Double-effect hydrogel fluorescence sensing method for detecting tetracycline and application of double-effect hydrogel fluorescence sensing method

By using the dual-effect hydrogel fluorescence sensing method in tetracycline detection, the target DNA and CRISPR/Cas12a system are used to solve the problems of time-consuming, high cost and cumbersome operation of existing detection methods, and the rapid, sensitive and accurate quantity detection of tetracycline is achieved.

CN120142640APending Publication Date: 2025-06-13TAIYUAN UNIVERSITY OF TECHNOLOGY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510320749.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-18
Publication Date
2025-06-13

AI Technical Summary

Technical Problem

The existing tetracycline detection methods have problems such as long detection, high cost and cumbersome operation, especially in on-site inspection, which is difficult to achieve fast, sensitive and accurate quantitative analysis.

Method used

Using the dual-effect hydrogel fluorescence sensing method, a sensor system that can activate double Cas12a in a single molecular recognition event is formed by designing the target DNA sequence and the CRISPR/Cas12a system, combining fluorescent signal reporter molecules, thereby achieving rapid, sensitive and accurate quantification detection of tetracycline.

Benefits of technology

This method can significantly improve the sensitivity and accuracy of tetracycline detection, is easy to operate, short detection time, detection limit is 0.035μg/L, and quantitative detection range is 0.05μg/L to 800μg/L, which is suitable for tetracycline detection in actual water bodies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120142640A_ABST
    Figure CN120142640A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of antibiotic monitoring, and particularly relates to a double-effect hydrogel fluorescence sensing method for detecting tetracycline and application of the double-effect hydrogel fluorescence sensing method. The double-effect hydrogel is prepared from acrylamide, target DNAS1, target DNAS2, a tetracycline aptamer, double-effect CRISPR / Cas12a (Cas12a / crRNA1, Cas12a / crRNA2), an incubation buffer solution 10 * NEBuffer 2.1), a fluorescence signal report molecule, a TAE buffer solution, an initiator ammonium persulfate and an accelerator tetramethylethylenediamine. During detection, the double-effect hydrogel is only required to be mixed with a sample to be detected according to a certain condition; the one-pot detection of tetracycline in the water environment can be realized through the sensing method. The double-effect hydrogel fluorescence sensing method disclosed by the invention is short in detection time; the operation is simple and convenient, and only one-step reaction is needed; the detection limit of tetracycline is 0.035 [mu] g / L, and the quantitative detection interval is 0.05 [mu] g / L to 800 [mu] g / L; the average recovery rate of tetracycline in river water, lake water and tap water is 92-105%, the coefficient of variation is lower than 6%, and the method can be used for quantitative detection of tetracycline in actual water.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of antibiotic monitoring, and specifically relates to a dual-effect hydrogel fluorescence sensing method for detecting tetracycline and its application. Background Art

[0002] The environmental and health risks caused by the abuse of antibiotics have attracted widespread attention worldwide. China is a major producer and consumer of antibiotics. According to statistics, the output of antibiotics reached nearly 223,000 tons in 2020. In recent years, antibiotics have been continuously detected in surface water, groundwater and even drinking water sources in many places, and the concentrations are in the trace range of ng / L - μg / L. In 2023, the Ministry of Ecology and Environment of China has clearly listed antibiotics in the "List of New Pollutants under Key Control". Tetracycline belongs to one of the tetracycline antibiotics (the main representatives are tetracycline, oxytetracycline and chlortetracycline). Because of its broad-spectrum antibacterial activity, low cost and good antibacterial effect, it is widely used in the livestock industry. The "Integrated Wastewater Discharge Standard for Urban Sewage Treatment Plants" issued in China in 2002 stipulates that the discharge concentration of tetracycline antibiotics in wastewater shall not exceed 0.5 mg / L, and the concentration entering the sewer shall not exceed 0.1 mg / L. Therefore, it is of great practical significance to develop and popularize a method for rapid quantitative detection of tetracycline in water environment with high sensitivity and high specificity.

[0003] At present, the detection of tetracycline mainly relies on large instruments such as high performance liquid chromatography and liquid chromatography tandem mass spectrometry. Although these technologies have high accuracy, the detection is time-consuming and costly; Immunoassays based on the principle of "antigen-antibody" specific affinity reaction, such as enzyme-linked immunosorbent assay (ELISA), although having high sensitivity and high specificity, are relatively cumbersome to operate and are not conducive to on-site detection. Therefore, there is an urgent need to develop a simple, rapid, sensitive and accurate TET detection method.

[0004] Aptamer (Apt) is a specific DNA or RNA sequence isolated by Systematic Evolution of Ligands by Exponential Enrichment (SELEX). It can form a certain spatial structure and specifically recognize target molecules. Compared with antibodies, the outstanding advantages of aptamers are: they can be artificially synthesized, with low production costs and stable performance; they have flexible structures and are easy to chemically modify and transform; they do not require harsh transportation and storage conditions. Therefore, aptamers are a type of novel biorecognition material with the potential to replace antibodies. DNA hybrid hydrogel is a three-dimensional cross-linked biomaterial formed by grafting DNA onto a polymer backbone through base complementary pairing between DNAs. It has good flexibility and high transparency. Therefore, it can not only be compatible with various material interfaces but also transmit optical signals without loss. In addition, the porous structure of the hydrogel is very conducive to the immobilization and embedding of biomolecules and can effectively resist fouling through strong hydration. Therefore, DNA hydrogel aptamer sensors have received extensive attention in the field of detecting small molecules, ions, proteins, etc. in complex matrix environments.

