Bacillus subtillis Bs-HGT3 and preparation method thereof

By genetically modifying Bacillus subtilis, the Bs-HGT3 strain was constructed, which solved the problem of low transformation efficiency in the existing technology and achieved rapid and efficient gene transfer and integration.

CN120158412APending Publication Date: 2025-06-17BEIJING INST OF TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510066857.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-01-16
Publication Date
2025-06-17

AI Technical Summary

Technical Problem

The prior art has complex, time-consuming and difficult to master in improving the transformation efficiency of Bacillus subtilis, especially when using ordinary plasmids.

Method used

B.s-HGT3 strain was constructed by genetically modifying B. subtilis, knocking out specific DNA fragments, and inserting xylose-induced regulatory elements and comK genes into the bpr gene to improve its gene transfer ability.

Benefits of technology

It significantly shortens the preparation time of competent cells, improves transformation efficiency, and can successfully transfer exogenous plasmids or resistance gene fragments in the range of 10 pM to 100 pM, and ensures stable integration of exogenous genes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120158412A_ABST
    Figure CN120158412A_ABST
Patent Text Reader

Abstract

The invention discloses bacillus subtillis Bs-HGT3 and a preparation method thereof, and belongs to the field of genetically engineered bacteria, the bacillus subtillis Bs-HGT3 is obtained by carrying out gene modification on bacillus subtillis 168, and a genome of the bacillus subtillis Bs-HGT3 has the following characteristics that DNA fragments at the 417th site, the 992nd site, the 440th site and the 605th site of the genome of the bacillus subtillis 168 are deleted, and a regulatory element induced by xylose and a comK gene are inserted into a bpr gene. The competent cells prepared from the bacillus subtillis Bs-HGT3 have very high conversion efficiency and recombination efficiency, and can be widely applied to the field of genetic engineering bacteria.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and particularly relates to a method for preparing Bacillus subtilis with high gene transfer ability. Background Art

[0002] Scientists are committed to improving the transformation efficiency of Bacillus subtilis to facilitate enzyme directed evolution and metabolic engineering transformation in Bacillus subtilis. Currently, there are mainly three reported methods for improving the transformation efficiency of Bacillus subtilis: one is to use a multi-copy plasmid for transformation, and this method requires the construction of a multi-copy plasmid; the second is the electroporation method, which requires the use of high concentrations of mannitol and sorbitol to create a high osmotic pressure environment for cells; the third is the protoplast method. Since protoplasts are fragile, it is difficult and very cumbersome to prepare Bacillus subtilis protoplasts, and polyethylene glycol is also required to promote the entry of DNA. Although these three methods can improve the transformation efficiency of Bacillus subtilis, these methods are laborious, complex, time-consuming and difficult to master. Therefore, there is a need to develop a simple and easy-to-operate method for efficiently transforming ordinary plasmids.

[0003] As early as 1958, Spizizen et al. found that Bacillus subtilis ( Bacillus subtilis ) strain 168 has the ability to form natural competence, and the formation of competence in Bacillus subtilis is the result of highly ordered genetic regulation in the late growth stage. Therefore, many researchers have started from the genetic regulatory network of Bacillus subtilis in the late growth stage, analyzed the genetic pathways of cell competence formation and spore formation, and the genetic determination mechanism of cells in competence formation and spore formation, and found that ComK is a key transcription factor that regulates competence formation in Bacillus subtilis. The change of its concentration will regulate the expression of genes related to the late stage of competence development such as cell morphological changes and exogenous DNA uptake, and easily make cells enter the competent state. Therefore, there is a literature that integrated comK gene into the genome of Bacillus subtilis 1A751 to obtain strain SCK6, and induced the expression of comK through a xylose-induced promoter, thereby preparing highly competent SCK6. By transforming a multi-copy plasmid, its transformation efficiency can reach 10 7 CFU / μg, and the process of preparing its competence is also very simple and easy to operate. However, this literature only proves that the induced strain has the ability to transform exogenous plasmids and the ability to circularize plasmids in vivo, and does not prove that SCK6 has the ability to transfer exogenous plasmids into cells and integrate them into the genome. Moreover, this study did not optimize the conditions for preparing and transforming the competence of SCK6, nor did it study the effect of this method on transforming ordinary plasmids.

