequence on the genome from kinD to motA (as shown in SEQ ID NO.2 in the sequence listing, the sequence located at positions 1431486bp - 1435245bp on the Bacillus subtilis 168 genome NC_000964.3) was knocked out based on the Bs-11 strain to obtain the Bs-1120 strain; in the third round, the VdhT gene (GeneID: 938788, SEQ ID NO.3, VdhT is the gene in Bacillus subtilis that converts vanillin into vanillic acid, and knocking out VdhT is beneficial to the accumulation of vanillin) was knocked out based on the Bs-1120 strain to obtain the Bs-1120V strain. The specific steps are as follows:

[0056] (2) Construction of the CRISPR / Cas9 editing plasmid: The target gene sequence (1102560kb - 1107516kb) was input into the Zhang Feng laboratory website (https: / / zlab.bio / guide-design-resources) for prediction of N20 efficiency, and two N20 sequences, N20-1 and N20-2, were determined. Among them, the N20-1 sequence is: ctccttcaggcattgactcg; the N20-2 sequence is: tgagcccattcagagaacat. Primers Δ11-N20-1-1, Δ11-N20-1-2, Δ11-N20-2-1, and Δ11-N20-2-2 were designed. N20-1 is the overlapping region (overlap) of Δ11-N20-1-1 and Δ11-N20-1-2; N20-2 is the overlapping region (overlap) of Δ11-N20-2-1 and Δ11-N20-2-2.

[0057] Using the plasmid pJOE-8999 as a template, the editing plasmid pJOE-8999 was linearized by PCR reaction with primers CasA and Δ11-N20-1-1, and the PCR fragment size is 2270bp. CasB and Δ11-N20-1-2 are primers for introducing N20-1, and the PCR fragment size is 2309bp; Δ11-N20-2-2 and Δ11-N20-2-1 are primers for introducing N20-2, and the PCR fragment size is 3011bp. N20-1 and N20-2 were introduced into the plasmid pJOE-8999 to construct the knockout plasmid pJOE-8999-N20.

[0058] The PCR reaction system is as follows:

[0059]

[0060]

[0061] According to the system shown in the above table, configure the PCR reaction systems of the linear fragment 11-1 of the plasmid backbone, the linear fragment 11-2 with N20-1 introduced, and the linear fragment 11-3 with N20-2 introduced in the corresponding PCR tubes respectively. After shaking and mixing evenly, put them into the PCR instrument for PCR reaction. The PCR reaction program is as follows:

[0062]

[0063] (3) After the reactions of the three PCR systems are completed, the linear fragments 11-1, 11-2, and 11-3 are obtained. After agarose gel electrophoresis and comparison with the DNA Marker, the target-sized bands in the above table are obtained. The remaining reaction products in the PCR tubes are respectively subjected to DNA recovery to obtain the purified linear fragments of 11-1, 11-2, and 11-3.

[0064] (4) Ligate the three purified DNA fragments obtained. Add ligase to the PCR tube, 2 μL ddH 2 O, 1 μL of 11-1, 1 μL of 11-2, 1 μL of 11-3. After pipetting and mixing evenly, place it in a 50 °C constant temperature water bath for ligation. The ligation time is half an hour. The ligated product is pJOE-8999-N20 with N20-1 and N20-2 introduced.

[0065] (5) Transfer all 10 μL of the ligated product into 100 μL of JM109 competent cells with a pipette gun, place it on ice, and incubate on ice for 25 min. After the ice bath ends, place the centrifuge tube in a water bath at 42 °C for heat shock for 1 min 30 s. After the heat shock ends, place the centrifuge tube back on ice for an ice bath for 2 min. After the ice bath ends, add 900 μL of SOC medium to the centrifuge tube, then place it on a shaker at 37 °C, resuscitate at 220 r for 45 min, and then spread it on a kanamycin-resistant plate. The plate is placed in a 37 °C constant temperature incubator for overnight growth.

[0066] (6) On the second day, the colonies on the plate were verified by PCR (the verification primers were Δ11-Test-1 and Δ11-Test-2), and a band of about 1 kb was obtained, indicating the successful introduction of N20. Single colonies of the strains with successful introduction of N20 were picked and inoculated into 5 ml sterilized shaking tubes, 5 μL of kanamycin was added to 5 ml of LB medium, and they were placed in a shaking tube at 37 °C for overnight culture. The next day, a plasmid miniprep kit from TIANGEN was used for plasmid extraction to obtain pJOE-8999-N20.