[0005] Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR-associated system (CRISPR / Cas) is a revolutionary technology in the fields of genome editing and biosensing. CRISPR / Cas12a is one of the efficient biosensing development tools, and when combined with aptamers, it can achieve the detection of non-nucleic acid targets. In this detection mode, even a small amount of target can activate the trans-cleavage property of CRISPR / Cas12a. Therefore, CRISPR / Cas12a is widely used as an effective signal amplification tool in the construction of highly sensitive biosensing technologies.

[0006] Currently, most reports combine the CRISPR / Cas system with nucleic acid amplification to further achieve signal amplification. Although the sensitivity can be improved, the detection is time-consuming and the signal stability is low. Summary of the Invention

[0007] Aiming at the defects of the existing highly sensitive antibiotic aptamer sensor technology, such as time-consuming detection and low stability, the present invention establishes a dual-effect hydrogel fluorescence sensing method for detecting tetracycline, which can achieve sensitive, rapid, accurate, and reliable quantitative analysis of tetracycline.

[0008] The present invention is achieved through the following technical solutions.

[0009] The present invention provides a dual-effect hydrogel fluorescence sensing method for detecting tetracycline, comprising the following steps:

[0010] Step 1: Prepare a dual-functional hydrogel for detecting tetracycline. The preparation of the dual-functional hydrogel includes the following steps:

[0011] Step 1: Design target DNAs S1 and S2 according to the tetracycline aptamer;

[0012] Step 2: Respectively configure target DNA S1 and the tetracycline aptamer into solutions and mix them in equal volumes for reaction. After the reaction is complete, add a 40% acrylamide solution and a TAE buffer solution and mix them evenly to obtain solution A containing the complex "target DNA S1 - tetracycline aptamer". Configure target DNA S2 into a solution and mix it evenly with a 40% acrylamide solution and a TAE buffer solution to obtain solution B. Mix solution A and solution B in equal volumes for reaction to obtain solution C containing the complex "target DNA S1 - tetracycline aptamer - target DNA S2";

[0013] Step 3: Add a dual-functional CRISPR / Cas12a solution, a fluorescent signal reporter molecule solution, an ammonium persulfate solution, and a tetramethylethylenediamine solution to solution C and mix them for reaction to form a dual-functional hydrogel;

[0014] Step 4: Vacuum-dry the prepared dual-functional hydrogel and set it aside for later use;

[0015] Step 2: Add tetracycline standard solutions with a series of concentration gradients into the detection wells of an enzyme-linked immunosorbent assay (ELISA) plate containing the dual-functional hydrogel. Measure the fluorescence values corresponding to each concentration of the tetracycline standard solution using an ELISA reader and plot a standard curve;

[0016] Step 3: Add the sample solution to be tested into the detection wells of an ELISA plate containing the dual-functional hydrogel. Under the temperature condition of 20 - 25 °C, shake it well and react in the dark for 5 - 15 min. Place the ELISA plate in an ELISA reader to detect the fluorescence value of the sample solution to be tested. The excitation wavelength set by the ELISA reader is 480 nm, and the emission wavelength is 525 nm; Substitute the measured fluorescence value of the sample solution into the standard curve plotted in Step 2 to obtain the concentration of tetracycline in the sample solution.

[0017] As a further improvement of the above solution, the 5'-end of target DNA S1 is modified with a functional group, methacrylamide, that can undergo a polymerization reaction with acrylamide, and it uses six methylene groups and five adenine deoxynucleotides as a spacer arm; the 3'-end of target DNA S2 is modified with a functional group, methacrylamide, that can undergo a polymerization reaction with acrylamide, and it uses six methylene groups and five adenine deoxynucleotides as a spacer arm; the fluorescent signal reporter molecule is a single-stranded DNA modified with a fluorescent group 6-FAM at the 5'-end and a fluorescent quenching group BHQ1 at the 3'-end.

[0018] As a further improvement of the above solution, in step 2, the complex "target DNAS1-tetracycline aptamer" is prepared by mixing 10 μmol / L target DNAS1 and 10 μmol / L tetracycline aptamer in equal volumes and reacting at a temperature of 20-25 °C for 5 min; the complex "target DNAS1-tetracycline aptamer-target DNAS2" is prepared by mixing the above complex "target DNAS1-tetracycline aptamer" and 5 μmol / L target DNAS2 in equal volumes and reacting at a temperature of 20-25 °C for 5 min; the solution C, the dual-effect CRISPR / Cas12a solution, the fluorescence signal reporter molecule solution, the ammonium persulfate solution and the tetramethylethylenediamine solution are reacted under light-shielded and shaken conditions at a temperature of 20-25 °C for 20 min to form a dual-effect hydrogel.

[0019] As a further improvement of the above solution, the dual-effect CRISPR / Cas12a includes Cas12a / crRNA1, Cas12a / crRNA2, and incubation buffer 10×NEBuffer2.1; wherein, the Cas12a / crRNA1 is obtained by mixing 2.1 μmol / L Cas12a and 2.1 μmol / L crRNA1 in equal volumes and incubating in the buffer 10×NEBuffer2.1, and the reaction molar concentration ratio of Cas12a to crRNA1 is: 1:1 to 1.5; the Cas12a / crRNA2 is obtained by mixing 2.1 μmol / L Cas12a and 2.1 μmol / L crRNA2 in equal volumes and incubating in the buffer 10×NEBuffer2.1, and the reaction molar concentration ratio of Cas12a to crRNA2 is: 1:1 to 1.5; wherein, the crRNA1 is designed according to the target DNAS1, and the crRNA2 is designed according to the target DNAS2.

