Reagent and kit for detecting canine mycoplasma nucleic acid and application of reagent and kit

Abstract

The invention provides a reagent and a kit for detecting canine mycoplasma nucleic acid and application of the reagent and the kit. The reagent comprises a first region for detecting the mycoplasma canine, and the first region is selected from any fragment in SEQ ID NO: 1. By applying the reagent or the kit provided by the invention, the canine mycoplasma can be quickly, efficiently, sensitively and accurately identified.

Description

Technical Field

[0001] This application relates to the field of detection of Mycoplasma cynos, and in particular, to a reagent, a kit for detecting Mycoplasma cynos nucleic acid and their applications. Background Art

[0002] Mycoplasma belongs to a class of prokaryotic cell-type microorganisms that lack cell walls, are highly pleomorphic, can pass through bacteriological filters, and can replicate automatically. They belong to the kingdom Bacteria, phylum Firmicutes, class Mollicutes, order Mycoplasmatales, family Mycoplasmataceae, and genus Mycoplasmopsis. They are widely present in the mucosae of animals. The only visible organelle in mycoplasma cells is the ribosome (mycoplasma is a prokaryotic cell, and the only organelle in prokaryotic cells is the ribosome). The genome of mycoplasma is extremely small, and the cells can replicate themselves, about 0.3 - 0.8 μm in size, and their growth depends on nutrients in the environment. Mycoplasma can infect many animals, including dogs, poultry, pigs, ruminants, humans, and reptiles. Since mycoplasma can also be isolated from the upper respiratory tracts of normal healthy animals, it is relatively difficult to evaluate the impact of mycoplasma on the upper respiratory tracts of animals. Among them, the main mycoplasma subspecies that infect dogs are: Mycoplasmopsis canis, Mycoplasmopsis cynos, Mycoplasmopsis opalescens, Mycoplasmopsis maculosa, Mycoplasmopsis edwardii, Mycoplasma mucosicanis. Among them, Mycoplasmopsis canis is the main subspecies that infects dogs.

[0003] Mycoplasma cynos mainly causes canine respiratory diseases, urogenital diseases, anemia, arthritis, and colitis. Mycoplasma often co-infects or secondary infects with other bacteria or viruses, and exacerbates the disease symptoms. If not treated in time, it will cause the spread of pathogens and damage to other tissues and organs. Research shows that the detection rate of Mycoplasma cynos in genital tract infections is 30% - 50% in male dogs and 23% - 75% in female dogs. Mycoplasma has a huge impact on the pet dog and meat dog breeding industries and poses a potential hazard to people who eat dog meat for a long time. Therefore, it is particularly important to be able to diagnose early whether a dog is infected with mycoplasma.

[0004] The detection methods of Mycoplasma cynos mainly include isolation and culture, serological methods, conventional PCR methods, etc. The most reliable method for detecting Mycoplasma cynos is to isolate Mycoplasma from samples. However, the isolation of Mycoplasma cynos is time-consuming, with poor sensitivity, extremely demanding nutritional requirements, slow growth in vitro culture, long time consumption, and is easily contaminated by other pathogenic microorganisms. Therefore, the traditional isolation and culture method cannot meet the needs of clinical diagnosis. There are cross-reactions between serological detection methods and other Mycoplasmas, which brings difficulties to the differential diagnosis of Mycoplasma cynos. The sensitivity of conventional PCR detection technology is not high, it is easily contaminated by the environment, and the PCR process cannot be monitored in real time. At present, the research on Mycoplasma cynos in China is still blank, and there is an urgent need to establish a rapid, accurate and highly sensitive detection method. With the rapid development of modern molecular biology technology, real-time fluorescence quantitative PCR detection technology has filled the defects of the above methods, with high sensitivity, good specificity, less sample consumption, and can directly detect the PCR amplification process in real time, making it an effective method for detecting microorganisms. Summary of the Invention

[0005] The main purpose of this application is to provide a reagent, kit and its application for detecting Mycoplasma cynos nucleic acid, so as to solve the problem of low specificity of the detection results of Mycoplasma cynos in the prior art.

[0006] To achieve the above object, according to the first aspect of the present application, a reagent for detecting the first region of Mycoplasma cynos nucleic acid is provided, and the first region is selected from any fragment in SEQ ID NO: 1.

[0007] Further, the first region is selected from any fragment between the (1-3)-(89-91)th bases in SEQ ID NO: 1.

