Composition for detecting ESKAPE pathogen in bloodstream infection, kit, application and detection method
By designing a digital PCR detection composition and kit for the six super bacteria of ESKAPE, and using digital PCR technology, the problem of low detection sensitivity in the existing technology is solved, and the detection of ESKAPE pathogens is achieved with high sensitivity and high specificity, which promotes early infection detection and appropriate treatment.
Patent Information
- Application Number
- CN202510403065.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-01
- Publication Date
- 2025-06-13
AI Technical Summary
The detection products for the six super bacteria in the market in the prior art market have low detection sensitivity and cannot effectively detect the presence of these pathogens in blood flow infection.
It provides a composition and kit for detecting ESKAPE pathogens in blood flow infection. Using digital PCR technology, it can achieve simultaneous detection and distinction of the six super bacteria by designing forward primers, reverse primers and probes for six super bacteria.
It has achieved high sensitivity and specificity detection of the six super bacteria of ESKAPE, which can detect infections early, help to take timely treatment measures, reduce unnecessary antibiotic use, and reduce the production of drug resistance.
Smart Images

Figure CN120138183A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of PCR detection, and particularly relates to a composition, a kit, an application and a detection method for detecting ESKAPE pathogens in bloodstream infections. Background Art
[0002] ESKAPE pathogens include Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter. These pathogens often cause severe nosocomial infections in critically ill and immunocompromised individuals. Staphylococcus aureus (S. aureus) is a major human pathogen that can cause various infections, including skin and soft tissue infections, osteoarticular and bloodstream infections, pneumonia, infective endocarditis and device-related infections. Klebsiella pneumoniae can cause pneumonia, urinary tract infections and liver infections, etc. Acinetobacter baumannii is a highly drug-resistant Gram-negative bacterium that has natural or acquired resistance to a variety of antibiotics, making it a common source of infection in the hospital environment. Pseudomonas aeruginosa is a bacterium highly resistant to a variety of antibiotics, especially carbapenem antibiotics. It is particularly difficult to control in the hospital environment and can cause severe infections. The genus Enterobacter includes various bacteria such as Enterobacter cloacae, which also show resistance to a variety of antibiotics and are important pathogenic bacteria for hospital infections.
[0003] These bacteria show high resistance to a variety of antibiotics globally and can even develop resistance to the last-line antibiotics. Therefore, the above-mentioned bacteria pose a major threat to human health.
[0004] Digital PCR (dPCR) technology is an absolute nucleic acid molecule quantification technology. It distributes a fluorescence quantitative PCR reaction system into a large number of tiny reactors, and each micro-reactor contains or does not contain one or more copies of the target nucleic acid molecule (DNA template) to perform "single-molecule template PCR amplification". After the amplification is completed, the copy number of the target gene in the original sample is calculated through the number of positive reaction units (judged by the end-point fluorescence signal) and statistical methods. It has better sensitivity, specificity and accuracy than traditional fluorescence quantitative PCR.
[0005] Currently, there are some detection products for the six major ESKAPE superbugs on the market, but most of them are for POCT qualitative detection or qPCR relative quantification. The sensitivity of these detection products is low, so there is an urgent need to develop a detection product based on digital PCR technology. Summary of the Invention
[0006] To solve the problem of low detection sensitivity of existing detection products for ESKAPE six superbugs on the market, the present invention provides a composition, a kit, an application and a detection method for detecting ESKAPE pathogens in bloodstream infections. To achieve the above object, the present invention adopts the following technical solutions.
[0007] The present invention provides a composition for detecting ESKAPE pathogens in bloodstream infections, and the composition includes at least one of component A, component B, component C, component D, component E and component F.
[0008] Component A includes a forward primer F1, a reverse primer R1 and a probe P1 for detecting Staphylococcus aureus; the nucleotide sequence of the forward primer F1 is as shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer R1 is as shown in SEQ ID NO.2.
[0009] Component B includes a forward primer F2, a reverse primer R2 and a probe P2 for detecting Enterococcus faecalis; the nucleotide sequence of the forward primer F2 is as shown in SEQ ID NO.4, and the nucleotide sequence of the reverse primer R2 is as shown in SEQ ID NO.5.
[0010] Component C includes a forward primer F3, a reverse primer R3 and a probe P3 for detecting Klebsiella pneumoniae; the nucleotide sequence of the forward primer F3 is as shown in SEQ ID NO.7, and the nucleotide sequence of the reverse primer R3 is as shown in SEQ ID NO.8.
[0011] Component D includes a forward primer F4, a reverse primer R4 and a probe P4 for detecting Acinetobacter baumannii; the nucleotide sequence of the forward primer F4 is as shown in SEQ ID NO.10, and the nucleotide sequence of the reverse primer R4 is as shown in SEQ ID NO.11.
[0012] Component E includes a forward primer F5, a reverse primer R5 and a probe P5 for detecting Enterobacter; the nucleotide sequence of the forward primer F5 is as shown in SEQ ID NO.13, and the nucleotide sequence of the reverse primer R5 is as shown in SEQ ID NO.14.