[0020] As a further improvement of the above solution, the incubation temperature of Cas12a and crRNA1 in the buffer 10×NEBuffer2.1 is 37 °C and the time is 15 min; the incubation temperature of Cas12a and crRNA2 in the buffer 10×NEBuffer2.1 is 37 °C and the time is 15 min.

[0021] As a further improvement of the above solution, in step 3, the concentration of the fluorescence signal reporter molecule solution is 8-12 μmol / L.

[0022] As a further improvement of the above solution, in step three, the time for the light-shielded reaction is 10 min.

[0023] The present invention provides an application of a dual-effect hydrogel fluorescence sensing method for detecting tetracycline in the detection of tetracycline.

[0024] As a further improvement of the above solution, it is applied to the detection of tetracycline concentration in actual water bodies.

[0025] The beneficial effects of the present invention are as follows:

[0026] 1. Compared with the conventional CRISPR / Cas reaction system (only containing a single type of crRNA) for the detection of a single target in biosensing, in the present invention, a CRISPR / Cas12a system with dual-effect reaction activity (containing crRNA1 and crRNA2) is constructed by reasonably designing a dual-target DNA sequence (target DNA S1 and target DNA S2). In a single "aptamer-target" molecular recognition event, it can activate twice the amount of Cas12a, and then achieve dual-effect cleavage of the fluorescent signal reporter molecule. Signal amplification can be achieved without coupling nucleic acid amplification means, effectively improving the detection sensitivity, and avoiding problems such as long detection time and low signal stability caused by multiple steps of nucleic acid amplification reactions.

[0027] 2. In the present invention, the dual-effect hydrogel integrates all the materials required for detection at the same time, and can achieve a "one-pot" detection of tetracycline, with extremely simple operation and short detection time.

[0028] 3. In the present invention, the dual-effect hydrogel fluorescence sensing method has high specificity for tetracycline. The detection limit for tetracycline is 0.035 μg / L, and the quantitative detection range is 0.05 μg / L - 800 μg / L. The spiked recovery rates of tetracycline in three types of actual water bodies, namely tap water, lake water, and river water, are between 92% and 105%, and the coefficient of variation is within 6%, meeting the requirements for accuracy and precision.

[0029] 4. Through the dual-effect hydrogel fluorescence sensing method in the present invention, high-sensitivity, high-specificity, rapid, and accurate quantitative analysis of tetracycline in actual polluted water environments can be achieved. Description of the Drawings

[0030] Figure 1 It is the detection principle diagram of the dual-effect hydrogel fluorescence sensing method in the present invention;

[0031] Figure 2 It is the rheological parameter characterization diagram of the dual-effect hydrogel in the present invention;

[0032] Figure 3 It is the electrophoresis diagram for verifying the formation of nucleic acid complexes in the dual-effect hydrogel in the present invention;

[0033] Figure 4 It is the detection standard curve diagram of the dual-effect hydrogel fluorescence sensing method for tetracycline in the present invention.

[0034] Figure 5Schematic diagram of the specific detection result of tetracycline by the dual-effect hydrogel fluorescence sensing method in Example 1. Detailed implementation manners

[0035] In order to further elaborate the technical solution of the present invention, the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0036] Meanwhile, the following given embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention.

[0037] The experimental methods in the following embodiments are all conventional methods unless otherwise specified.

[0038] The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0039] The present invention provides a dual-effect hydrogel fluorescence sensing method for detecting tetracycline, comprising the following steps:

[0040] Step 1: Prepare a dual-effect hydrogel for detecting tetracycline, and the preparation of the dual-effect hydrogel comprises the following steps:

[0041] Step 1: Design target DNAS1 and target DNAS2 according to the tetracycline aptamer;

[0042] Step 2: Respectively configure target DNAS1 and the tetracycline aptamer into solutions, mix them in equal volume for reaction, after the reaction is complete, add a 40% acrylamide solution and a TAE buffer solution and mix them evenly to obtain solution A containing the complex "target DNAS1 - tetracycline aptamer", configure target DNAS2 into a solution and mix it evenly with a 40% acrylamide solution and a TAE buffer solution to obtain solution B, and mix solution A and solution B in equal volume for reaction to obtain solution C containing the complex "target DNAS1 - tetracycline aptamer - target DNAS2";

[0043] Step 3: Add a dual-effect CRISPR / Cas12a solution, a fluorescence signal reporter molecule solution, an ammonium persulfate (APS) solution and a tetramethylethylenediamine (TEMED) solution to solution C for mixing reaction to form a dual-effect hydrogel;

[0044] Step 4: Vacuum-dry the prepared dual-effect hydrogel and reserve it for use.

[0045] Step 2: Respectively add tetracycline standard solutions with a series of concentration gradients into the detection wells of an enzyme-linked immunosorbent assay (ELISA) plate containing the dual-effect hydrogel, measure the fluorescence values corresponding to the tetracycline standard solutions at each concentration by an enzyme label instrument, and draw a standard curve.

[0046] Step 3: Add the sample solution to be tested into the detection wells of the microplate containing the dual-effect hydrogel, shake well at a temperature of 20-25°C, react for 5-15 min in the dark, place the microplate in a microplate reader to detect the fluorescence value of the sample solution to be tested. The excitation wavelength set by the microplate reader is 480 nm, and the emission wavelength is 525 nm; substitute the measured fluorescence value of the sample solution into the standard curve drawn in Step 2 to obtain the concentration of tetracycline in the sample solution.

[0047] Further, acrylamide can form polyacrylamide with a three-dimensional network structure through intermolecular polymerization reaction.