[0004] There is a literature that uses the SCK6 strain as the starting strain, without changing the genotype, and improves its plasmid transformation efficiency by changing the culture conditions, induction concentration, etc. After medium optimization, such as changing to nutrient-rich media YN and MD; or by changing the concentration of xylose during induction, the transformation efficiency of unmethylated plasmids with specific resistance can be improved. However, the application scope of this technology is relatively narrow, and high transformation efficiency can only be obtained when the transformed plasmid has specific resistance and a specific vector. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a Bacillus subtilis with high-level gene transfer ability and its preparation method.

[0006] The technical solution of the present invention is: Bacillus subtilis Bs-HGT3, which is obtained by genetically modifying Bacillus subtilis ( Bacillus subtilis ) 168. The genome of the said Bs-HGT3 has the following characteristics: the DNA fragment at positions 417,992 - 440,605 of the genome of Bacillus subtilis ( Bacillus subtilis ) 168 is deleted and a xylose-induced regulatory element and bpr gene are inserted into the comK gene. The genome sequence of Bacillus subtilis ( Bacillus subtilis ) 168 is numbered NC_000964.3 in the NCBI database; the nucleotide sequence of the xylose-induced regulatory element is as shown in SEQ ID NO.2, and the nucleotide sequence of the comK gene is as shown in SEQ ID NO.3.

[0007] Furthermore, the nucleotide sequence of the bpr gene is as shown in SEQ ID NO.1.

[0008] The use of the above-mentioned Bacillus subtilis Bs-HGT3 as a genetically engineered bacterium.

[0009] Furthermore, the said use refers to using Bacillus subtilis Bs-HGT3 as a host bacterium for plasmid transformation, DNA fragment transformation or recombination.

[0010] Furthermore, the said use refers to genetically modifying on the basis of the genome of Bacillus subtilis Bs-HGT3 to meet specific functions.

[0011] The method for preparing the above-mentioned Bacillus subtilis Bs-HGT3 includes the following steps: (1) Knock out the DNA fragment at positions 417,992 - 440,605 in the genome of Bacillus subtilis ( Bacillus subtilis ) 168. The Bacillus subtilis ( Bacillus subtilis)The 168 genomic sequence is numbered NC_000964.3 in the NCBI database; (2) Insert a xylose-inducible regulatory element and Bacillus subtilis gene into the bpr gene of Bacillus subtilis ( comK ) 168; The bpr gene has a nucleotide sequence as shown in SEQ ID NO.1, the xylose-inducible regulatory element has a nucleotide sequence as shown in SEQ ID NO.2, and the comK gene has a nucleotide sequence as shown in SEQ ID NO.3.

[0012] Compared with the prior art, the present invention has the following beneficial effects: The preparation time of the competent cells of the strain prepared by the present invention is shortened from several hours of the traditional method to only 3.5 hours, significantly improving the work efficiency. Once the competent cells are prepared, they can be directly co-cultured with exogenous plasmids or resistance gene fragments for 2 hours. Under such optimized conditions, the competent cells can successfully transfer exogenous plasmids (with a minimum concentration of 10 pM) or exogenous resistance gene fragments (with a minimum concentration of 5 pM) of any resistance without modification into the cells. This process not only improves the efficiency of gene transfer but also ensures the stable integration of exogenous genes in the target cells. The transformed cells can successfully grow on the resistance plate and form single colonies, indicating that the transformation and expression of exogenous genes have been effectively verified.

[0013] Compared with the comK gene and Bacillus subtilis 168 strain (subsequently replaced by Bs-CK) into which the same xylose-inducible element is inserted, the Bs-HGT3 strain of the present invention can transfer plasmids as low as 10 pM into the cells and form single colonies at the lowest, and can also transform 5 pM of resistance gene fragments into the cells and integrate them into the genome. When the Bs-HGT3 strain of the present invention transforms 50 pM or 100 pM of exogenous plasmids, compared with Bs-CK, the transformation efficiency can be increased by one order of magnitude, and it is not affected by the resistance genes and the size of the plasmids contained in the plasmids. When transforming 10 pM or 50 pM of exogenous DNA fragments, compared with Bs-CK, the recombination efficiency can be increased by two orders of magnitude. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Transformation efficiency diagram of 6Kb plasmid; Figure 2 Transformation efficiency diagram of 4.2Kb plasmid; Figure 3 Transformation plate diagram of 4.2Kb plasmid; Figure 4Verification of positive colonies transformed with a 4.2Kb plasmid; Figure 5 Recombination efficiency diagram of a 2.6Kb DNA fragment; Figure 6 Recombinant plate diagram of a 2.6Kb DNA fragment; Figure 7 Verification diagram of positive colonies of recombinant 2.6Kb DNA fragment. Specific implementation mode

[0015] The experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples are all obtained from commercial channels unless otherwise specified.