[0013] Component F includes a forward primer F6, a reverse primer R6 and a probe P6 for detecting Pseudomonas aeruginosa; the nucleotide sequence of the forward primer F6 is as shown in SEQ ID NO.16, and the nucleotide sequence of the reverse primer R6 is as shown in SEQ ID NO.17.
[0014] The nucleotide sequence of the probe P1 is shown in SEQ ID NO.3: the nucleotide sequence of the probe P2 is shown in SEQ ID NO.6; the nucleotide sequence of the probe P3 is shown in SEQ ID NO.9; the nucleotide sequence of the probe P4 is shown in SEQ ID NO.12; the nucleotide sequence of the probe P5 is shown in SEQ ID NO.15; the nucleotide sequence of the probe P6 is shown in SEQ ID NO.18.
[0015] The composition for detecting ESKAPE pathogens in bloodstream infections provided by the present invention can be used to detect the six major ESKAPE superbugs, can detect six superbugs simultaneously, has high specificity, and can also apply digital PCR technology with high sensitivity.
[0016] In the present invention, the primer pair with the nucleotide sequences shown in SEQ ID NO.1 to SEQ ID NO.2 and the probe with the nucleotide sequence shown in SEQ ID NO.3 are designed for a target fragment with a length of 114 bp of Staphylococcus aureus. The sequence of the target fragment is shown in SEQ ID NO.19:
[0017] AGCTAAAGAGTTTGGTGCATTTACAGATAGCATGCCATACAGTCATT TCACGCAAACTGTTGGCCACTATGAGTTAAAGCTTGCTGAAGGTTATGAA ACACATTTAGTGGGAAT.
[0018] In the present invention, the primer pair with the nucleotide sequences shown in SEQ ID NO.4 to SEQ ID NO.5 and the probe with the nucleotide sequence shown in SEQ ID NO.6 are designed for a target fragment with a length of 79 bp of Enterococcus faecium. The sequence of the target fragment is shown in SEQ ID NO.20:
[0019] TGCAAGTCGAACGCTTCTTTTCCCACCGGAGCTTGCTCCACCGGGAA AAGAGGAGTGGCGAACGGGTGAGTAACACGTG.
[0020] In the present invention, the primer pair with the nucleotide sequences shown in SEQ ID NO.7 to SEQ ID NO.8 and the probe with the nucleotide sequence shown in SEQ ID NO.9 are designed for a target fragment with a length of 79 bp of Klebsiella pneumoniae. The sequence of the target fragment is shown in SEQ ID NO.21:
[0021] TGATTCTCGACCTGCTGCTCACCGCGCTGGCGCCCGCTATCTGGGGGACGACCTACATCGTCACCTCCCAGTTTCTTCC。
[0022] In the present invention, the primer pair with the nucleotide sequences shown in SEQ ID NO.10 to SEQ ID NO.11
[0023] The probe with the nucleotide sequence shown in SEQ ID NO.12 is designed for a 120-bp target fragment of Acinetobacter baumannii. The sequence of the target fragment is shown in SEQ ID NO.22:
[0024] TATTGATATACGAATTGCACCTCATAAGCTTGAGCAGTTAATTCGCCAAGCCAAACTCCCTATAGATGAGATATTAGGTGAACGCGCAAGTCAGTTTAAAAGACCGCTGGAAGAGTTTGA。
[0025] In the present invention, the primer pair with the nucleotide sequences shown in SEQ ID NO.13 to SEQ ID NO.14
[0026] The probe with the nucleotide sequence shown in SEQ ID NO.15 is designed for a 97-bp target fragment of Enterobacter bacteria. The sequence of the target fragment is shown in SEQ ID NO.23:
[0027] TCAGAGGGATTGAAAGGCTTGATCACGTAGTCGTCAGCGCCCAGGCGCAATCCCATCAGTTTATCAACATCCTGATCGAGGGCGGTGACCATAATAA。
[0028] In the present invention, the primer pair with the nucleotide sequences shown in SEQ ID NO.16 to SEQ ID NO.17
[0029] The probe with the nucleotide sequence shown in SEQ ID NO.18 is designed for an 88-bp target fragment of Pseudomonas aeruginosa. The sequence of the target fragment is shown in SEQ ID NO.24:
[0030] ACCCTCAGGCGGCTTTCTTCTCCGGAGCCTTCTTCTTCGGCTTGAGGTACTTCACTAGACCCTGGAACCAGATCACCAGCGCCGGATT。
[0031] Preferably, the composition comprises any three of the component A, the component B, the component C, the component D, the component E and the component F.
[0032] Among them, the component A, the component B, the component C, the component D, the component E and the component F can simultaneously achieve the joint detection and differentiation of Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Acinetobacter baumannii, Enterobacter bacteria, and Pseudomonas aeruginosa, without non-specific amplification, and the overall detection effect is good.
[0033] Preferably, a fluorescent reporter group is labeled on each of the probes P1 to P6, and they do not interfere with each other.