[0008] Further, the above reagent includes a primer pair, and the nucleotide sequence of the primer pair has a nucleotide sequence complementary or identical to 22-29 consecutive nucleotides between the (1-3)-(89-91)th bases in SEQ ID NO: 1.

[0009] Further, the primer pair is selected from the nucleotide sequences shown in SEQ ID NOs: 2 and 4; preferably, the reagent further includes a probe, and the probe is selected from the nucleotide sequence shown in SEQ ID NO: 6; wherein, SEQ ID NO: 2 is 5'-GTTTCAATCGCTCAAAAACGTAAAATC-3', SEQ ID NO: 4 is 5'-GGTAAAACRATTGAAATAACCCCTTTG-3', R = A or G, SEQ ID NO: 6 is 5'-TTCCATGRCGACCRGCCATCTTATCACC-3', R = A or G.

[0010] Furthermore, the 5'-end and 3'-end of the probe respectively have a fluorescent reporter group and a fluorescent quenching group; preferably, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, AlexaFluor633, Cy5, Quasar 670, Cy5.5 or Cy7; the fluorescent quenching group is selected from BHQ, TAMRA, Dabcyl or Eclipse; more preferably, the 5'-end of the probe is a FAM group and the 3'-end is a BHQ1 group.

[0011] To achieve the above object, according to the second aspect of the present application, a kit is provided, which includes any one of the above reagents for detecting Mycoplasma cynos nucleic acid in a test sample.

[0012] Furthermore, the kit further includes at least one of the following: a qPCR premix, the qPCR premix includes a qPCR buffer and AK Taq DNA polymerase, preferably, the concentration of AK Taq DNA polymerase is 25 U / μL.

[0013] According to the third aspect of the present application, a method for fluorescence quantitative PCR detection of Mycoplasma cynos is provided, and fluorescence quantitative PCR detection is performed using any one of the above reagents or any one of the above kits.

[0014] Furthermore, the conditions for fluorescence quantitative PCR detection are: reverse transcription at 48-52 °C (preferably 49-51 °C) for 180 s-300 s (preferably 240 s-300 s), pre-denaturation at 92-98 °C (preferably 95-98 °C) for 30 s-90 s (preferably 30 s-60 s); denaturation treatment at 92-98 °C (preferably 95-98 °C) for 2-8 s (preferably 2-5 s), annealing at 58-62 °C (preferably 60-62 °C) for 30-40 s (preferably 30-35 s) and collecting fluorescence signal processing, for a total of 40-44 cycles.

[0015] According to one aspect of the present application, there is provided the use of any one of the above reagents or kits in the detection of Mycoplasma cynos.

[0016] Applying the technical solution of the present application, the reagent for detecting Mycoplasma cynos nucleic acid of the present application has high specificity for Mycoplasma cynos and also has higher sensitivity. Therefore, compared with the existing detection reagents, it has significant advantages of rapidity, high efficiency, sensitivity and accuracy in the identification of Mycoplasma cynos. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] To more clearly illustrate the technical solutions of the embodiments of the present application, the following will briefly introduce the attached drawings required for the embodiments. It should be understood that the following attached drawings only show some embodiments of the present application, and therefore should not be regarded as a limitation of the scope. For those of ordinary skill in the art, without creative efforts, other related attached drawings can also be obtained based on these attached drawings.

[0018] Figure 1 Is the amplification curve of the F3R3 primer combination;

[0019] Figure 2 Is the amplification curve of the F3R4 primer combination;

[0020] Figure 3 Is the amplification curve of the F4R3 primer combination;

[0021] Figure 4 Is the amplification curve of the F4R4 primer combination;

[0022] Figure 5 Is the amplification diagram of the standard curve;

[0023] Figure 6 Is the standard curve;

[0024] Figure 7 Is the PCR amplification diagram of 5 replicates of 1000 copies / ml plasmid;

[0025] Figure 8 Is the PCR amplification diagram of 5 replicates of 500 copies / ml plasmid;

[0026] Figure 9 Is the PCR amplification diagram of 5 replicates of 250 copies / ml plasmid;

[0027] Figure 10 Is the amplification curve of the positive sample;

[0028] Figure 11 Is the nucleic acid amplification curve of canine adenovirus and Bordetella bronchiseptica samples; Detailed implementation manners

[0029] It should be noted that, without conflict, the embodiments in the present application and the features in the embodiments can be combined with each other. The following will detail the present application in combination with the embodiments.