[0067] (7) Plasmid pJOE-8999-N20 was used for the insertion of homologous arms. Using plasmid pJOE-8999-N20 as a template, first, a linear fragment N20-G of the double N20 backbone was amplified, and a repair template was introduced on this basis. Using the genome of Bacillus subtilis 168 as a template, the upstream and downstream homologous arms (11-5HA, 11-3HA) of the 4957 bp gene to be knocked out (the fragment from yhfM to yhfP on the genome) were obtained by PCR amplification with primers Δ11-HA-1 and Δ11-HA-2 and Δ11-HA-3 and Δ11-HA-4 respectively. Overlap PCR was used to splice the upstream and downstream homologous arms together to form a repair template. The PCR reaction system is as follows:

[0068]

[0069] According to the above table, the PCR reaction systems of the linear fragment N0-G of the double N20 backbone, the repair template 11-5HA, and the repair template 11-3HA were prepared in the corresponding PCR tubes respectively. After shaking and mixing evenly, they were placed in a PCR instrument for PCR reaction. The PCR reaction program of N20-G is as follows:

[0070]

[0071] The PCR reaction systems of 11-5HA and 11-3HA are as follows:

[0072]

[0073] (8) After the three PCR systems were reacted, linear fragments of N20-G, 11-5HA, and 11-3HA were obtained. After agarose gel electrophoresis and comparison with DNA Marker, the target-sized bands in the above table were obtained. The remaining reaction products in the PCR tubes were respectively subjected to DNA recovery to obtain purified linear fragments of N20-G, 11-5HA, and 11-3HA.

[0074] (9)Ligate the three purified DNA fragments obtained. Add ligase, 2 μL of ddH2O, 1 μL of N20-G, 1 μL of 11-5HA, and 1 μL of 11-3HA to a PCR tube. Mix well with a pipette tip and then place it in a 50°C constant temperature water bath for ligation for half an hour. The product after ligation is the knockout plasmid pCas11.

[0075] (10)Transfer all 10 μL of the product after ligation into 100 μL of JM109 competent cells using a pipette. Place it on ice and incubate on ice for 25 min. After the ice bath, place the centrifuge tube in a 42°C water bath for heat shock for 1 min 30 s. After heat shock, place the centrifuge tube back on ice for an ice bath for 2 min. After the ice bath, add 900 μL of SOC medium to the centrifuge tube, then place it on a 37°C shaker and resuscitate at 220 r for 45 min, and then spread it on a kanamycin-resistant plate. The plate is placed in a 37°C constant temperature incubator for overnight growth.

[0076] (11)Perform PCR verification on the colonies on the plate the next day (the verification primers are HA-5 and HA-3). A band of about 1966 bp in size is obtained, indicating that the repair template has been successfully introduced. Pick single colonies of the strains with the successfully introduced repair template and transfer them into a 5 ml sterilized shaking tube. Add 5 ml of LB medium and 5 μL of kanamycin, and place it in a 37°C shaking tube for overnight culture. The next day, use the TIANGEN plasmid miniprep kit to extract the plasmid to obtain the knockout plasmid pCas11.

[0077] (12)CRISPR / Cas9 induction and editing: Use a pipette to transfer 10 μL of the constructed editing plasmid pCas11 into Bacillus subtilis 168 competent cells. After resuscitating at 220 rpm in a 37°C shaker for 1 h, spread it on an LB plate containing 20 μg / mL of kanamycin resistance and 0.2% mannose, and then place it in a 30°C incubator for overnight culture.