[0048] Further, the target DNA S1 is modified at the 5' end with a functional group methacrylamide (Acrydite) that can undergo a polymerization reaction with acrylamide, and it uses 6 methylene groups (-(CH 2 ) 6 -) and 5 adenine deoxynucleotides (AAAAA) as a spacer arm.

[0049] Further, the target DNA S2 is modified at the 3' end with a functional group methacrylamide that can undergo a polymerization reaction with acrylamide, and it uses 6 methylene groups (-(CH 2 ) 6 -) and 5 adenine deoxynucleotides (AAAAA) as a spacer arm.

[0050] Further, the fluorescence signal reporter molecule is a single-stranded DNA modified with a fluorescent group 6-FAM at the 5' end and a fluorescence quenching group BHQ1 at the 3' end.

[0051] Further, in Step 2, the complex "target DNA S1 - tetracycline aptamer" is prepared by mixing 10 μmol / L target DNA S1 and 10 μmol / L tetracycline aptamer in equal volumes and reacting at a temperature of 20-25°C for 5 min; the complex "target DNA S1 - tetracycline aptamer - target DNA S2" is prepared by mixing the above complex "target DNA S1 - tetracycline aptamer" and 5 μmol / L target DNA S2 in equal volumes and reacting at a temperature of 20-25°C for 5 min;

[0052] Further, the reaction temperature of Solution A and Solution B is 20-25°C, and the reaction time is 5 min.

[0053] Further, in Step 2, the Solution C, dual-effect CRISPR / Cas12a solution, fluorescence signal reporter molecule solution, ammonium persulfate solution, and tetramethylethylenediamine solution are reacted under a temperature condition of 20-25°C in the dark and shaken for 20 min to form a dual-effect hydrogel.

[0054] Furthermore, the dual - effect CRISPR / Cas12a includes Cas12a / crRNA1, Cas12a / crRNA2, and incubation buffer 10×NEBuffer2.1.

[0055] Among them, Cas12a / crRNA1 is obtained by incubating 2.1 μmol / L Cas12a and 2.1 μmol / L crRNA1 in equal volumes in buffer 10×NEBuffer2.1, and the reaction molar concentration ratio of Cas12a to crRNA1 is 1:1 - 1.5;

[0056] Cas12a / crRNA2 is obtained by incubating 2.1 μmol / L Cas12a and 2.1 μmol / L crRNA2 in equal volumes in buffer 10×NEBuffer2.1, and the reaction molar concentration ratio of Cas12a to crRNA2 is 1:1 - 1.5;

[0057] Among them, crRNA1 is designed according to target DNA S1, and crRNA2 is designed according to target DNA S2.

[0058] Furthermore, the incubation temperature of Cas12a and crRNA1 in buffer 10×NEBuffer2.1 is 37 °C, and the time is 15 min;

[0059] Furthermore, the incubation temperature of Cas12a and crRNA2 in buffer 10×NEBuffer2.1 is 37 °C, and the time is 15 min.

[0060] Furthermore, in step 3, the concentration of the fluorescent signal reporter molecule solution is 8 - 12 μmol / L.

[0061] Preferably, in step three, the time for the light - avoiding reaction is 10 min.

[0062] Furthermore, in the dual - effect hydrogel, the tetracycline aptamer is the connecting chain of target DNA S1 and target DNA S2. A part of the base sequence of target DNA S1 can be complementary to a part of the base sequence of the tetracycline aptamer and a part of the base sequence of crRNA1; a part of the base sequence of target DNA S2 can be complementary to a part of the base sequence of the tetracycline aptamer and a part of the base sequence of crRNA2; a part of the base sequence of crRNA1 can be complementary to the corresponding part of target DNA S1, and another part of the base sequence of crRNA1 can bind to Cas12a; a part of the base sequence of crRNA2 can be complementary to the corresponding part of target DNA S2, and another part of the base sequence of crRNA2 can bind to Cas12a.

[0063] The present invention provides an application of a dual - effect hydrogel fluorescence sensing method for detecting tetracycline in the detection of tetracycline.

[0064] Furthermore, it is applied to the detection of tetracycline concentration in actual water bodies.

[0065] Among them, the actual water body refers to water containing complex environmental matrices.

[0066] Combined Figure 1 , in the present invention, the principle of the dual - effect hydrogel for detecting tetracycline concentration is as follows:

[0067] The main structure of the dual - effect hydrogel is composed of polyacrylamide chains polymerized from acrylamide monomers. Dual - target DNAs (target DNAS1 and target DNAS2) are modified on the polyacrylamide chains through a polymerization reaction and form a complex "target DNAS1 - tetracycline aptamer - target DNAS2" with tetracycline aptamers through base complementary pairing. The dual - effect CRISPR / Cas12a containing two crRNAs (crRNA1 and crRNA2) and the fluorescence signal reporter molecule are physically encapsulated in the dual - effect hydrogel. In the presence of the target tetracycline, the molecular recognition element tetracycline aptamer can specifically recognize and bind to tetracycline to form "tetracycline - tetracycline aptamer", which dissociates from the complex "target DNAS1 - tetracycline aptamer - target DNAS2". Then target DNAS1 and target DNAS2 respectively form complexes "Cas12a / crRNA1 - target DNAS1" and "Cas12a / crRNA2 - target DNAS2" with Cas12a / crRNA1 and Cas12a / crRNA2 through base complementary pairing, activating the Cas12a in the system. Subsequently, the fluorescence signal reporter molecule is trans - cleaved, releasing fluorescence. The fluorescence signal value in the system is in a proportional relationship with the tetracycline concentration.

[0068] Example 1

[0069] This example is used to describe in detail the details of each step of the present invention.

[0070] I. Preparation of a dual - effect hydrogel for detecting tetracycline.