[0030] As mentioned in the background art, in the current prior art, for the specific primer-probe designed for Mycoplasma cynos pathogen, directly using the target gene reported in the literature patent is prone to false positives in negative samples. At the same time, when using clinical samples for testing, the amplification Ct values are generally low and the linearity is not optimistic. In view of the above situation, this application selects to align the RNA polymerase beta subunit gene sequence of Mycoplasma cynos pathogen. After comprehensive comparison, a conserved sequence is finally selected for the design of the primer-probe. After multiple tests and verifications, it solves the problem of false positives in negative samples. At the same time, it has good linearity under different concentration gradients of templates. Based on the above research results, the applicant proposes a series of technical solutions of this application.

[0031] In a first exemplary embodiment, a reagent for detecting a first region of Mycoplasma cynos nucleic acid is provided, and the first region is selected from any fragment of SEQ ID NO: 1.

[0032] Applying the technical solution of this application can accurately detect Mycoplasma cynos.

[0033] Due to the uniqueness of the above first region, detecting any fragment of any length selected therefrom can achieve highly specific detection of Mycoplasma cynos. To further improve the specificity and sensitivity of the detection, in some preferred embodiments, the first region is selected from any fragment between positions (1-3)-(89-91) of SEQ ID NO: 1.

[0034] For any fragment of any length in the above two regions, appropriate primers or primer-probe combinations can be designed for detection. In some preferred embodiments, the reagent includes a primer pair for detecting the nucleic acid sequence of SEQ ID NO: 1. The primer pair includes an upstream primer and a downstream primer, and the nucleotide sequence of the primer pair has a nucleotide sequence complementary or identical to 22-29 consecutive nucleotides between positions (1-3)-(89-91) of SEQ ID NO: 1.

[0035] In some more preferred embodiments, the primer pair is selected from the nucleotide sequences shown in SEQ ID NOs: 2 and 4; preferably, the reagent further includes a probe, and the probe is selected from the nucleotide sequence shown in SEQ ID NO: 6; wherein, SEQ ID NO: 2 is 5'-GTTTCAATCGCTCAAAAACGTAAAATC-3', SEQ ID NO: 4 is 5'-GGTAAAACRATTGAAATAACCCCTTTG-3', R = A or G, SEQ ID NO: 6 is 5'-TTCCATGRCGACCRGCCATCTTATCACC-3', R = A or G.

[0036] A set of primer-probe combinations of the present application has the advantages of high specificity, high sensitivity, and high detection accuracy in the detection of Mycoplasma cynos.

[0037] In the above primer-probe combinations, the 5'-end and 3'-end of the probe respectively have a fluorescent reporter group and a fluorescent quenching group. Having a fluorescent reporter group and a fluorescent quenching group facilitates accurate, efficient, and rapid detection by fluorescence quantitative PCR. Therefore, any group that can emit fluorescence and absorb fluorescence of the corresponding wavelength is applicable to the present application.

[0038] In some preferred embodiments, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5, or Cy7.; the fluorescent quenching group is selected from BHQ, TAMRA, Dabcyl, or Eclipse. When the above fluorescent reporter group and fluorescent quenching group are specifically used, they are reasonably selected and matched according to the wavelength of the emitted fluorescence and the wavelength that can absorb fluorescence.

[0039] Considering from the perspectives of cost, effect, wide application, and convenience, in some more preferred embodiments, the 5'-end of the above probe selects the FAM group, and the 3'-end selects the BHQ group (specifically, it can be BHQ1, BHQ2, or BHQ3).

[0040] In the second typical embodiment of the present application, a kit is provided, and the kit includes any of the above reagents. Using this kit for the detection of Mycoplasma cynos has the advantages of rapidity, high efficiency, high specificity, high sensitivity, and high detection accuracy.

[0041] In order to further improve the convenience of the detection of the kit, in some preferred embodiments, the above kit further includes at least one of the following: qPCR premix, and the qPCR premix includes a qPCR buffer and AK Taq DNA polymerase. Preferably, the concentration of AK Taq DNA polymerase is 25 U / μL. A specific qPCR buffer can be selected from existing known products for application. Details are not described here. It should be noted that the DNA polymerase used in this qPCR premix is AK Taq DNA polymerase produced by PhyNexus, and the use of other DNA polymerases with similar effects is not excluded here.