[0078] (13)Detection of CRISPR / Cas9 gene editing results: On the LB editing plate containing kanamycin and mannose, randomly pick single colonies, and screen for positive clones by colony PCR using two pairs of internal and external primers designed for the deleted gene fragment. And perform Sanger sequencing to further verify the genome editing situation. The PCR reaction system is as follows:

[0079]

[0080] The PCR reaction system is as follows:

[0081]

[0082] The PCR products were subjected to agarose gel electrophoresis. When no band within 11 could be obtained from the same colony, but a band outside 11 with a size of 2.2 kb could be obtained, it indicated that the editing of the colony was successful. The verification results are as Figure 1 shown, Figure 1 (a) The upper figure shows the band 11-out obtained by PCR with external homologous arm primers, and the lower figure shows the band 11-in obtained by PCR with internal homologous arm primers. Among them, the first lane is the marker, and the second to the tenth lanes are the results of single colony PCR of the Bs-11 knockout strain. From Figure 1 the results, it can be seen that when performing PCR on 9 single colonies of the Bs-11 knockout strain, a 11-out fragment with a size of 2.2 kb could be obtained for all, and at the same time, no 11-in fragment could be obtained, indicating that the editing of these colonies was successful.

[0083] (14) Elimination of the editing plasmid: When gene editing is successfully completed, it is necessary to eliminate the editing plasmid in the bacteria for subsequent gene operations. Since the editing plasmid carries the temperature-sensitive Bacillus subtilis replication origin pE194ts, the loss of the editing plasmid can be achieved by increasing the culture temperature of Bacillus subtilis. Pick the correctly edited positive mutant and inoculate it into an antibiotic-free LB liquid medium, and culture it overnight in a shaker at 50 °C and 220 rpm. Dip an appropriate amount of the bacterial solution with a sterilized inoculation loop and streak it on an antibiotic-free LB agar plate, and incubate it at 42 °C until single colonies grow. The single colonies were simultaneously inoculated into LB liquid media containing kanamycin and antibiotic-free LB media respectively to verify whether the plasmid had been eliminated. When the same colony grew normally on the antibiotic-free LB plate but could not grow on the LB plate containing kanamycin, it indicated that the colony had successfully lost the editing plasmid. After losing the plasmid, the obtained strain was named Bacillus subtilis strain No. 11 (abbreviated as Bs-11 strain).

[0084] (15) Perform the second round of iterative knockout using the Bs-11 strain as the chassis strain: Knock out the 20th gene fragment (from kinD to motA, located at positions 1431486 bp - 1435245 bp on the genome, as shown in SEQ ID NO.2) on the basis of Bs-11. The specific knockout method is the same as the knockout construction method of the above Bs-11 strain, and only the corresponding primers need to be replaced. The specific primers are shown in Table 1) to obtain the Bs-1120 strain. Colony PCR verification is shown in Figure 1 (b), and the verification band for the 20-out fragment is 2.15 kb.

[0085] (16) The third round of iterative knockout was carried out using Bs-1120 strain as the chassis strain: VdhT is the enzyme gene in Bacillus subtilis that converts vanillin into vanillic acid. Knocking out VdhT is beneficial to the accumulation of vanillin. Therefore, the VdhT gene (located at 807091bp - 808548bp on the genome, except for using single N20, the specific knockout method is the same as that in Example 1, only the corresponding primers need to be replaced, and the specific primers are shown in Table 1) was knocked out on the basis of Bs-1120. After knocking out VdhT, the Bs-1120V chassis strain was obtained. The colony PCR verification is shown in Figure 1 (c), and the V-external fragment verification band is 1178kb. It was stored in a -80°C refrigerator.

[0086] (17) Using the same method as above, the VdhT gene was knocked out with Bs-11 strain as the chassis strain, and the obtained strain was named Bs-11V strain.

[0087] Example 2: Construction of vanillin-producing strains

[0088] In this example, Bs-168, Bs-11V, and Bs-1120V were used as chassis bacteria respectively, and vanillin-producing strains Bs-168-EF, Bs-11V-EF, and Bs-1120V-EF were constructed through transformation using ferulic acid as the substrate. The specific construction method is as follows:

[0089] (1) Construction of the vanillin-producing plasmid for the ferulic acid pathway: To synthesize vanillin from ferulic acid, it is necessary to express the feruloyl-CoA synthase gene fcs from Amycolatopsis sp. and the enoyl-CoA hydratase gene ech from Pseudomonas fluorescens. The sequences of the fcs gene from Amycolatopsis sp. (NCBI RefSeq: WP_020422604.1) and the ech gene from Pseudomonas fluorescens (GenBank: AAZ23790.1) were obtained from NCBI, and the gene sequence fragments of ech and fcs were obtained by gene synthesis. The ech, fcs, and pUC-19 were ligated by Gibson to construct the vanillin-producing plasmid pBAPEF for the ferulic acid pathway. The PCR reaction system is as follows:

[0090]

[0091]

[0092] According to the system shown in the above table, the plasmid backbone linear fragment EF-G, the PCR reaction system containing the ech gene fragment Ech, and the PCR reaction system containing the fcs gene fragment Fcs were respectively configured in the corresponding PCR tubes. After shaking and mixing evenly, they were put into a PCR instrument for PCR reaction. The PCR reaction program is as follows:

[0093]

[0094] (2) After the reactions of the three PCR systems were completed, fragments of EF-G, Ech, and Fcs were obtained. Agarose gel electrophoresis was performed on them respectively and compared with the DNA Marker to obtain the target-sized bands in the above table respectively.

[0095] (3) The remaining reaction products in the PCR tubes were respectively subjected to DNA recovery to obtain linear fragments of purified DNA amplification products, namely EF-G, Ech, and Fcs.

[0096] (4) Gibson ligation was performed on the three purified DNA fragments obtained: Ligase, 2 μL ddH2O, 1 μL EF-G, 1 μL Ech, and 1 μL Fcs were added to the PCR tube. After pipetting and mixing evenly, it was placed in a 50 °C constant temperature water bath for ligation. The ligation time was half an hour, and the ligated product was plasmid pBAPEF.

[0097] (5) The ligated product was transferred into 100 μL of JM109 competent cells: All 10 μL of the ligated product was transferred into 100 μL of competent cells and placed on ice. After ice-bathing for 25 min, the centrifuge tube was placed in a water bath at 42 °C for heat shock for 1 min 30 s. After heat shock, the centrifuge tube was placed back on ice for ice-bathing for 2 min. After ice-bathing, 900 μL of SOC medium was added to the centrifuge tube, and then it was placed on a shaker at 37 °C and recovered at 220 rpm for 45 min and then spread on a kanamycin-resistant plate. The plate was placed in a 37 °C constant temperature incubator and grown overnight.

[0098] (6) The next day, single colonies were picked for PCR to verify whether the plasmid was successfully constructed. The PCR reaction system was as follows:

[0099]

[0100] According to the system shown in the above table, the PCR reaction system for the EF fragment to verify whether the plasmid was successfully constructed was respectively configured in the corresponding PCR tubes. After shaking and mixing evenly, it was placed in a PCR instrument for PCR reaction. The PCR reaction program was as follows:

[0101]

[0102] After the PCR reaction was completed, agarose gel electrophoresis was performed and the bands were compared with the DNA Marker to obtain the target correct bands in the above table, that is, the vanillin-producing plasmid pBAPEF was successfully constructed.

[0103] (7) Take 10 μL of plasmid pBAPEF and transform it into 400 μL of competent cells of Bs-168, Bs-11V, and Bs-1120V respectively. Incubate on ice for 25 min, heat-shock in a 42 °C water bath for 1 min 30 s, then incubate on ice for 2 min. Then add 1 ml of SOC medium, recover at 37 °C with 220 rpm for 45 min, and evenly spread on an LB plate with kanamycin. Place it in a 37 °C incubator for overnight culture. The next day, pick single colonies on the plate for shaking culture and store them at -80 °C. Three vanillin-producing strains using ferulic acid as a substrate are obtained, namely Bs-168-EF, Bs-11V-EF, and Bs-1120V-EF.

[0104] Example 3: Production of vanillin using vanillin-producing strains Bs-168-EF and Bs-11V-EF

[0105] (1) Take out the vanillin-producing strains Bs-168-EF and Bs-11V-EF from the -80 °C refrigerator, streak them on kanamycin plates respectively, and place them in a 37 °C incubator for overnight culture.

[0106] (2) The next day, pick single colonies on the plates respectively and inoculate them into shaking tubes containing 5 ml of liquid LB medium and 5 μL of kanamycin. Place the shaking tubes in a 37 °C shaker and shake-culture at 220 rpm for 12 h as the seed liquid required for shake-flask fermentation.