[0034] Preferably, each of the probes P1 to P6 is labeled with any one of the following fluorescent reporter groups:
[0035] FAM, HEX, and CY5.
[0036] Preferably, the nucleotide sequence of the probe P1 is as shown in SEQ ID NO.3, the 5' end of the probe with the shown nucleotide sequence is labeled with the fluorescent reporter group FAM, and the 3' end is labeled with the fluorescent quenching group BHQ2; the nucleotide sequence of the probe P2 is as shown in SEQ ID NO.6, the 5' end of the probe with the shown nucleotide sequence is labeled with the fluorescent reporter group HEX, and the 3' end is labeled with the fluorescent quenching group BHQ2; the nucleotide sequence of the probe P3 is as shown in SEQ ID NO.9, the 5' end of the probe with the shown nucleotide sequence is labeled with the fluorescent reporter group CY5, and the 3' end is labeled with the fluorescent quenching group BHQ2; the nucleotide sequence of the probe P4 is as shown in SEQ ID NO.12, the 5' end of the probe with the shown nucleotide sequence is labeled with the fluorescent reporter group FAM, and the 3' end is labeled with the fluorescent quenching group BHQ2; the nucleotide sequence of the probe P5 is as shown in SEQ ID NO.16, the 5' end of the probe with the shown nucleotide sequence is labeled with the fluorescent reporter group HEX, and the 3' end is labeled with the fluorescent quenching group BHQ2; the nucleotide sequence of the probe P6 is as shown in SEQ ID NO.18, the 5' end of the probe with the shown nucleotide sequence is labeled with the fluorescent reporter group CY5, and the 3' end is labeled with the fluorescent quenching group BHQ2.
[0037] Preferably, the components of the composition exist in a mixed form.
[0038] The present invention also provides a kit for detecting ESKAPE pathogens in bloodstream infections. The kit includes the composition for detecting ESKAPE pathogens in bloodstream infections as described above, and the composition of the pathogens is a standard mixture of 6 strains. The kit provided by the present invention for detecting ESKAPE pathogens in bloodstream infections can simultaneously detect six superbugs, has high specificity, and has high sensitivity when applied to the digital PCR platform.
[0039] Preferably, the concentrations of the forward primers F1 to F6 and the reverse primers R1 to R6 are all 0.5 μM to 1 μM, and the concentrations of the probes P1 to P6 are 0.2 μM to 0.6 μM.
[0040] More preferably, the composition for detecting ESKAPE pathogens in bloodstream infections.
[0041] Preferably, the concentrations of the forward primers F1 to F6 and the reverse primers R1 to R6 are all 0.9 μM, and the concentrations of the probes P1 to P6 are 0.6 μM.
[0042] Preferably, the kit further includes any one or more of DNA polymerase, UNG enzyme, dNTP(U)s, PCR buffer, and Mg 2+ in any one of them, and this PCR mix is the 5X dPCR mix of Juexin Biotech.
[0043] Preferably, the kit further includes any one or two of a positive control product and a negative control product, and the positive control product includes a mixture of DNA standards of 6 strains.
[0044] The present invention also provides the use of the composition or the kit in the preparation of rapid detection products and diagnostic products for bloodstream infection pathogens.
[0045] The present invention also provides a method for detecting bloodstream infection pathogens for non-diagnostic purposes, including the following steps:
[0046] Performing droplet digital PCR amplification on a nucleic acid sample using the kit for detecting ESKAPE pathogens in bloodstream infections.
[0047] Reading and analyzing the results with a digital PCR bioanalyzer.
[0048] Compared with the prior art, the present invention has the following beneficial effects:
[0049] 1. The present invention provides a composition for detecting ESKAPE pathogens in bloodstream infections. The composition for detecting ESKAPE pathogens in bloodstream infections provided by the present invention includes forward and reverse primers and probes for detecting Staphylococcus aureus, component B includes forward and reverse primers and probes for detecting Enterococcus faecalis, component C includes forward and reverse primers and probes for detecting Klebsiella pneumoniae, component D includes forward and reverse primers and probes for detecting Acinetobacter baumannii, component E includes forward and reverse primers and probes for detecting Enterobacter, and component F includes at least one of forward and reverse primers and probes for detecting Pseudomonas aeruginosa.
[0050] Among them, the forward and reverse primers and probes corresponding to each of the above-mentioned superbugs can and can only amplify the target fragment corresponding to the superbug, will not amplify other templates in the multiplex PCR reaction system, nor will they amplify other bacteria other than these six bacteria. Moreover, the forward and reverse primers and probes corresponding to each bacterium do not interfere with each other, each set of primer-probe has high specificity, and is applicable to the digital PCR platform. Therefore, the composition for detecting ESKAPE pathogens in bloodstream infections provided by the present invention can be used to detect the six ESKAPE superbugs, can detect six superbugs simultaneously, has high specificity, can apply digital PCR technology at the same time, and has high sensitivity, which can solve the problem of low detection sensitivity of the existing detection products for the six ESKAPE superbugs on the market.