[0042] The positive control product in the kit is usually a gene fragment containing the object to be detected. In a preferred embodiment of the present application, the above positive control product is a gene fragment containing 91 bp of Mycoplasma cynos, and this gene fragment is as shown in SEQ ID NO: 1.

[0043] SEQ ID NO: 1:

[0044] GTTTCAATCGCTCAAAAACGTAAAATCAAAGTTGGTGATAAGATGGCYGGTCGYCATGGAAACAAAGGGGTTATTTCAATYGTTTTACCAG, (Y = C / T);

[0045] The negative control in the kit is a plasmid without the target gene fragment, which is a control that cannot amplify the target fragment. Preferably, the negative control is deionized water.

[0046] In the third typical embodiment, a method for fluorescence quantitative PCR detection of Mycoplasma canis is provided, which includes performing fluorescence quantitative PCR detection using the above primer-probe composition or the above kit.

[0047] In some preferred embodiments, the conditions for fluorescence quantitative PCR detection are: reverse transcription at 48 - 52 °C (preferably 49 - 51 °C) for 180 s - 300 s (preferably 240 s - 300 s), pre-denaturation at 92 - 98 °C (preferably 95 - 98 °C) for 30 s - 90 s (preferably 30 s - 60 s); denaturation treatment at 92 - 98 °C (preferably 95 - 98 °C) for 2 - 8 s (preferably 2 - 5 s), annealing at 58 - 62 °C (preferably 60 - 62 °C) for 30 - 40 s (preferably 30 - 35 s) and collecting fluorescence signal processing, for a total of 40 - 44 cycles.

[0048] In some more preferred embodiments, the conditions for fluorescence quantitative PCR detection are: reverse transcription at 50 °C for 300 s; pre-denaturation at 95 °C for 60 s; denaturation treatment at 95 °C for 5 s, annealing at 60 °C for 30 s and collecting fluorescence signal processing, for a total of 42 cycles.

[0049] In the fourth typical embodiment, the above reagent or the above kit is provided for use in the detection of Mycoplasma canis. By applying primers or primer-probe combinations capable of differentiating Mycoplasma canis, the present application can amplify the target fragment in clinical samples, and quickly, efficiently, sensitively and accurately identify Mycoplasma canis.

[0050] The beneficial effects of the present application will be further explained in detail below in combination with specific examples. It should be noted that the primers in the following examples were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Unless otherwise specified, the relevant reagents are all from commercially available products.

[0051] Example 1 Primer-Probe Design

[0052] Based on the conserved regions found by aligning the RNA polymerase beta subunit gene of Mycoplasma cynos, primers and probes were designed using these regions. During the primer design process, Primer Express 3.0.1 software was used for primer and probe design and evaluation. The evaluation criteria mainly included: length, Tm value, GC content, hairpin structure, internal primer dimers, primer-primer dimers, and the formation of mismatches. After the primer and probe design was completed, a BLAST analysis was performed online on the NCBI database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to avoid non-specific binding and amplification with other pathogenic bacteria. The primer and probe information is shown in Table 1.

[0053] Table 1 Primer and Probe Sequence Information for Real-Time Fluorescent Quantitative PCR Detection of Mycoplasma cynos

[0054] Serial number Name Sequence SEQ ID NO: 2 F3 GTTTCAATCGCTCAAAAACGTAAAATC SEQ ID NO: 3 F4 TTCAATCGCTCAAAAACGTAAAAT SEQ ID NO: 4 R3 GGTAAAACRATTGAAATAACCCCTTTG, R = A / G SEQ ID NO: 5 R4 CTGGTAAAACRATTGAAATAACCCCTT, R = A / G SEQ ID NO: 6 P2 TTCCATGRCGACCRGCCATCTTATCACC, R = A / G

[0055] Example 2 Primer Combination Screening

[0056] To further verify the effectiveness of different combinations of primers designed based on the conserved regions found by aligning the RNA polymerase beta subunit gene, clinical positive samples of Mycoplasma cynos were used as templates and diluted in 5-fold concentration gradients for 5 levels, with ddH2O as the negative control. The amplification system was configured according to Table 2, and the amplification reaction program was referred to Table 3. Amplification verification was carried out on an Applied 7500 Real-Time Fluorescent Quantitative PCR Instrument.