[0107] (3) After 12 h, take 200 μL of the seed liquid and inoculate it into shake flasks containing 20 ml of liquid LB medium and 20 μL of kanamycin respectively. Seal the shake flasks with rubber bands and sealing films, and place them in a 37 °C shaker for overnight culture at 220 rpm. The next day, add the substrate ferulic acid to the shake flasks respectively to make the ferulic acid concentration in the fermentation broth 1 g / L. Then place them in a 30 °C shaker and shake-culture at 220 rpm.

[0108] (4) Sampling is carried out every 12 h, and the vanillin yield in the fermentation broth is detected by HPLC.

[0109] Sample treatment: Take 1 ml of the fermentation sample, centrifuge at 5000 g for 2 min, take the supernatant, filter it through a 0.22 μm filter membrane, and inject it into a brown liquid-phase vial with a syringe.

[0110] HPLC detection method: Chromatographic column: Gemini (5 μm NX-C18 150×4.6 mm), mobile phase is methanol / acetonitrile / 0.2% formic acid water (volume ratio is 15:15:70); flow rate is 1 mL / min; detection wavelength is 231 nm; column temperature is room temperature; injection volume is 5 μL, and the detection duration is 15 min.

[0111] (5) The results are as Figure 2As shown, the fermentation results indicate that when ferulic acid at 1 g / L is used as the substrate, the vanillin yield of strain Bs-168-EF at 12 h is 0.33 g / L and the conversion rate is 0.33 g / g; the vanillin yield of strain Bs-11V-EF at 12 h is 0.55 g / L and the conversion rate is 0.55 g / g. Both the yield and the conversion rate are significantly higher than those of strain Bs-168-EF. At 24 h, the vanillin yield of strain Bs-168-EF is 0.53 g / L and the conversion rate is 0.53 g / g; the vanillin yield of strain Bs-11V-EF is 0.58 g / L and the conversion rate is 0.58 g / g. It can be seen that compared with the control strain Bs-168, the Bs-11V chassis bacterium constructed in the present invention is a more suitable chassis bacterium for constructing vanillin-producing strains.

[0112] Example 4: Production of vanillin using vanillin-producing strains Bs-11V-EF and Bs-1120V-EF

[0113] Take out the frozen bacteria of Bacillus subtilis strains Bs-11V-EF and Bs-1120V-EF stored in a -80°C refrigerator, place them in an ice box or on ice, dip a small amount of bacterial liquid with an inoculation loop in a laminar flow hood, and streak plate on solid LB medium. Then place it in an incubator at 37°C and incubate overnight at a constant temperature until single colonies grow. Randomly pick single colonies from the plate, inoculate them into 20 mL of fresh LB medium, and place them in a shaker at 37°C and 220 rpm for overnight culture as the seed liquid. After 12 h, take 200 μL of the seed liquid and inoculate it into a shake flask containing 20 ml of liquid LB medium and 20 μL of kanamycin respectively. Seal the shake flask with a rubber band and sealing film and place it in a shaker at 37°C and 220 rpm for overnight culture. The next day, add the substrate ferulic acid to the shake flask to a final concentration of 3 g / L, and then place it in a shaker at 30°C and 220 rpm for shaking culture. Take samples every 12 h and detect the vanillin yield in the fermentation broth by HPLC.

[0114] The results are as Figure 3 , under 3 g / L ferulic acid, the 24-h vanillin yield of Bacillus subtilis Bs-11V-EF is 0.93 g / L and the conversion rate is 0.31 g / g; while the 24-h vanillin yield of Bacillus subtilis Bs-1120V-EF is 1.64 g / L and the conversion rate is 0.55 g / g. This result shows that compared with strain Bs-11V-EF, the vanillin-producing strain Bs-1120V-EF has a higher vanillin production capacity.