[0051] 2. The kit for detecting ESKAPE pathogens in bloodstream infections provided by the present invention can detect six superbugs simultaneously, has high specificity, and has high sensitivity when applying the digital PCR platform.
[0052] 3. The present invention adopts the droplet digital PCR technology. Through the careful design of the upstream primers, downstream primers and corresponding probes for detecting each bloodstream infection pathogen, the composition for detecting bloodstream infection pathogens provided can achieve the detection and differentiation of at least one of Enterococcus faecalis, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter bacteria. It is more suitable for early detection, has high sensitivity, specificity and precision, can accurately and quickly detect Enterococcus faecalis, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter bacteria, and is used for the early screening of drug-resistant bacterial infections, helps to take timely treatment measures, customize personalized treatment plans, reduce unnecessary antibiotic use, and reduce the generation of drug resistance. BRIEF DESCRIPTION OF THE DRAWINGS
[0053] Figure 1 It is a one-dimensional scatter plot of the joint detection of Enterococcus faecalis, Staphylococcus aureus, and Klebsiella pneumoniae in Example 1 of the present invention; among them,Figure 1 Figure A in it is *Staphylococcus aureus*; Figure 1 Figure B in it is *Enterococcus faecalis*; Figure 1 Figure C in it is the internal reference dye channel; Figure 1 Figure D in it is *Klebsiella pneumoniae*.
[0054] Figure 2 This is the two-dimensional scatter plot (FAM + HEX) for the combined detection of *Enterococcus faecalis*, *Staphylococcus aureus*, and *Klebsiella pneumoniae* in Example 1 of the present invention.
[0055] Figure 3 This is the two-dimensional scatter plot (FAM + CY5) for the combined detection of *Enterococcus faecalis*, *Staphylococcus aureus*, and *Klebsiella pneumoniae* in Example 1 of the present invention.
[0056] Figure 4 This is the two-dimensional scatter plot (CY5 + HEX) for the combined detection of *Enterococcus faecalis*, *Staphylococcus aureus*, and *Klebsiella pneumoniae* in Example 1 of the present invention.
[0057] Figure 5 This is the one-dimensional scatter plot for the combined detection of *Acinetobacter baumannii*, *Pseudomonas aeruginosa*, and *Enterobacter* in Example 1 of the present invention; wherein, Figure 5 Figure A in it is *Acinetobacter baumannii*; Figure 5 Figure B in it is *Enterobacter*; Figure 5 Figure C in it is the internal reference dye channel; Figure 5 Figure D in it is *Pseudomonas aeruginosa*.
[0058] Figure 6 This is the two-dimensional scatter plot (FAM + HEX) for the combined detection of *Acinetobacter baumannii*, *Pseudomonas aeruginosa*, and *Enterobacter* in Example 1 of the present invention.
[0059] Figure 7 This is the two-dimensional scatter plot (FAM + CY5) for the combined detection of *Acinetobacter baumannii*, *Pseudomonas aeruginosa*, and *Enterobacter* in Example 1 of the present invention.
[0060] Figure 8 This is the two-dimensional scatter plot (CY5 + HEX) for the combined detection of *Acinetobacter baumannii*, *Pseudomonas aeruginosa*, and *Enterobacter* in Example 1 of the present invention.
[0061] Figure 9 This is the Medcalc statistical analysis result of the sensitivity of *Enterococcus faecalis* in Example 2 of the present invention.
[0062] Figure 10 This is the Medcalc statistical analysis result of the sensitivity of *Staphylococcus aureus* in Example 2 of the present invention.
[0063] Figure 11This is the Medcalc statistical analysis result of the sensitivity of Klebsiella pneumoniae in Example 2 of the present invention.
[0064] Figure 12 This is the Medcalc statistical analysis result of the sensitivity of Acinetobacter baumannii in Example 2 of the present invention.
[0065] Figure 13 This is the Medcalc statistical analysis result of the sensitivity of Pseudomonas aeruginosa in Example 2 of the present invention.
[0066] Figure 14 This is the Medcalc statistical analysis result of the sensitivity of Enterobacter bacteria in Example 2 of the present invention.
[0067] Figure 15 This is the droplet digital PCR detection result of 6 groups of primer-probes + templates of other non-target bacterial species in the specific detection item of Example 3 of the present invention; among them, Figure 15 Figure A in it is the amplification test of other non-target bacterial species with the primer-probe pair of Staphylococcus aureus + Acinetobacter baumannii, and the result shows no positive droplets; Figure 15 Figure B in it is the amplification test of other non-target bacterial species with the primer-probe pair of Enterococcus faecium + Enterobacter bacteria, and the result shows no positive droplets; Figure 15 Figure C in it is the internal reference dye channel; Figure 15 Figure D in it is the amplification test of other non-target bacterial species with the primer-probe pair of Klebsiella pneumoniae + Pseudomonas aeruginosa, and the result shows no positive droplets.