[0016] Example 1: Construction of strain Bs-HGT3 and control strain In this example, Bacillus subtilis ( Bacillus subtilis ) strain 168 was used as the starting strain, and the double N20 method was used to knockout the full-length 22.6 Kb large fragment from yclG to gabR (the sequence located at positions 417,992 - 440,605 on genome NC_000964.3, https: / / www.ncbi.nlm.nih.gov / search / all / ?term=NC_000964.3, including yclG, yczF, gerKA, gerKC, gerKB, yclH, yclI, yclJ, yclK, rapC, phrC, yczM, yczN, thrD, pbtN, pbtO, pbtP, pbtQ, ycnB, ycnC, nfrAB, ycnE, yczG, gabR genes). The obtained strain was named Bs-m3 strain. The xylose-induced regulatory element and bpr gene were inserted into the comK gene on the genomes of Bs-m3 strain and Bacillus subtilis strain 168, and they were named Bs-HGT3 strain and Bs-CK strain respectively. The latter is the control strain.

[0017] The DNA sequence of the full-length 22.6 Kb large fragment is as follows:

[0018] The following is the specific method for editing and knocking out a 22.6 kb region on the genome of Bacillus subtilis strain 168: (1) Knockout yclG To gabR region, two rounds of plasmid construction are required for editing with a circular template. First, introduce the N20 sequence. Select two N20 sequences with high efficiency and low off-target rate through the website: N20-1 ttaatagacgcaacgcttgg and N20-2 gaatatttcaagctgcagcc, respectively, at the head and tail of the knockout region. At the same time, design the forward and reverse primers Δ3-N20-1 and Δ3-N20-2, as well as Δ3-N20-3 and Δ3-N20-4. Use PCR to introduce N20-1 into the plasmid pJOE-8999 to construct the knockout plasmid pJOE-8999-1. The total volume of the PCR reaction system is 50 μL, including 25 μL of primestar high-fidelity enzyme, 22 μL of ddH2O, 1 μL of the upstream primer Δ3-N20-1, 1 μL of the downstream primer Δ3-N20-2, and 1 μL of the template pJOE-8999. The PCR program is: 98 °C for 1 min, 56 °C for 15 s, 72 °C for 1 min 20 s, and set 30 cycles. Obtain the plasmid pJOE-8999-N20-1 constructed in the first round. Then, use PCR again to introduce N20-2 into the plasmid pJOE-8999-N20-1 to construct the knockout plasmid pJOE-8999-N20-2. The primers are Δ3-N20-3 and Δ3-N20-4, and the PCR program is the same as that for the construction of pJOE-8999-1.

[0019] (2) Using the plasmid pJOE-8999-N20-2 constructed in step (1) as a template, introduce a repair fragment on this basis.

[0020] ① First, perform PCR on the template pJOE-8999-N20-2. The upstream primer F1 is 5’-ATAAGGCCTTTCTAGATTAAGAAATAATCTTCATCTAAAATATACTTCAG -3’ and the downstream primer F2 is 5’-CGTTGGCCGTCGACC -3’. The total volume of the PCR reaction system is 50 μL, including 25 μL of primestar high-fidelity enzyme, 22 μL of ddH2O, 1 μL of F1, 1 μL of F2, and 1 μL of pJOE-8999-N20-2 as the template. The PCR program is: 98 °C for 1 min, 56 °C for 15 s, 72 °C for 1 min 20 s, and set 30 cycles. The target size is about 8 K, which becomes the plasmid backbone R1 constructed in this round.

[0021] ②Secondly, the positions for repairing fragment selection are about 1 kb upstream and downstream of the region to be knocked out. Using primers Δ3-HA-1, Δ3-HA-2 and Δ3-HA-3, Δ3-HA-4, PCR is carried out using the genome of Bacillus subtilis 168 as a template respectively to obtain the upstream and downstream homologous arm fragments, and gel electrophoresis is run to verify whether the band sizes are correct. To improve the plasmid construction efficiency, the upstream and downstream homologous arm fragments are first subjected to oePCR to make them into a fragment of about 2 kb, which is the repair fragment R2.