[0071] The reagents and materials for preparing the dual - effect hydrogel include: acrylamide, target DNAS1, target DNAS2, tetracycline aptamer, dual - effect CRISPR / Cas12a, fluorescence signal reporter molecule, polymerization reaction buffer TAE buffer, initiator ammonium persulfate, and accelerator tetramethylethylenediamine.

[0072] Among them, the dual-effect CRISPR / Cas12a includes Cas12a / crRNA1, Cas12a / crRNA2, and incubation buffer 10×NEBuffer2.1. Cas12a / crRNA1 needs to be obtained by incubating Cas12a and crRNA1 in buffer 10×NEBuffer2.1, and Cas12a / crRNA2 needs to be obtained by incubating Cas12a and crRNA2 in buffer 10×NEBuffer2.1.

[0073] The specific preparation steps of the dual-effect hydrogel are as follows:

[0074] 1. Design target DNAs S1 and target DNAs S2 according to the tetracycline aptamer.

[0075] The tetracycline aptamer used is the tetracycline aptamer reported in the existing literature (Bioorganic & Medicinal Chemistry, 2008, 16(15): 7245-53.). Its sequence is as follows:

[0076] 5’-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCCCACTGCGC GTGGATCCGAGCTCCACGTG -3’;

[0077] The underlined part is complementary to part of the base sequence of target DNAs S1, and the italicized part is complementary to part of the base sequence of target DNAs S2.

[0078] Design the sequences of target DNAs S1 and target DNAs S2 according to the sequence of the tetracycline aptamer.

[0079] The sequence of target DNAs S1 is as follows:

[0080] 5’-Acrydite-(CH 2 ) 6 -AAAAACACGTGGAGCTCGGATCCAC-3’;

[0081] Among them, the bold part is complementary to the underlined part of the tetracycline aptamer sequence and part of the base sequence of crRNA1.

[0082] It should be noted that target DNAs S1 is modified at the 5’ end with a functional group methacrylamide that can polymerize with acrylamide, and it uses six methylene groups and five adenine deoxynucleotides as a spacer arm.

[0083] The sequence of target DNAs S2 is as follows:

[0084] 5’-GGGCTAGCGAATTCCGTACGAAAAA-(CH 2 ) 6 -Acrydite-3’;

[0085] Among them, the bold part is complementary to the italic part of the tetracycline aptamer sequence and partial base sequences of crRNA2.

[0086] It should be noted that the target DNA S2 is modified with a functional group, methacrylamide, at the 3'-end, which uses six methylene groups and five deoxyadenosine nucleotides as a spacer arm.

[0087] Design crRNA1 and crRNA2 according to target DNA S1 and target DNA S2 to prepare for the synthesis of dual-effect CRISPR / Cas12a.

[0088] The sequence of crRNA1 is as follows:

[0089] 5’-UAAUUUCUACUAAGUGUAGAU GUGGAUCCGAGCUCCACGUG -3’;

[0090] Among them, the bold part binds to Cas12a, and the underlined part is complementary to the bold part of target DNA S1.

[0091] The sequence of crRNA2 is as follows:

[0092] 5’-UAAUUUCUACUAAGUGUAGAU CGUACGGAAUUCGCUAGCCC -3’;

[0093] Among them, the bold part binds to Cas12a, and the underlined part is complementary to the bold part of target DNA S2.

[0094] In addition, the sequence of the fluorescence signal reporter molecule is as follows:

[0095] 5’-6-FAM-TTTTTTTTTTTTTTT-BHQ1-3’;

[0096] It should be noted that the fluorescence signal reporter molecule is a single-stranded DNA modified with a fluorescent group 6-FAM at the 5'-end and a fluorescence quenching group BHQ1 at the 3'-end.

[0097] 2. After separately preparing the target DNA S1 and the tetracycline aptamer as solutions, mix them in equal volumes and react. After the reaction is complete, add a 40% acrylamide solution and a TAE buffer and mix evenly to obtain solution A containing the complex "target DNA S1 - tetracycline aptamer". Prepare the target DNA S2 as a solution and mix it evenly with a 40% acrylamide solution and a TAE buffer to obtain solution B. Mix solution A and solution B in equal volumes and react to obtain solution C containing the complex "target DNA S1 - tetracycline aptamer - target DNA S2".

[0098] Synthesis of the complex "target DNA S1 - tetracycline aptamer - target DNA S2":

[0099] (1) Prepare the freeze-dried powder of the tetracycline aptamer and the freeze-dried powder of the target DNA S1 as a 100 μmol / L mother solution of the tetracycline aptamer and a 100 μmol / L mother solution of the target DNA S1 with ultrapure water respectively, and place them in a refrigerator at 4 °C for standby; dilute the tetracycline aptamer to 10 μmol / L with Buffer A buffer (10 mmol / L Tris-HCl, 250 mmol / L NaCl, 5 mmol / L MgCl 2 , pH 7.6), dilute the target DNA S1 to 10 μmol / L with ultrapure water, mix the two in equal volumes (20 μL), react at a temperature of 20 - 25 °C for 5 min, and then add a 40% acrylamide solution (30 μL) and a 1×TAE buffer (30 μL) to obtain solution A containing the complex "target DNA S1 - tetracycline aptamer".

[0100] (2) Prepare the freeze-dried powder of the target DNA S2 as a 5 μmol / L target DNA S2 solution with ultrapure water, take 40 μL and mix it with a 40% acrylamide solution (30 μL) and a 1×TAE buffer (30 μL) to obtain solution B containing the target DNA S2.