[0068] Figure 16 It is the one-dimensional scatter plot of the primer-probe sequence test of the authorized patent. Detailed implementation manners
[0069] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments, but it should not be construed as a limitation of the present invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.
[0070] The strains used in the following embodiments are as follows:
[0071] Enterococcus faecium is the Enterococcus faecium DNA standard product, sourced from Beina Biotech, product number: BNCC380804.
[0072] Staphylococcus aureus is the Staphylococcus aureus DNA standard product, sourced from Beina Biotech, product number: BNCC373988.
[0073] Klebsiella pneumoniae is the Klebsiella pneumoniae DNA standard product, sourced from Beina Biotech, product number: BNCC377981.
[0074] Acinetobacter baumannii is the Acinetobacter baumannii DNA standard, sourced from Beina Biology, product number: BNCC363997.
[0075] Pseudomonas aeruginosa is the Pseudomonas aeruginosa DNA standard, sourced from Beina Biology, product number: BNCC377987.
[0076] Enterobacter bacteria are the Enterobacter cloacae DNA standard, sourced from Beina Biology, product number: BNCC370665.
[0077] Serratia marcescens is the Serratia marcescens genomic DNA, sourced from Beina Biology, product number: BNCC362726.
[0078] Stenotrophomonas maltophilia is the Stenotrophomonas maltophilia genomic DNA, sourced from Beina Biology, product number: BNCC364737.
[0079] Proteus mirabilis is the Proteus mirabilis genomic DNA, sourced from Beina Biology, product number: BNCC361250.
[0080] Candida albicans is the Candida albicans genomic DNA, sourced from Beina Biology, product number: BNCC352026.
[0081] Cryptococcus neoformans is the Cryptococcus neoformans genomic DNA, sourced from Beina Biology, product number: BNCC374391.
[0082] Neisseria meningitidis is the Neisseria meningitidis genomic DNA, sourced from Beina Biology, product number: BNCC369966.
[0083] Aspergillus is the Aspergillus flavus genomic DNA, sourced from Beina Biology, product number: BNCC360029.
[0084] Haemophilus influenzae is the Haemophilus influenzae genomic DNA, sourced from Beina Biology, product number: BNCC362317.
[0085] In the examples of the present invention, the "upstream primer" is the forward primer, and the "downstream primer" is the "reverse primer".
[0086] Example 1
[0087] 1. Reagent preparation
[0088] The droplet digital PCR reaction system for the joint detection of Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter bacteria is shown in Table 1. The sequences of the upstream primer, downstream primer, and probe corresponding in the reaction system are shown in Table 2. The upstream primer, downstream primer, and probe provided in Table 2 are the compositions for detecting blood stream infection pathogens provided in this example.
[0089] Table 1 Droplet digital PCR reaction system
[0090] Component Volume in 20 μL reaction system (μL) PCR buffer (5×) 4 UNG enzyme 0.08 Taq enzyme (5 U / μL) 0.8 <![CDATA[Mg 2+ (1M)]]> 0.08 dNTP (U) (10 mM) 0.2 Each pair of primers (100 μM) 0.36 Each probe (100 μM) 0.12 Droplet stabilizer (10%) 2 ROX dye (50×) 0.4 Template 10
[0091] Note: Each primer includes forward primer F1 to forward primer F6, and reverse primer R1 to reverse primer R6; each probe includes probe P1 to the said probe P6. The templates, i.e., positive controls, are genomic DNA standards of Enterococcus faecalis, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter bacteria respectively.
[0092] It should be noted that the above amplification primer sequences and fluorescence probe sequences are shown in Table 2.
[0093] Table 2 Primer and probe sequences
[0094]
[0095]
[0096] Note: S. aureus - F is forward primer F2, S. aureus - R is reverse primer R2, S. aureus - P is probe P2; E. faecalis - F is forward primer F1, E. faecalis - R is reverse primer R1, E. faecalis - P is probe P1; K. pneumoniae - F is forward primer F3, K. pneumoniae - R is reverse primer R3, K. pneumoniae - P is probe P3; A. baumannii - F is forward primer F4, A. baumannii - R is reverse primer R4, A. baumannii - P is probe P4; Enterobacter - F is forward primer F5, Enterobacter - R is reverse primer R5, Enterobacter - P is probe P5; P. aeruginosa - F is forward primer
[0097] F6, P. aeruginosa - R is reverse primer R6, P. aeruginosa - P is probe P6.
[0098] The detection templates, i.e., positive controls, are genomic DNAs of Enterococcus faecalis, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter bacteria respectively; the negative control is sterile normal saline. Prepare a 19 μL droplet digital PCR reaction system mixture excluding 1 μL template according to Table 1. After centrifuging at 2000 rpm for 10 s, vortex for 20 s, and then centrifuge at 2000 rpm for 10 s for standby.