[0022] ③Connect R1 and R2 by Gibson assembly. The Gibson ligation system is generally configured to 10 μL, and the specific ratio is: 3 μL of R1 and 2 μL of R2, 5 μL of Gibson Assembly® Master Mix. After mixing, place it in a 50 °C water bath for ligation for 30 minutes. Transform the ligation product into 100 μL of commercially available competent cells of Escherichia coli JM109, ice bath for 20 min, heat shock at 42 °C for 45 s, immediately place on ice for 2 minutes, and then immediately add 700 μL of SOC medium, and resuscitate in a shaker at 37 °C and 220 rpm for 45 min. After centrifugation at 5000 rpm for 2 min, remove 500 μL of the supernatant, evenly spread the remaining bacterial solution on the corresponding resistant plate, place it in an incubator at 37 °C overnight, pick monoclonal colonies, extract plasmids and perform sequencing verification. If the corresponding N20 and homologous arms are successfully introduced in the sequencing results, it indicates that the correct knockout plasmid has been obtained.

[0023] (3) Transform the knockout plasmid constructed in step (2) into the competent cells of Bacillus subtilis 168, resuscitate in a shaker at 37 °C and 220 rpm for 2 h, take 200 μL and spread it on an LB plate containing 20 μg / mL kanamycin resistance and 0.2% mannitol, place it in an incubator at 30 °C overnight, pick monoclonal colonies and verify them with the outer primers Δ3-Test-1 and Δ3-Test-2 outside the homologous arms and the primers Δ3-Test-3 and Δ3-Test-4 inside the gene respectively to obtain successfully edited single colonies.

[0024] Inoculate the verified correct single colonies into antibiotic-free LB medium, culture at 37 °C for 24 h, then streak on an antibiotic-free plate, place it in an incubator at 37 °C for 12 h, and then pick the single colonies on the plate and streak them on antibiotic-free and kanamycin-resistant plates respectively. If it can grow on the antibiotic-free plate and cannot grow on the resistant plate, it indicates that the plasmid has been successfully lost. After losing the plasmid, the obtained strain is named Bacillus subtilis Bs-m3 strain and stored in a -80 °C refrigerator.

[0025] The following is the specific method for inserting the xylose-inducible regulatory element (shown as SEQ ID NO.2) and bpr gene (shown as SEQ ID NO.3) into the genomes of Bacillus subtilis 168 and Bs-m3 strains (the region is shown as SEQ ID NO.1, located at positions 1,599,283 - 1,604,717 of the Bacillus subtilis genome): comK (1) Construct a gene replacement plasmid. (1) Construct a gene replacement plasmid.

[0026] ① First, perform PCR on the template pJOE-8999 using CX-2 and CX-10. The total volume of the PCR reaction system is 50 μL, including 25 μL of primestar high-fidelity enzyme, 22 μL of ddH2O, 1 μL of F1, 1 μL of F2, and 1 μL of pJOE-8999-N20-2 as the template. The PCR program is: 98°C for 1 min, 56°C for 15 s, 72°C for 1 min 20 s, and set 30 cycles. The target size is around 7.2K, and it becomes the plasmid backbone R1 constructed in this round.

[0027] ② Second, construct the N20 fragment for knockout. Perform PCR on the template pJOE-8999 using CX-1 and CX-3. The total volume of the PCR reaction system is 50 μL, including 25 μL of primestar high-fidelity enzyme, 22 μL of ddH2O, 1 μL of F1, 1 μL of F2, and 1 μL of pJOE-8999-N20-2 as the template. The PCR program is: 98°C for 1 min, 56°C for 15 s, 72°C for 1 min 20 s, and set 30 cycles. The target size is around 241 bp, and it becomes the N20 fragment R2 of the plasmid constructed in this round.

[0028] ③ Finally, construct a repair fragment containing the upstream and downstream homologous arms and the xylose-inducible regulatory comK element to be inserted. Use primers CX-4, CX-5 and CX-8, CX-9 to perform PCR with the Bacillus subtilis 168 genome as the template to obtain the upstream and downstream homologous arm fragments, and run a gel to verify whether the band size is correct. Use primers CX-6 and CX-7 to perform PCR on the plasmid pHT-01- comK to obtain the comK fragment containing the xylose regulatory element. To improve the plasmid construction efficiency, perform oePCR on the N20 fragment R2, the upstream and downstream homologous arm fragments, and the comK fragment containing the xylose regulatory element to make it a fragment of about 3.7 kb, which is the repair fragment R3.