[0101] (3) Mix solution A (100 μL) containing the complex "target DNA S1 - tetracycline aptamer" with solution B (100 μL, 2 μmol / L) containing the target DNA S2, and react at a temperature of 20 - 25 °C for 5 min to obtain solution C containing the complex "target DNA S1 - tetracycline aptamer - target DNA S2".

[0102] 3. Add a dual-effect CRISPR / Cas12a solution, a fluorescent signal reporter molecule solution, a 10% (w / v) ammonium persulfate solution, and a 5% (v / v) tetramethylethylenediamine solution to solution C and mix and react to form a dual-effect hydrogel.

[0103] Preparation of the Cas12a solution: Dilute it to 2.1 μmol / L with 1×NEbuffer2.1 (prepare it immediately before use).

[0104] Preparation of crRNA1 solution: Dissolve the freeze-dried powder of crRNA1 with ultrapure water to prepare a 2.1 μmol / L crRNA1 solution.

[0105] Preparation of crRNA2 solution: Dissolve the freeze-dried powder of crRNA2 with ultrapure water to prepare a 2.1 μmol / L crRNA2 solution.

[0106] Synthesis of dual-effect CRISPR / Cas12a: Add Cas12a solution (10 μL, 2.1 μmol / L) and crRNA1 solution (10 μL, 2.1 μmol / L) to 10×NEBuffer2.1 buffer (10 μL) and incubate (37 °C, 15 min) to obtain a Cas12a / crRNA1 solution; add Cas12a solution (10 μL, 2.1 μmol / L) and crRNA2 solution (10 μL, 2.1 μmol / L) to 10×NEBuffer2.1 buffer (10 μL) and incubate (37 °C, 15 min) to obtain a Cas12a / crRNA2 solution.

[0107] Preparation of fluorescent signal reporter molecule solution: Dissolve the freeze-dried powder of the fluorescent signal reporter molecule with ultrapure water to prepare a 10 μmol / L fluorescent signal reporter molecule solution.

[0108] Preparation of 10% (w / v) ammonium persulfate (APS) solution: Accurately weigh 0.1 g of ammonium persulfate, dissolve it in ultrapure water, and make up the volume to 1 mL (prepare and use immediately).

[0109] Preparation of 5% (v / v) tetramethylethylenediamine (TEMED) solution: Use a micropipette to accurately measure 5 μL of TEMED and add it to a brown vial, then add 95 μL of ultrapure water and mix well.

[0110] Formation of dual-effect hydrogel:

[0111] Add Cas12a / crRNA1 solution (30 μL), Cas12a / crRNA2 solution (30 μL), fluorescent signal reporter molecule solution (40 μL, 10 μmol / L), 10% (w / v) ammonium persulfate solution (2 μL), and 5% (v / v) tetramethylethylenediamine solution (2 μL) to solution C containing the complex "target DNA S1 - tetracycline aptamer - target DNA S2" in sequence. After mixing, transfer it to an enzyme-linked immunosorbent assay (ELISA) plate (100 μL / well) and shake it in the dark at 20 - 25 °C for 20 min to form a dual-effect hydrogel.

[0112] It should be noted that in this example, to cooperate with the use of an enzyme-linked immunosorbent assay (ELISA) reader, the dual-effect hydrogel is finally formed in the detection wells of the ELISA plate.

[0113] 4. The prepared dual-effect hydrogel was vacuum-dried for 5 min and then placed in a refrigerator at 4 °C for standby.

[0114] 5. Characterize the dual-effect hydrogel and verify its feasibility for detecting tetracycline.

[0115] As Figure 2 shown, rheological parameter characterization analysis was performed on the dual-effect hydrogel prepared under the conditions of Example 1.

[0116] It can be seen from Figure 2 that the storage modulus (G') of the dual-effect hydrogel is much greater than the loss modulus (G"), which conforms to the gel properties, indicating that the dual-effect hydrogel was successfully synthesized.

[0117] As Figure 3 shown, polyacrylamide gel electrophoresis was used to verify the formation of nucleic acid complexes in the dual-effect hydrogel.

[0118] Figure 3 The bands in lanes 2, 3, and 4 in represent target DNA S1, target DNA S2, and tetracycline aptamer, respectively; the band in lane 5 indicates that target DNA S1 and tetracycline aptamer formed the complex "target DNA S1-tetracycline aptamer", the band in lane 6 indicates that tetracycline aptamer and target DNA S2 formed the complex "tetracycline aptamer-target DNA S2", and the band in lane 7 indicates that tetracycline aptamer formed complexes "target DNA S1-tetracycline aptamer-target DNA S2" with target DNA S1 and target DNA S2 respectively through base complementary pairing, laying a foundation for the next step of tetracycline detection.

[0119] II. Tetracycline standard solutions with a series of concentration gradients were respectively added to the detection wells of an enzyme-linked immunosorbent assay (ELISA) plate containing the dual-effect hydrogel, and the fluorescence values corresponding to the tetracycline standard solutions at each concentration were measured by an ELISA reader to plot a standard curve.

[0120] 1. Dilute the tetracycline standard with Buffer A buffer into standard solutions with the following concentration gradients: 1000, 500, 200, 100, 50, 20, 10, 5, 1, 0.5, 0.2, 0.1, 0.05 (μg / L).

[0121] 2. Take 100 μL of the standard solutions at each concentration and add them to the detection wells of an ELISA plate containing the dual-effect hydrogel respectively. At the same time, set up a blank control well (in the blank control well, Buffer A buffer is used instead of the standard solution, that is, without tetracycline, and the others are the same). Set the excitation wavelength of the ELISA reader to 480 nm and the emission wavelength to 525 nm. Under the temperature condition of 20-25 °C, react for 10 min in the dark, and detect the fluorescence values of the corresponding detection wells of the tetracycline standard solutions with a series of concentration gradients.