[0099] For Enterococcus faecalis, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter bacteria, different fluorescent reporter groups are used to label different probes for signal differentiation. Among them, the fluorescent reporter gene for the probes detecting Staphylococcus aureus and Acinetobacter baumannii is FAM; the fluorescent reporter group for the probes detecting Enterococcus faecalis and Enterobacter bacteria is HEX; the fluorescent reporter group for the probes detecting Klebsiella pneumoniae and Pseudomonas aeruginosa is CY5; the internal reference channel is ROX.
[0100] 2. Droplet generation
[0101] On the Juenxin Bio Sminer 405 droplet digital PCR instrument, droplet generation is carried out according to the pressure and time shown in Table 3.
[0102] Table 3 Droplet generation parameters
[0103]
[0104] 3. PCR amplification
[0105] On the Juenxin Bio Sminer 405 droplet digital PCR instrument, PCR amplification is carried out according to the temperature and time settings shown in Table 4.
[0106] Table 4 Amplification program
[0107]
[0108] 4. Reading the film and analyzing the results with a digital PCR bioanalyzer
[0109] (1) Judgment criteria
[0110] Quality control negative control: no positive droplets in the FAM, HEX, and CY5 channels; positive control: obvious positive droplets in the FAM, HEX, and CY5 channels, and the copy number can be clearly calculated with a distinct difference from the negative droplets.
[0111] The above requirements need to be met simultaneously in the same experiment. Otherwise, this experiment is invalid and needs to be repeated. Table 5 shows the film reading parameters of the bioanalyzer.
[0112] Table 5 Film reading parameters
[0113] Exposure time (ms) Gain FAM 1000 120 HEX 1000 50 CY5 1000 120 ROX 900 120
[0114] (2) Detection results
[0115] The results of Example 1 for the joint detection of Enterococcus faecalis, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter bacteria are as Figures 1 - 8 shown.
[0116] Figure 1 One-dimensional scatter plot of Enterococcus faecium, Staphylococcus aureus and Klebsiella pneumoniae in Example 1. From Figure 1 It can be seen that the positive and negative microdroplets are clearly distinguishable. The three groups of primer-probes are applicable to this digital PCR system, and Poisson distribution can be applied for concentration determination.
[0117] Figure 2 Two-dimensional scatter plot (FAM+HEX) of Enterococcus faecium, Staphylococcus aureus and Klebsiella pneumoniae in Example 1. From Figure 2 It can be seen that the positive and negative microdroplets are clearly distinguishable. The three groups of primer-probes are applicable to this digital PCR system, and Poisson distribution can be applied for concentration determination.
[0118] Figure 3 Two-dimensional scatter plot (FAM+CY5) of Enterococcus faecium, Staphylococcus aureus and Klebsiella pneumoniae in Example 1. From Figure 3 It can be seen that the positive and negative microdroplets are clearly distinguishable. The three groups of primer-probes are applicable to this digital PCR system, and Poisson distribution can be applied for concentration determination.
[0119] Figure 4 Two-dimensional scatter plot (CY5+HEX) of Enterococcus faecium, Staphylococcus aureus and Klebsiella pneumoniae in Example 1. From Figure 4 It can be seen that the positive and negative microdroplets are clearly distinguishable. The three groups of primer-probes are applicable to this digital PCR system, and Poisson distribution can be applied for concentration determination.
[0120] Figure 5 One-dimensional scatter plot of Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter bacteria in Example 1. From Figure 5 It can be seen that the positive and negative microdroplets are clearly distinguishable. The three groups of primer-probes are applicable to this digital PCR system, and Poisson distribution can be applied for concentration determination.
[0121] Figure 6 Two-dimensional scatter plot (FAM+HEX) of Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter bacteria in Example 1. From Figure 6 It can be seen that the positive and negative microdroplets are clearly distinguishable. The three groups of primer-probes are applicable to this digital PCR system, and Poisson distribution can be applied for concentration determination.
[0122] Figure 7 Two-dimensional scatter plot (FAM+CY5) of Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter bacteria in Example 1. From Figure 7 It can be seen that the positive and negative microdroplets are clearly distinguishable. The three groups of primer-probes are applicable to this digital PCR system, and Poisson distribution can be applied for concentration determination.
[0123] Figure 8Two-dimensional scatter plot (CY5+HEX) of Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacteriaceae in Example 1. From Figure 8 It can be seen that the positive and negative microdroplets are clearly distinguishable. The three sets of primer-probes are applicable to this digital PCR system, and Poisson distribution can be used for concentration determination.
[0124] From Figures 1 - 8 It can be known that in Example 1, various bloodstream infection pathogens such as Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacteriaceae are jointly detected, and it is possible to detect and distinguish Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacteriaceae. There is little mutual influence among the upstream primers, downstream primers and corresponding probes corresponding to each bloodstream infection pathogen.
[0125] Example 2: Sensitivity detection
[0126] Using the droplet digital PCR reaction system in Example 1 of the present invention, and respectively using the primer-probe sequences and fluorescent reporter groups corresponding to Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacteriaceae in Table 2, the LOD (sensitivity) of each bloodstream infection pathogen (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacteriaceae) target was detected according to the detection method in Example 1. The concentrations of the standard product gradient dilution were 3.125 copies / μL, 2.34375 copies / μL, 1.5625 copies / μL, 1.171875 copies / μL, and 0.78125 copies / μL respectively. Using the standard DNA of each strain, 24 parallel repeated PCR detections were carried out on a droplet digital PCR instrument. The detection results were analyzed by dose-response analysis using Medcalc software.