[0115] Example 5: Production of vanillin by whole-cell catalysis method

[0116] Take out the frozen bacteria of Bacillus subtilis Bs-11V-EF and Bs-1120V-EF strains stored in a -80°C refrigerator, place them in an ice box or on ice, and use an inoculation loop to dip a small amount of bacterial liquid onto a solid LB medium for streaking in a laminar flow hood. Then place it in an incubator at 37°C and incubate overnight at a constant temperature until single colonies grow. Randomly pick single colonies from the plate and inoculate them into 20 mL of fresh LB medium, and place them in a shaker at 37°C and 220 rpm for overnight culture as the seed liquid. After 12 h, take 200 μL of the seed liquid and inoculate it into a shake flask containing 20 ml of liquid LB medium and 20 μL of kanamycin respectively. Seal the shake flask with a rubber band and sealing film and place it in a shaker at 37°C and 220 rpm for overnight culture. The next day, centrifuge all the bacteria in the conical flask at 5000 rpm for 2 min to collect the bacteria, and resuspend the collected bacteria with PBS buffer to OD 600 = 20, and re-transfer them to the shake flask. Add ferulic acid as the substrate to the shake flask to a final concentration of 3 g / L, and then place it in a shaker at 30°C and 220 rpm for shaking culture. Take samples every 4 h and detect the vanillin production in the fermentation broth by HPLC.

[0117] The results are as Figure 4 shown. At 4 h, the vanillin production of Bacillus subtilis Bs-11V-EF was 0.82 g / L and the conversion rate was 0.27 g / g; the vanillin production of Bacillus subtilis Bs-1120V-EF was 1.39 g / L and the conversion rate was 0.46 g / g. At 12 h, the vanillin production of Bacillus subtilis Bs-11V-EF was 1.04 g / L and the conversion rate was 0.35 g / g; for Bacillus subtilis Bs-1120V-EF under 3 g / L ferulic acid, the vanillin production at 12 h was 1.59 g / L and the conversion rate was 0.53 g / g. This result once again shows that compared with the Bs-11V-EF strain, the vanillin-producing strain Bs-1120V-EF has a higher vanillin production capacity.

[0118] Example 6: Effect of knockout of fragment 11 on the vanillin accumulation ability of the strain

[0119] This example is used to illustrate that Bacillus subtilis Bs-11 strain can accumulate high concentrations of vanillin.

[0120] Randomly pick single colonies of Bacillus subtilis 168 and Bacillus subtilis Bs-11 from each plate respectively, inoculate them into 20 mL of fresh LB medium, and place them in a shaker at 37°C and 220 rpm for overnight culture as the seed liquid. The next day, inoculate them at 2% into 20 ml of fresh LB medium, and shake at 37°C until OD 600≈2.5, add vanillin to make its final concentration 1 g / L, transfer to a shaker at 30 °C and 220 rpm, take 1 mL of sample after culturing for 48 h, centrifuge the sample at 7000 rpm for 10 min, aspirate the supernatant with a disposable sterile syringe, filter through a 0.22 μm water membrane, and then perform high performance liquid chromatography (HPLC) detection.

[0121] The chromatographic detection conditions are as follows: chromatographic column: Gemini (5 μm NX-C18 150×4.6 mm), mobile phase: methanol / acetonitrile / 0.2% formic acid water (volume ratio 15:15:70); flow rate: 1 mL / min; detection wavelength: 231 nm; column temperature: room temperature; injection volume: 5 μL, detection duration: 15 min.

[0122] After detection, all data are statistically analyzed, and the results are as Figure 5 shown (in the figure, CK is the blank control without adding any strains, WT is the experimental group adding Bacillus subtilis 168, and 11 is the experimental group adding Bacillus subtilis Bs-11). By detecting the residual vanillin content in the medium after 48 h by HPLC, the vanillin accumulation ability of the modified strain is evaluated. The wild-type original strain (WT) only has 0.45 g / L of residual vanillin after 48 h, and 55% of the vanillin is decomposed, while the vanillin concentration in the medium of Bs-11 is significantly higher than that of the wild-type at 48 h, reaching 0.80 g / L, and only 20% is decomposed, indicating that Bs-11 belongs to the vanillin-accumulating type of Bacillus subtilis.

[0123] The above results show that the knockout of fragment 11 helps to improve the vanillin accumulation ability of the strain.

[0124] Example 7: Effect of knockout of fragment 20 on the vanillin tolerance ability of the strain

[0125] Using a method similar to that in Example 1, with Bacillus subtilis 168 strain as the chassis strain, knockout the 20th gene fragment (from kinD to motA, located at positions 1431486 bp - 1435245 bp on the genome, as shown in SEQ ID NO.2, and the specific knockout method is the same as the knockout construction method of the above Bs-11 strain, only need to replace the corresponding primers, and the specific primers are shown in Table 1) to obtain the Bs-20 strain.