[0122] As shown Figure 4 in the figure, the fluorescence value is positively correlated with the tetracycline concentration and shows a good linear relationship within a certain concentration range (R 2 = 0.994). The error bars are the standard deviations of n = 3 parallel experiments, and the relative standard deviations (coefficients of variation) are all within 5%, indicating good detection precision.

[0123] 3. Taking the measured fluorescence value (F) as the ordinate and the corresponding tetracycline concentration as the abscissa, plot the standard curve. At the same time, plot the linear relationship graph for the linear region in the curve (taking the log value of the tetracycline concentration as the abscissa).

[0124] Among them, the fitting function model of the standard curve is as follows:

[0125] y = a - b×ln(x + c) (Model 1)

[0126] In the formula: a is the vertical displacement parameter, which determines the up and down position of the curve;

[0127] b is the scaling parameter, which determines the slope and direction of the curve;

[0128] c is the horizontal displacement parameter, which determines the left and right position of the curve;

[0129] x is the concentration of tetracycline, the independent variable;

[0130] y is the fluorescence value corresponding to x, the dependent variable.

[0131] The linear relationship fitting model is as follows:

[0132] y = k×logx + b (Model 2)

[0133] In the formula: k is the slope;

[0134] b is the intercept (x = 0);

[0135] x is the concentration of tetracycline, the independent variable;

[0136] y is the fluorescence value corresponding to x, the dependent variable.

[0137] The calculation formula for the detection limit of tetracycline is as follows:

[0138]

[0139] In the formula: c LOD is the detection limit;

[0140] σ is the standard deviation of the detection results of blank samples;

[0141] k is the slope in Model 2.

[0142] Using Model 1 forFigure 4 The standard curve in Figure 4 (inset in

[0143] III. Detection of the fluorescence value of the sample solution to be measured and specificity analysis of tetracycline detection

[0144] Detection of the fluorescence value of the sample solution to be measured: Add the sample solution to be measured into the detection well of the microplate loaded with the dual-effect hydrogel. Under the temperature condition of 20-25°C, shake well and react in the dark for 5-15 min. Place the microplate in a microplate reader to detect the fluorescence value of the sample solution to be measured. The excitation wavelength set by the microplate reader is 480 nm, and the emission wavelength is 525 nm.

[0145] Five common types of antibiotics, namely tetracyclines (tetracycline, oxytetracycline), quinolones (ciprofloxacin, ofloxacin), sulfonamides (trimethoprim, sulfamethoxazole), β-lactams (penicillin, cephalothin), and dibenzazepines (carbamazepine), were selected to evaluate the specificity of the detection method. The tetracycline standard was diluted to 100 μg / L with Buffer A buffer, and other antibiotic standards were diluted to 1000 μg / L with Buffer A buffer. The fluorescence values of the prepared solutions of various antibiotics were detected by the above method. As Figure 5 can be seen, the fluorescence value corresponding to tetracycline is much higher than that of other antibiotics, indicating that the dual-effect hydrogel fluorescence sensing method of the present invention has high specificity for detecting tetracycline.

[0146] Example 2

[0147] This example is used to illustrate the practical applicability of the dual-effect hydrogel fluorescence sensing method in the present invention for tetracycline detection.

[0148] The application steps are as follows:

[0149] In this example, the actual water bodies selected are tap water, lake water, and river water samples. Based on the instantaneous sampling method, the water samples are collected in brown glass bottles, transported to the laboratory by cold chain, and immediately filtered after arrival. Tetracycline standards are added to the water samples at spiked concentrations of 0.1 μg / L, 1 μg / L, and 10 μg / L respectively, and then fluorescence detection is carried out according to the sensing method in the present invention and the recovery rate is calculated. The measurement results are shown in Table 1. Among them, the recovery rate measurement method is as follows: The sample addition concentration (final concentration) is represented by X, the average value of the measurement of the sample without adding the standard is x 1 , and the average value of the measurement of the sample with the added standard is x 2, each sample was detected in parallel 5 times, and the recovery rate was calculated as follows:

[0150]

[0151] The determination results are shown in Table 1. The coefficient of variation of the detection results of tetracycline in the three types of actual water bodies is within 6%, indicating that the double-effect hydrogel has good detection precision for tetracycline; the recovery rate of the detection results is 92% - 105%, indicating that the double-effect hydrogel has good detection accuracy for tetracycline.

[0152] This proves that the double-effect hydrogel fluorescence sensing method of the present invention can meet the detection requirements for tetracycline in actual water bodies.

[0153] Table 1 Determination results of tetracycline recovery rate in different water bodies

[0154]

[0155] The above shows and describes the basic principles, main features and advantages of the present invention. For those skilled in the art, it is obvious that the present invention is not limited to the details of the above exemplary embodiments, and can be implemented in other specific forms without departing from the spirit or basic features of the present invention. Therefore, from any point of view, the embodiments should be regarded as exemplary and non-limiting. The scope of the present invention is defined by the appended claims rather than the above description. Therefore, it is intended to embrace all changes falling within the meaning and scope of the equivalent elements of the claims in the present invention.