[0127] Among them, the calculation formula of the detection rate is as follows:
[0128] Detection rate = (number of detections / number of tests) × 100%.
[0129] The results are as Figures 9 - 14 shown.
[0130] The above results show that for samples as low as 1.5625 copies / μL, each channel can still accurately detect them. Among them, the sensitivity of Enterococcus faecalis at 95% confidence level is 1.53657 copies / μL, and the 95% confidence interval is 1.33395 copies / μL - 2.06692 copies / μL; the sensitivity of Staphylococcus aureus at 95% confidence level is 1.22189 copies / μL, and the 95% confidence interval is 1.02573 copies / μL - 2.22937 copies / μL; the sensitivity of Klebsiella pneumoniae at 95% confidence level is 1.40325 copies / μL, and the 95% confidence interval is 1.22653 copies / μL - 1.86890 copies / μL; the sensitivity of Acinetobacter baumannii at 95% confidence level is 1.36864 copies / μL, and the 95% confidence interval is 1.17446 copies / μL - 2.00309 copies / μL; the sensitivity of Pseudomonas aeruginosa at 95% confidence level is 1.30404 copies / μL, and the 95% confidence interval is 1.06512 copies / μL - 2.82885 copies / μL, and the sensitivity of Enterobacter bacteria at 95% confidence level is 1.51742 copies / μL, and the 95% confidence interval is 1.34859 copies / μL - 1.88664 copies / μL.
[0131] Example 3: Specific Detection
[0132] Using the droplet digital PCR reaction system in Example 1 of the present invention, and using the primer-probe sequences and fluorescent reporter groups corresponding to Enterococcus faecalis, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter bacteria in Table 2, according to the detection method in Example 1, in reaction systems respectively containing other common blood-borne pathogens and other pathogens with similar infection symptoms (Serratia marcescens, Stenotrophomonas maltophilia, Proteus mirabilis, Candida albicans, Cryptococcus neoformans, Neisseria meningitidis, Aspergillus and Haemophilus influenzae), the composition (primer-probe sequences in Table 2) for detecting blood-borne infection pathogens in this example has no cross-reaction with the above other common blood-borne pathogens. The detection results of each other common blood-borne pathogen are as Figure 11 shown.
[0133] It can be Figure 15 seen that the composition (primer-probe sequences in Table 2) for detecting blood-borne infection pathogens in this example has no cross-reaction with the above other common blood-borne pathogens.
[0134] The above results show that the combination of the present invention for detecting bloodstream infection pathogens has high specificity when detecting Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter bacteria without nonspecific amplification of other common bloodstream pathogens. This shows that the combination of the present invention for detecting bloodstream infection pathogens has good specificity.
[0135] Example 4: Accuracy and Precision Testing
[0136] Using the droplet digital PCR reaction system in Example 1 of the present invention, and using the primer probe sequences and fluorescent reporter groups corresponding to Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter bacteria in Table 2, respectively, according to the detection method in Example 1, Enterococcus faecium DNA standard (catalog number: BNCC380804), Staphylococcus aureus DNA standard (catalog number: BNCC373988), Klebsiella pneumoniae DNA standard (catalog number: BNCC373989), CC377981), Acinetobacter baumannii DNA standard (catalog number: BNCC363997), Pseudomonas aeruginosa DNA standard (catalog number: BNCC377987), Enterobacter cloacae DNA standard (catalog number: BNCC370665) were diluted to 5000 copies / mL for detection (because the uncertainty values of digital PCR for different concentrations are different, diluting all samples to the same concentration can better perform accuracy analysis), and each sample was measured 10 times.
[0137] Among them, the dilution method and sample loading amount are shown in Table 6:
[0138] Table 6 Dilution method and sample loading
[0139]
[0140] The copy numbers detected in these samples are consistent with the copy numbers of the samples after the standard was diluted (the national standard stipulates that the accuracy deviation is <15%, and the deviation between the experimental results and the theoretical value of the standard dilution is much less than 15%, and there will inevitably be errors in the dilution process). It can be considered that the composition for detecting bloodstream infection pathogens provided by the present invention has good detection accuracy. At the same time, it can be considered that in the multiple PCR reaction, each set of primer probes can only amplify the target sequence of the target bacterial species, and has strong specificity in this amplification environment, and does not interfere with the detection of other bacterial species.
[0141] The detection rates of these samples were all 100%, and the copy number variation coefficient (CV) was less than 5%. It can be considered that the composition for detecting bloodstream infection pathogens provided by the present invention has good detection precision.