[0126] This example is used to illustrate that Bacillus subtilis strain 20 can tolerate high concentrations of vanillin.

[0127] (1) Take out the frozen bacteria of Bacillus subtilis strain No. 20 and Bacillus subtilis 168 strain stored in a -80°C refrigerator respectively, place them in an ice box or on ice, dip a small amount of bacterial liquid with an inoculation loop in a laminar flow hood, and perform streak plating on a solid medium respectively. Then place them in an incubator at 30°C and incubate overnight at a constant temperature until single colonies grow. Randomly pick single colonies from each plate and inoculate them into 20 mL of fresh LB medium, place them at 37°C, and shake culture overnight at 220 rpm as the seed liquid. Add 20 ml of LB liquid medium to the shake flask, add an aqueous solution of vanillin to make its final concentration reach 2.5 g / L respectively. Inoculate the seed liquid into the medium with a vanillin concentration of 2.5 g / L, so that its initial OD 600 = 0.05, culture at 37°C on a 220 rpm shaker, and take samples for detection after culture. Within the first 12 h, take 200 μL of samples every three hours to measure OD 600 , and after 12 h, take samples at intervals of 9 h to measure OD 600 again. If the bacterial liquid is too concentrated, it needs to be diluted by a certain multiple. Set three parallel experiments for each experimental group and set a blank control overall.

[0128] The results are as shown in Figure 6 (a). Bacillus subtilis strain No. 20 can grow normally in the presence of vanillin at a concentration of 2.5 g / L, that is, a vanillin-tolerant strain is obtained. While the wild-type Bacillus subtilis 168 strain does not grow at all in the presence of 2.5 g / L vanillin.

[0129] (2) Vanillin tolerance of the vanillin-tolerant strain No. 20: According to the test method in step (1), set the vanillin concentrations to 2.5 g / L, 3 g / L, 3.5 g / L, 4 g / L, 4.5 g / L, and 5 g / L respectively, and measure the tolerance of strain No. 20 under different concentrations of vanillin. The results are as shown in Figure 6 (b).

[0130] As can be seen from Figure 6 (b), strain No. 20 can grow normally when the vanillin concentration is 4 g / L, its growth begins to be inhibited at 4.5 g / L, and its growth is completely inhibited at 5 g / L. Therefore, the vanillin-tolerant strain No. 20 can tolerate 4.5 g / L of vanillin.

[0131] The above results show that the knockout of the 20th fragment helps to improve the vanillin tolerance of the strain.

[0132] The 4957 bp large fragment located at positions 1102560 bp - 1107516 bp on the genome of Bacillus subtilis 168 described in the present invention is as shown in SEQ ID NO.1:

[0133]

[0134] The 3,760 bp large fragment located at positions 1,431,486 bp - 1,435,245 bp on the genome of Bacillus subtilis 168 according to the present invention is as shown in SEQ ID NO.2:

[0135]

[0136] The VdhT gene fragment of the present invention, with Gene ID 938788, is as shown in SEQ ID NO.3:

[0137]

[0138] The fcs gene of the present invention has a nucleotide sequence as shown in SEQ ID NO.4:

[0139]

[0140] The ech gene of the present invention has a nucleotide sequence as shown in SEQ ID NO.5:

[0141] ATGTCAAAATATGAAGGCAGATGGACAACAGTTAAAGTTGAAATTGAAGAAGGCATTGCATGGGTTATTCTGAATAGACCGGAAAAAAGAAATGCAATGTCACCGACACTGAATAGAGAAATGATTGATGTTCTGGAAACACTGGAACAAGATCCGGCAGCGGGCGTTCTGGTTCTGACGGGCGCGGGCGAAGCATGGACAGCGGGCATGGATCTGAAAGAATATTTTAGAGAAGTTGATGCGGGCCCGGAAATTCTGCAAGAAAAAATTAGAAGAGAAGCATCACAATGGCAATGGAAACTGCTGAGAATGTATGCGAAACCGACAATTGCAATGGTTAATGGCTGGTGCTTTGGCGGAGGCTTTTCACCGCTGGTTGCATGCGATCTGGCAATTTGCGCAGATGAAGCAACATTTGGCCTGTCAGAAATTAATTGGGGCATTCCGCCGGGCAATCTGGTTTCAAAAGCAATGGCAGATACAGTTGGCCATAGACAATCACTGTATTATATTATGACGGGCAAAACATTTGGCGGCCAAAAAGCAGCAGAAATGGGCCTGGTTAATGAATCAGTTCCGCTGGCACAACTGAGAGAAGTTACAATTGAACTGGCAAGAAATCTGCTGGAAAAAAATCCGGTTGTTCTGAGAGCAGCAAAACATGGCTTTAAAAGATGCAGAGAACTGACATGGGAACAAAATGAAGATTATCTGTATGCAAAACTGGATCAATCAAGACTGCTGGATACAGAAGGCGGCAGAGAACAAGGCATGAAACAATTTCTGGATGATAAATCAATTAAACCGGGCCTGCAAGCATATAAAAGATAA。

[0142] Although the present invention has been disclosed above in preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various changes, modifications, substitutions, and variations in form and detail to these embodiments without departing from the spirit and principles of the present invention. The scope of the present invention is defined by the claims and their equivalents.

Claims

1. A method for increasing the vanillin production of Bacillus subtilis, characterized in that, the method is achieved by knocking out at least one of the following fragments on the genome of Bacillus subtilis: (1) Knocking out a sequence on the genome containing genes yhfM to yhfP; (2) Knocking out a sequence on the genome containing genes kinD to motA; (3) Knocking out a sequence on the genome containing VdhT.

2. The method for increasing the vanillin production of Bacillus subtilis according to claim 1, characterized in that, the sequence of yhfM to yhfP is the sequence at positions 1102560bp - 1107516bp on the genome of Bacillus subtilis NC_000964.3, as shown in SEQ ID NO.1 in the sequence listing; the sequence of kinD to motA is the sequence at positions 1431486bp - 1435245bp on the genome of Bacillus subtilis NC_000964.3, as shown in SEQ ID NO.2 in the sequence listing; the VdhT, GeneID: 938788, as shown in SEQ ID NO.3 in the sequence listing.

3. A recombinant Bacillus subtilis strain with high vanillin production, characterized in that, the recombinant strain is obtained by using Bacillus subtilis 168 as the starting strain and knocking out at least one of the following fragments on the genome: (1) Knocking out a sequence on the genome containing genes yhfM to yhfP; (2) Knocking out a sequence on the genome containing genes kinD to motA; (3) Knocking out a sequence on the genome containing VdhT.

4. The recombinant Bacillus subtilis strain with high vanillin production according to claim 2, characterized in that, the recombinant Bacillus subtilis strain with high vanillin production is obtained by using Bacillus subtilis 168 as the starting strain and knocking out the fragment of yhfM to yhfP shown in SEQ ID NO.1, the fragment of kinD to motA shown in SEQ ID NO.2, and the VdhT gene shown in SEQ ID NO.3, and is named Bacillus subtilis Bs - 1120V strain.

5. The application of the strain according to claim 3 or 4.

6. The application according to claim 5, characterized in that, it is the application in vanillin production, or the application as the chassis bacterium for the strain producing vanillin or its derivatives.

7. The application according to claim 6, characterized in that, the vanillin derivatives include, but are not limited to: vanillic acid, vanillyl alcohol, ethyl vanillin, cinnamic acid.

8. A recombinant Bacillus subtilis strain with high vanillin production, characterized in that, the recombinant strain is obtained by using strain Bs - 1120V as the chassis bacterium and constructing a synthesis pathway from ferulic acid to vanillin.

9. The recombinant Bacillus subtilis strain with high vanillin production according to claim 8, characterized in that, The synthesis pathway from ferulic acid to vanillin is achieved by expressing the feruloyl-CoA synthase gene fcs from Amycolatopsis sp. and the enoyl-CoA hydratase gene ech from Pseudomonas fluorescens in the chassis bacterium Bs-1120V; The fcs gene has a nucleotide sequence as shown in SEQ ID NO.4; The ech gene has a nucleotide sequence as shown in SEQ ID NO.

5.

10. Use of the strain according to claim 8 or 9 in the production of vanillin.

Images