[0156] In addition, it should be understood that although this specification is described according to embodiments, not every embodiment only contains an independent technical solution. This narrative way of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A dual-effect hydrogel fluorescence sensing method for detecting tetracycline, characterized in that: The following steps are involved: Step 1: preparing a dual-effect hydrogel for detecting tetracycline, the preparation of the dual-effect hydrogel comprising the following steps: Step 1: Design target DNAS1 and target DNAS2 based on tetracycline aptamer; Step: 2: The target DNA S1 and the tetracycline aptamer are respectively prepared into solutions and then mixed in equal volumes for reaction. After the reaction is complete, 40% acrylamide solution and TAE buffer are added and mixed evenly to obtain solution A containing the complex "target DNA S1-tetracycline aptamer". The target DNA S2 is prepared into a solution and then mixed evenly with 40% acrylamide solution and TAE buffer to obtain solution B. The solution A and the solution B are mixed in equal volumes for reaction to obtain solution C containing the complex "target DNA S1-tetracycline aptamer-target DNA S2"; Step 3: Add dual-effect CRISPR / Cas12a solution, fluorescent signal reporter molecule solution, ammonium persulfate solution and tetramethylethylenediamine solution to solution C for mixed reaction to form a dual-effect hydrogel; Step 4: vacuum-dry the prepared dual-effect hydrogel for later use; Step 2: Add tetracycline standard solutions with a series of concentration gradients into the detection wells of the ELISA plate containing the dual-effect hydrogel, measure the fluorescence value corresponding to each concentration of tetracycline standard solution by an ELISA instrument, and draw a standard curve; Step 3: Add the sample solution to be tested into the detection well of the ELISA plate containing the dual-effect hydrogel, fully shake at a temperature of 20 to 25°C, and react in the dark for 5 to 15 minutes. Place the ELISA plate in an ELISA reader to detect the fluorescence value of the sample solution to be tested. The excitation wavelength of the ELISA reader is set to 480 nm and the emission wavelength is set to 525 nm. Substitute the measured fluorescence value of the sample solution into the standard curve drawn in step 2 to obtain the concentration of tetracycline in the sample solution.

2. A dual-effect hydrogel fluorescence sensing method for detecting tetracycline according to claim 1, characterized in that: The target DNA S1 is modified at the 5' end with a functional group methacrylamide that can undergo polymerization reaction with acrylamide, and has 6 methylene groups and 5 adenine deoxynucleotides as spacer arms; The target DNA S2 is modified at the 3' end with a functional group methacrylamide that can undergo polymerization reaction with acrylamide, and has 6 methylene groups and 5 adenine deoxynucleotides as spacer arms; The fluorescent signal reporter molecule is a single-stranded DNA with a fluorescent group 6-FAM modified at the 5' end and a fluorescent quenching group BHQ1 modified at the 3' end.

3. The dual-effect hydrogel fluorescence sensing method for detecting tetracycline according to claim 1, characterized in that: In step 2, the complex "target DNAS1-tetracycline aptamer" is prepared by mixing equal volumes of 10 μmol / L target DNAS1 and 10 μmol / L tetracycline aptamer and reacting them at 20-25° C. for 5 min; The complex "target DNAS1-tetracycline aptamer-target DNAS2" is prepared by mixing equal volumes of the above complex "target DNAS1-tetracycline aptamer" and 5 μmol / L target DNAS2 and reacting them at a temperature of 20-25°C for 5 minutes; The solution C, the dual-effect CRISPR / Cas12a solution, the fluorescent signal reporter molecule solution, the ammonium persulfate solution and the tetramethylethylenediamine solution are reacted at a temperature of 20 to 25° C. in the dark for 20 minutes to form a dual-effect hydrogel.

4. The dual-effect hydrogel fluorescence sensing method for detecting tetracycline according to claim 1, characterized in that: The dual-effect CRISPR / Cas12a includes Cas12a / crRNA1, Cas12a / crRNA2, and incubation buffer 10×NEBuffer2.1; The Cas12a / crRNA1 is prepared by mixing equal volumes of 2.1 μmol / L Cas12a and 2.1 μmol / L crRNA1 and incubating the mixture in a buffer solution 10×NEBuffer 2.

1. The reaction molar concentration ratio of Cas12a to crRNA1 is 1:1 to 1.

5. The Cas12a / crRNA2 is obtained by mixing 2.1 μmol / L Cas12a and 2.1 μmol / L crRNA2 in equal volumes and incubating in a buffer 10×NEBuffer 2.1, and the reaction molar concentration ratio of Cas12a to crRNA2 is: 1:1-1.5; Wherein, the crRNA1 is designed according to the target DNA S1, and the crRNA2 is designed according to the target DNA S2.

5. A dual-effect hydrogel fluorescence sensing method for detecting tetracycline according to claim 4, characterized in that: The incubation temperature of Cas12a and crRNA1 in buffer 10×NEBuffer2.1 is 37° C. for 15 min; The incubation temperature of the Cas12a and crRNA2 in the buffer 10×NEBuffer2.1 was 37° C. for 15 min.

6. The dual-effect hydrogel fluorescence sensing method for detecting tetracycline according to claim 1, characterized in that: In step 3, the concentration of the fluorescent signal reporter molecule solution is 8-12 μmol / L.

7. The dual-effect hydrogel fluorescence sensing method for detecting tetracycline according to claim 1, characterized in that: In step 3, the reaction time in the dark is 10 minutes.

8. Use of the dual-effect hydrogel fluorescence sensing method for detecting tetracycline as claimed in any one of claims 1 to 7 in the detection of tetracycline.

9. The use of a dual-effect hydrogel fluorescence sensing method for detecting tetracycline according to claim 8 in tetracycline detection, characterized in that: It is used to detect the concentration of tetracycline in actual water bodies.

Citation Information

Patent Citations

  • Tetracycline bivalent aptamer sequence and non-enzyme label-free detection method

    CN113913432A

  • Fluorescent biosensor for detecting tetracycline based on CRISPR-Cas system

    CN114836521A