[0142] Table 7 Repeatability test results
[0143]
[0144] Example 5: Comparative Experiment
[0145] Using the droplet digital PCR reaction system in Example 1 of the present invention, and using the primer-probe sequences of Klebsiella pneumoniae in the authorized patent (CN110564824 A) (see Table 8) for detection according to the detection method in Example 1, Figure 16 The result is a one-dimensional scatter plot, showing that there is no effective distinction between positive and negative droplets, indicating that this primer-probe combination cannot measure the copy number concentration of Klebsiella pneumoniae in this Assay.
[0146] Table 8 Primer-probe sequences of Klebsiella pneumoniae in the authorized patent (CN 110564824 A)
[0147]
[0148]
[0149] In summary, the composition and kit for detecting ESKAPE pathogens in bloodstream infections developed on the Juenxin digital PCR Sminer 405 platform can solve the problems existing in the current detection products for the six major superbugs of ESKAPE. It can detect six superbugs simultaneously with high sensitivity and good specificity, and can detect patients with low infection levels at an early stage for intervention and treatment.
[0150] It should be noted that when the present invention involves numerical ranges, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. To avoid repetition, preferred embodiments of the present invention are described.
[0151] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they know the basic creative concept, and these changes and modifications all fall within the scope of all changes and modifications of the present invention.
Claims
1. A composition for detecting ESKAPE pathogens in bloodstream infections, characterized in that The composition comprises at least one of component A, component B, component C, component D, component E and component F; The component A comprises a forward primer F1, a reverse primer R1 and a probe P1 for detecting Staphylococcus aureus; the component B comprises a forward primer F2, a reverse primer R2 and a probe P2 for detecting Enterococcus faecium; the component C comprises a forward primer F3, a reverse primer R3 and a probe P3 for detecting Klebsiella pneumoniae; the component D comprises a forward primer F4, a reverse primer R4 and a probe P4 for detecting Acinetobacter baumannii; the component E comprises a forward primer F5, a reverse primer R5 and a probe P5 for detecting Enterobacter; the component F comprises a forward primer F6, a reverse primer R6 and a probe P6 for detecting Pseudomonas aeruginosa; The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO.2; the nucleotide sequence of the forward primer F2 is shown in SEQ ID NO.4, and the nucleotide sequence of the reverse primer R2 is shown in SEQ ID NO.5; the nucleotide sequence of the forward primer F3 is shown in SEQ ID NO.7, and the nucleotide sequence of the reverse primer R3 is shown in SEQ ID NO.8; the nucleotide sequence of the forward primer F4 is shown in SEQ ID NO.10, and the nucleotide sequence of the reverse primer R4 is shown in SEQ ID NO.11; the nucleotide sequence of the forward primer F5 is shown in SEQ ID NO.13, and the nucleotide sequence of the reverse primer R5 is shown in SEQ ID NO.14; the nucleotide sequence of the forward primer F6 is shown in SEQ ID NO.16, and the nucleotide sequence of the reverse primer R6 is shown in SEQ ID NO.17; The nucleotide sequences of the probes P1 to P6 are shown in SEQ ID NO.3, SEQ ID NO.6, SEQ ID NO.9, SEQ ID NO.12, SEQ ID NO.15 and SEQ ID NO.18 respectively.
2. The composition according to claim 1, characterized in that The composition includes any three of the component A, the component B, the component C, the component D, the component E and the component F.
3. The composition according to claim 1, characterized in that The probes P1 to P6 are all labeled with a fluorescent reporter group and do not interfere with each other.
4. The composition according to claim 3, characterized in that The probes P1 to P6 are respectively labeled with any one of the following fluorescent reporter groups: FAM, HEX and CY5.
5. A kit for detecting ESKAPE pathogens in bloodstream infections, characterized in that: The kit comprises the composition according to any one of claims 1 to 4.
6. The kit according to claim 5, characterized in that The concentrations of the forward primers F1 to F6 and the reverse primers R1 to R6 are all 0.5 μM to 1 μM, and the concentration of the probes P1 to P6 is 0.2 μM to 0.6 μM.
7. The kit according to claim 5, characterized in that The kit also includes DNA polymerase, UNG enzyme, dNTP (U) s, PCR buffer and Mg 2+ Any one or more of .
8. The kit according to claim 7, characterized in that The kit also includes any one or both of a positive quality control product and a negative quality control product.
9. Use of the composition according to claim 1 or the kit according to claim 5 in the preparation of rapid detection products and diagnostic products for bloodstream infection pathogens.
10. A method for detecting bloodstream infection pathogens for non-diagnostic purposes, characterized in that: The steps include: Perform droplet digital PCR amplification on a nucleic acid sample using the kit described in any one of claims 5 to 8; The digital PCR bioanalyzer was used to read the slides and analyze the results.
Citation Information
Patent Citations
Primer and probe combination and kit for detecting human pathogenic bacteria
CN110564824A
Primer and / or probe composition for detecting bacillus for initiating blood flow infection and application of primer and / or probe composition
CN110656188A
Detection kit for detecting multiple pathogens infected with blood flow and application of detection kit
CN117210587A