[0029] ④Connect R1 and R3 by Gibson assembly. The Gibson ligation system is generally configured to be 10 μL, and the specific ratio is: 3 μL of R1, 2 μL of R3, and 5 μL of Gibson Assembly® Master Mix. After mixing, place it in a 50 °C water bath for 30 minutes for ligation. Transform the ligation product into 100 μL of commercially available competent cells of Escherichia coli JM109, ice-bath for 20 min, heat-shock at 42 °C for 45 s, immediately place it on ice for 2 minutes, and then immediately add 700 μL of SOC medium. Resuscitate in a shaker at 37 °C and 220 rpm for 45 min. After centrifugation at 5000 rpm for 2 min, discard 500 μL of the supernatant, evenly spread the remaining bacterial solution on the corresponding resistant plate, place it in an incubator at 37 °C overnight, pick monoclonal colonies, extract plasmids and perform sequencing verification. If the corresponding N20 and homologous arms are successfully introduced in the sequencing results, it indicates that the correct replacement plasmid has been obtained.

[0030] (2)Transform the knockout plasmid constructed in step (1) into the competent cells of Bacillus subtilis 168 and Bacillus subtilis Bs-m3, resuscitate in a shaker at 37 °C and 220 rpm for 2 h, take 200 μL and spread it on an LB plate containing 20 μg / mL kanamycin resistance and 0.2% mannose, place it in an incubator at 30 °C overnight, pick monoclonal colonies and verify them with the internal gene primer CX-11 and the external homologous arm primer CX-12 respectively to obtain successfully edited single colonies.

[0031] Inoculate the verified single colonies into antibiotic-free LB medium, culture at 37 °C for 24 h, then streak on an antibiotic-free plate, place it in an incubator at 37 °C for 12 h, and then pick the single colonies on the plate and streak them on antibiotic-free and kanamycin-resistant plates respectively. If it can grow on the antibiotic-free plate but not on the resistant plate, it indicates successful plasmid loss. After plasmid loss, the obtained strains are named Bacillus subtilis Bs-CK strain and Bs-HGT3 strain respectively, and stored in a -80 °C refrigerator.

[0032] Table 1 Some primers and sequences involved in the examples of the present invention

[0033] Example 2: Verify the transformation efficiency of Bs-HGT3 competent cells for carrying Kan r resistance plasmids at different concentrations The successfully constructed Bs-HGT3 strain and Bs-CK strain were streaked on LB solid medium. Single colonies were separately picked and transferred into LB liquid medium. After overnight culture at 37 °C and 220 rpm, they were transferred to fresh LB liquid medium at a ratio of 1:20 and cultured at 37 °C and 220 rpm for about 1.5 h. When the OD 600 reached 0.5, a xylose solution with a final concentration of 10 g / L was added and induced for 2 h. Take several sterile 2 mL ep tubes, dispense 1.9 mL of the bacterial solution into each tube, centrifuge at 5000 rpm for 2 min, discard 0.9 mL of the supernatant, resuspend the cells, add a glycerol solution with a final concentration of 20%, and store it in a -80 °C refrigerator, which can be stored for 14 days.

[0034] Add plasmids with a full length of about 6 Kb and carrying Kan r resistance at concentrations of 10 pM, 50 pM, and 100 pM to the aliquoted competent cells. Set 3 parallel experiments for each concentration. After culturing at 37 °C and 220 rpm for about 2.5 h, centrifuge at 5000 rpm for 2 min, discard 0.8 mL of the supernatant, resuspend the cells, take 1 μL of the bacterial solution and add it to 1 mL of sterile water, then spread it on an LB solid plate, and spread the remaining bacterial solution on the corresponding resistant plates. Incubate overnight in a 37 °C incubator.

[0035] Count the number of colonies (CFU + ) on the resistant plates, and express the transformation efficiency as the number of positive colonies (CFU + / μg DNA) obtained per μg of DNA transformed. As Figure 1 shown, the Bs-HGT3 strain can transfer 10 pM of the plasmid into the cells, while the Bs-CK strain cannot form obvious colonies.