[0057] Table 2 qPCR Amplification System for Mycoplasma cynos

[0058]

[0059]

[0060] Table 3 Real-Time PCR Amplification Program

[0061]

[0062] Data showed that after the samples were diluted in 5-fold concentration gradients for 5 levels, the detection sensitivities among different primer combinations were inconsistent. Among them, the F3R3 combination was the best, and the other combinations were inferior ( Figures 1 - 4 , Table 4).

[0063] Table 4 Ct Values of qPCR Amplification of Clinical Samples Using Primers and Probes Designed Based on the Conserved Regions Found by Aligning the RNA Polymerase Beta Subunit Gene

[0064]

[0065] Example 3 Linear Detection

[0066] A recombinant plasmid containing the amplified fragment synthesized by Sangon Biotech (Shanghai) Co., Ltd. was used. The plasmid concentration (unit: copies / mL) was calibrated using a NanoDrop 2000C (Thermo Scientific, America) ultra-micro spectrophotometer to prepare plasmid standards. The calibrated plasmid standards were serially diluted by 5 gradients according to a 10-fold concentration factor (5×10 8 copies / mL to 5×10 4 copies / mL) for gradient amplification.

[0067] Using this as a template, a 25-μL Real-time PCR reaction system was established with reference to Table 2 and amplified on an Applied 7500 Real-time Fluorescent Quantitative PCR Instrument according to the procedure in Table 3. The amplification curve is shown in Figure 5 .

[0068] Linear fitting of the standard curve was performed on the amplification results. In the present invention, the amplification efficiency Efficiency = 102.834%, and the correlation coefficient R2 = 0.999, indicating a good linear relationship between the Ct value and the standard. y = -3.048x + 47.303. The standard curve is shown in Figure 6 .

[0069] Example 4 Sensitivity Detection

[0070] A recombinant plasmid containing the amplified fragment synthesized by Sangon Biotech (Shanghai) Co., Ltd. was used. The plasmid concentration (unit: copies / mL) was calibrated using a NanoDrop 2000C (Thermo Scientific, America) ultra-micro spectrophotometer to prepare detection limit gradient reference products with copy numbers of 1000, 500, and 250 copies / mL respectively. Each concentration was detected 5 times repeatedly to determine the detection limit of this primer-probe combination.

[0071] Using this as a template, a 25-μL Real-time PCR reaction system was established with reference to Table 2 and amplified on an Applied 7500 Real-time Fluorescent Quantitative PCR Instrument.

[0072] The results are shown in Figures 7 - 9As shown, the primer-probe combination had 100% detection rate for 1000 copies / ml, 100% detection rate for 500 copies / ml, and 20% detection rate for 250 copies / ml. Therefore, the detection limit of this primer-probe combination was determined to be 500 copies / ml.

[0073] Example 5 Experiment on Positive Samples

[0074] Using the kit assembled in the present invention, the pharyngeal swab samples of diseased dogs infected with Mycoplasma cynos were used as the test samples, and extraction was carried out using a viral DNA / RNA extraction kit (magnetic bead method) (Guangdong Runpeng Biology; product number: RK1001). The specific operation steps refer to the instruction manual. Using the recombinant plasmid as the positive control and ddH2O as the negative control, the reaction parameters in the present invention were run, and by comparing the PCR amplification curves of the test samples with those of the negative control and positive control, it was determined whether the Mycoplasma cynos RNA polymerase beta subunit gene was present in the test samples.

[0075] Using this as a template, a 25 μL Real-time PCR reaction system was established with reference to Table 2, and amplification was carried out on an Applied 7500 real-time fluorescence quantitative PCR instrument according to the procedure in Table 3.

[0076] The results were as Figure 10 shown. The kit of the present invention had an amplification curve for the nucleic acid of the pharyngeal swab samples of diseased dogs infected with Mycoplasma cynos, indicating that the Mycoplasma cynos RNA polymerase beta subunit gene was present in the samples.

[0077] Example 6 Specificity Experiment

[0078] Using the kit assembled in the present invention, the pharyngeal swab samples of diseased dogs infected with canine adenovirus and Bordetella bronchiseptica were used as the test samples, and extraction was carried out using a viral DNA / RNA extraction kit (magnetic bead method) (Guangdong Runpeng Biology; product number: RK1001). The specific operation steps refer to the instruction manual. Using the recombinant plasmid as the positive control and ddH2O as the negative control, the reaction parameters in the present invention were run, and by comparing the PCR amplification curves of the test samples with those of the negative control and positive control, it was determined whether non-Mycoplasma cynos RNA polymerase beta subunit genes were present in the test samples.