[0036] Example 3: Verification of the transformation efficiency of Bs-HGT3 competent cells for plasmids carrying Cm r resistance The successfully constructed Bs-HGT3 strain and Bs-CK strain were streaked on LB solid medium. Single colonies were separately picked and transferred into LB liquid medium. After overnight culture at 37 °C and 220 rpm, they were transferred to fresh LB liquid medium at a ratio of 1:20 and cultured at 37 °C and 220 rpm for about 1.5 h. When the OD 600 reached 0.5, a xylose solution with a final concentration of 10 g / L was added and induced for 2 h. Take several sterile 2 mL ep tubes, dispense 1.9 mL of the bacterial solution into each tube, centrifuge at 5000 rpm for 2 min, discard 0.9 mL of the supernatant, resuspend the cells, add a glycerol solution with a final concentration of 20%, and store it in a -80 °C refrigerator, which can be stored for 14 days.

[0037] Add plasmids with a full length of approximately 4.2 Kb carrying Cm resistance and red fluorescent protein (RFP) at concentrations of 10 pM, 50 pM, and 100 pM to the aliquoted competent cells. Set up 3 parallel experiments for each concentration. After culturing at 37°C and 220 rpm for approximately 2.5 h, centrifuge at 5000 rpm for 2 min, discard 0.8 mL of the supernatant, resuspend the bacterial cells, take 1 μL of the bacterial suspension and add it to 1 mL of sterile water, then spread it onto an LB solid plate. Spread the remaining bacterial suspension onto the corresponding resistant plates and incubate overnight in a 37°C incubator. r Count the number of colonies (CFU) on the resistant plates, and use the number of positive colonies (CFU / μg DNA) obtained per μg of DNA transformation to represent the transformation efficiency. As shown, at a plasmid concentration of 10 pM, the Bs-HGT3 strain can form approximately 5×10 positive transformants per μg of DNA transformation, while the Bs-CK strain can only form approximately 2×10 transformants. At different plasmid concentrations, the CFUs formed by the Bs-HGT3 strain are all higher than those of the Bs-CK. As shown, because the plasmid carries the RFP protein, the positive transformants are the red colonies formed on the resistant plates. As the plasmid concentration increases, the number of CFUs formed by the Bs-HGT3 strain gradually increases, significantly higher than that of the control Bs-CK strain. To prove that the transformants on the resistant plates carry the target plasmid rather than being false positives, randomly pick several single colonies from the plates and perform PCR using the specific primers on the plasmid. The results are as shown. In the plasmid transformation experiments at different concentrations, the single colonies picked are all colonies carrying the Cm resistance gene.

[0038] Count the number of colonies (CFU + ), and use the number of positive colonies (CFU + / μg DNA) obtained per μg of DNA transformation to represent the transformation efficiency. As Figure 2 shown, at a plasmid concentration of 10 pM, the Bs-HGT3 strain can form approximately 5×10 4 positive transformants per μg of DNA transformation, while the Bs-CK strain can only form approximately 2×10 3 transformants. At different plasmid concentrations, the CFUs formed by the Bs-HGT3 strain are all higher than those of the Bs-CK. As + shown, because the plasmid carries the RFP protein, the positive transformants are the red colonies formed on the resistant plates. As the plasmid concentration increases, the number of CFUs formed by the Bs-HGT3 strain gradually increases, significantly higher than that of the control Bs-CK strain. To prove that the transformants on the resistant plates carry the target plasmid rather than being false positives, randomly pick several single colonies from the plates and perform PCR using the specific primers on the plasmid. The results are as Figure 3 shown. In the plasmid transformation experiments at different concentrations, the single colonies picked are all colonies carrying the Cm + resistance gene. Figure 4 shown, in the plasmid transformation experiments at different concentrations, the single colonies picked are all colonies carrying the Cm r resistance gene.

[0039] Example 4: Verify the transformation efficiency of Bs-HGT3 competent cells for different concentrations of the Kan r resistance gene Streak the successfully constructed Bs-HGT3 strain and Bs-CK strain on an LB solid medium. Randomly pick single colonies and transfer them to an LB liquid medium. After overnight culturing at 37°C and 220 rpm, transfer them to a fresh LB liquid medium at a ratio of 1:20 and culture at 37°C and 220 rpm for approximately 1.5 h. Wait until the OD 600When it reaches 0.5, add a xylose solution with a final concentration of 10 g / L and induce for 2 h. Take several sterile 2 mL ep tubes, dispense 1.9 mL of the bacterial solution into each tube, centrifuge at 5000 rpm for 2 min, discard 0.9 mL of the supernatant, resuspend the cells, add a glycerol solution with a final concentration of 20%, and store at -80 °C in the refrigerator for 14 days.

[0040] Add DNA fragments with a full length of approximately 2.6 Kb, carrying Kan r resistance, rfp genes and homologous arms of 600 bases (nt) each at the upstream and downstream to the competent cells after sub-packaging. Set 3 parallel experiments for each concentration. After culturing at 37 °C and 220 rpm for about 2.5 h, centrifuge at 5000 rpm for 2 min, discard 0.8 mL of the supernatant, take 1 μL of the bacterial solution after resuspending the cells into 1 mL of sterile water and spread it on the LB solid plate, and spread the remaining bacterial solution on the corresponding resistant plates, and place them in a 37 °C incubator for overnight culture.

[0041] Count the number of colonies (CFU + ) on the resistant plates and the total number of colonies (CFU T ) in the bacterial solution. Use the ratio of CFU + / CFU T to represent the recombination efficiency. As Figure 5 shown, for the Bs-HGT3 strain at the exogenous DNA fragment concentrations of 5 pM, 10 pM, and 50 pM, there are single colonies with successful recombination in all three parallel experiments. However, for the Bs-CK strain, the number of single colonies formed at each concentration is small and the parallelism is unstable. The efficiency is reduced by 2 orders of magnitude compared to the Bs-HGT3 strain. Under the condition of 5 pM DNA fragment, the Bs-CK strain cannot form positive recombinant colonies. As Figure 6 shown, since the DNA fragment carries the RFP protein, the positive transformants are the red colonies formed on the resistant plates. As the concentration of the DNA fragment increases, the number of CFU + formed by the Bs-HGT3 strain gradually increases, which is significantly higher than that of the control Bs-CK strain. To prove that the transformants on the resistant plates carry the target plasmid rather than false positives, randomly pick several single colonies on the plate, design one primer outside the homologous arm of the genome and the other primer on the inserted fragment for colony PCR. The results are as Figure 7 shown. In the recombination experiments of DNA fragments at different concentrations, the single colonies picked are all the colonies that kan r recombine the resistance gene into the genome.

Claims

1. Bacillus subtilis Bs-HGT3, characterized in that It is produced by Bacillus subtilis ( Bacillus subtilis ) 168 was obtained by genetic modification, and the genome of Bs-HGT3 has the following characteristics: Bacillus subtilis ( Bacillus subtilis ) 168 genome DNA fragment at position 417,992-440,605 and in bpr The xylose-induced regulatory element and comK gene, the Bacillus subtilis ( Bacillus subtilis ) 168 genome sequence is numbered as NC_000964.3 in the NCBI database; the nucleotide sequence of the xylose-induced regulatory element is shown in SEQ ID NO.2, comK The nucleotide sequence of the gene is shown in SEQ ID NO.

3.

2. The Bacillus subtilis Bs-HGT3 according to claim 1, characterized in that Said bpr The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. Use of the Bacillus subtilis Bs-HGT3 described in any one of claims 1-2 as a genetically engineered bacterium.

4. The use according to claim 3, characterized in that The use refers to using Bacillus subtilis Bs-HGT3 as a host bacterium to carry out plasmid transformation, DNA fragment transformation or recombination.

5. The use according to claim 3, characterized in that: The use refers to carrying out gene modification on the basis of the Bacillus subtilis Bs-HGT3 genome so as to meet specific functions.

6. A method for preparing the Bacillus subtilis Bs-HGT3 according to any one of claims 1 to 2, characterized in that: The steps include: (1) Knockout of Bacillus subtilis ( Bacillus subtilis )168 genome at positions 417,992-440,605, the Bacillus subtilis ( Bacillus subtilis )168 The genome sequence is numbered NC_000964.3 in the NCBI database; (2) In Bacillus subtilis ( Bacillus subtilis ) 168 bpr Insertion of xylose-induced regulatory elements into the gene comK Gene; Said bpr The nucleotide sequence of the gene is shown in SEQ ID NO.1, the nucleotide sequence of the xylose-induced regulatory element is shown in SEQ ID NO.2, and the comK The nucleotide sequence of the gene is shown in SEQ ID NO.3.