[0079] Using this as a template, a 25 μL Real-time PCR reaction system was established with reference to Table 2, and amplification was carried out on an Applied 7500 real-time fluorescence quantitative PCR instrument according to the procedure in Table 3.

[0080] The results were as Figure 11As shown, the kit of the present invention does not amplify the nucleic acid of the sample to be tested, proving that the primer-probe combination used in the kit of the present invention has no cross-amplification for the nucleic acid sequences of canine adenovirus and Bordetella bronchiseptica samples.

[0081] In summary, the self-developed canine mycoplasma amplification reagent has good performance and is superior to the competing detection reagents. From the above description, it can be seen that the above embodiments of the present application achieve the following technical effects: by using the primer-probe composition of the present application, not only is the specificity high, but also the sensitivity is greatly improved, so that canine mycoplasma can be efficiently and accurately identified. The target fragment is amplified in clinical samples, with high speed and efficiency, accurate results, and controllable cost.

[0082] The above are only the preferred embodiments of the present application and are not intended to limit the present application. For those skilled in the art, the present application can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A reagent for detecting canine mycoplasma nucleic acid, characterized in that, the reagent comprises: a reagent for detecting the first region of canine mycoplasma, wherein the first region is selected from any fragment of SEQ ID NO:

1.

2. The reagent according to claim 1, characterized in that, the first region is selected from any fragment between the 1st and (89 - 91)th bases of SEQ ID NO:

1.

3. The reagent according to claim 2, characterized in that, the reagent comprises a primer pair, and the nucleotide sequence of the primer pair has a nucleotide sequence complementary or identical to 22 - 29 consecutive nucleotides between the (1 - 3)th and (89 - 91)th bases of SEQ ID NO:

1.

4. The reagent according to claim 3, characterized in that, the primer pair is selected from the nucleotide sequences shown in SEQ ID NOs: 2 and 4; preferably, the reagent further comprises a probe, and the probe is selected from the nucleotide sequence shown in SEQ ID NO: 6; wherein, SEQ ID NO: 2 is 5'-GTTTCAATCGCTCAAAAACGTAAAATC-3', SEQ ID NO: 4 is 5'-GGTAAAACRATTGAAATAACCCCTTTG-3', R = A or G, SEQ ID NO: 6 is 5'-TTCCATGRCGACCRGCCATCTTATCACC-3', R = A or G.

5. The reagent according to claim 4, characterized in that, the 5' end and 3' end of the probe respectively have a fluorescent reporter group and a fluorescent quenching group; preferably, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5 or Cy7; the fluorescent quenching group is selected from BHQ, TAMRA, Dabcyl or Eclipse; more preferably, the 5' end of the probe is a FAM group and the 3' end is a BHQ1 group.

6. A kit, characterized in that, the kit comprises the reagent for detecting canine mycoplasma nucleic acid in a test sample according to any one of claims 1 to 5.

7. The kit according to claim 6, characterized in that, the kit further comprises at least one of the following: a qPCR premix, the qPCR premix comprises a qPCR buffer and AK Taq DNA polymerase, preferably, the concentration of the AK Taq DNA polymerase is 25 U / μL.

8. A method for fluorescence quantitative PCR detection of canine mycoplasma, characterized in that, the fluorescence quantitative PCR detection is carried out by using the reagent for detecting canine mycoplasma nucleic acid in a test sample according to any one of claims 1 to 5 or the kit according to claim 6 or 7.

9. The method according to claim 8, characterized in that, The conditions for the fluorescence quantitative PCR detection are as follows: reverse transcription at 48 - 52°C for 180 s - 300 s, pre-denaturation at 92 - 98°C for 30 s - 90 s; denaturation treatment at 92 - 98°C for 2 - 8 s, annealing at 58 - 62°C for 30 - 40 s and collecting fluorescence signal for processing, with a total of 40 - 44 cycles.

10. Use of the reagent for detecting Mycoplasma cynos nucleic acid in a sample to be tested according to any one of claims 1 to 5 or the kit according to claim 6 or 7 in the detection of Mycoplasma cynos.

Images