Wheat gene, protein and application of wheat gene and protein in controlling development of wheat leaf pillow and size of leaf included angle

Abstract

The invention discloses a gene TaLG2 and a homologous gene TaLG2L of the gene influencing the development of wheat leaf pillow and the size of a leaf included angle, the gene directly regulates and controls a wheat leaf pillow organ, meanwhile, TaLG2 (3A, 3B and 3D) and the homologous gene TaLG2L (1A, 1B and 1D) are knocked out, so that the leaf pillow organs of all leaves of wheat can be deleted, the leaf included angle is reduced, and a foundation is laid for high-close planting breeding and yield improvement of wheat.

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering, and specifically relates to the wheat gene TaLG2 and its homologous gene TaLG2L, as well as the encoded proteins, and also relates to the application of this gene and protein in controlling the development of wheat leaf sheaths and the size of leaf angles. Background Art

[0002] The size of the wheat leaf angle is an important agronomic trait that determines leaf erectness. An erect plant type can reduce the mutual shading between leaves, improve the ventilation condition in the middle and lower parts of the plant, and is beneficial to the improvement of the population photosynthetic efficiency. Compared with varieties with a loose plant type, compact varieties with a small leaf angle can make more full use of light energy to accumulate more dry matter and increase yield. The patent application for invention CN118207351A discloses a CAPS marker for a new allelic variation of the wheat leaf angle gene TaSPL8, which can be used to identify the size of the wheat leaf angle and can be used to improve wheat breeding accordingly. Discovering new genes that affect the size of the wheat leaf angle and using genetic engineering means to improve wheat traits are technical problems to be solved in this field. Summary of the Invention

[0003] One object of the present invention is to provide the gene TaLG2 and its homologous gene TaLG2L that affect the size of the wheat leaf angle. This gene directly regulates the wheat leaf sheath organ. Simultaneously knocking out TaLG2 (3A, 3B, 3D) and its homologous gene TaLG2L (1A, 1B, 1D) can cause the absence of the leaf sheath organs of all wheat leaves and the reduction of the leaf angle, laying a foundation for high-density wheat breeding and yield improvement.

[0004] In order to achieve the above object, the present invention adopts the following technical solutions:

[0005] The wheat gene TaLG2 (3A), its nucleotide sequence is as shown in SEQ ID NO.1; the wheat gene TaLG2 (3B), its nucleotide sequence is as shown in SEQ ID NO.2; the wheat gene TaLG2 (3D), its nucleotide sequence is as shown in SEQ ID NO.3.

[0006] The protein encoded by the wheat gene TaLG2 (3A), its amino acid sequence is as shown in SEQ ID NO.7; the protein encoded by the wheat gene TaLG2 (3B), its amino acid sequence is as shown in SEQ ID NO.8; the protein encoded by the wheat gene TaLG2 (3D), its amino acid sequence is as shown in SEQ ID NO.9.

[0007] The homologous gene TaLG2L(1A) of wheat gene TaLG2 has a nucleotide sequence as shown in SEQ ID NO.4; the homologous gene TaLG2L(1B) has a nucleotide sequence as shown in SEQ ID NO.5; the homologous gene TaLG2L(1D) has a nucleotide sequence as shown in SEQ ID NO.6.

[0008] The protein encoded by gene TaLG2L(1A) has an amino acid sequence as shown in SEQ ID NO.10; the protein encoded by gene TaLG2L(1B) has an amino acid sequence as shown in SEQ ID NO.11; the protein encoded by gene TaLG2L(1D) has an amino acid sequence as shown in SEQ ID NO.12.

[0009] Another object of the present invention is to provide the use of the above genes or proteins in regulating the development of wheat leaf sheaths and / or the size of leaf angles, specifically by regulating the presence or absence of wheat leaf sheath organs to regulate the size of wheat leaf angles.

[0010] Preferably, when using gene TaLG2 and its homologous gene TaLG2L to regulate the development of wheat leaf sheaths and leaf angles, select sgRNA containing the target sites of the conserved sequences of TaLG2(3A, 3B, 3D) and its homologous gene TaLG2L(1A, 1B, 1D), construct a CRISPR / CAS9 vector, transfer it into wheat Fielder, and use gene editing technology to cause base insertion or deletion mutations in the coding regions of TaLG2(3A, 3B, 3D) and its homologous gene TaLG2L(1A, 1B, 1D), so that the functions of TaLG2(3A, 3B, 3D) and its homologous gene TaLG2L(1A, 1B, 1D) are lost. The loss of the functions of gene TaLG2 and its homologous gene TaLG2L will result in the absence of leaf sheath tissues in all leaves of the plant and the reduction of leaf angles.

[0011] The present invention has the following beneficial effects:

[0012] 1. Gene TaLG2 and its homologous gene TaLG2L are a group of genes specifically expressed in the early stage of wheat leaf sheath development, and this gene can be used to only change the leaf sheaths of crops without affecting other traits.

[0013] 2. Gene TaLG2 and its homologous gene TaLG2L can effectively regulate the development process of leaf sheaths to achieve the purpose of changing leaf angles.

[0014] 3. After successfully knocking out gene TaLG2 and its homologous gene TaLG2L using CRISPR / Cas9, screening plants without residual Cas9 protein in the genome provides materials for cultivating wheat varieties with compact plant types through molecular breeding. Description of the Drawings

[0015] Figure 1 is the RNA-seq sequencing result;

[0016] Figure 2 is the qRT-PCR result;

[0017] Figure 3 is the mutation types of TaLG2-3A, 3B, 3D and TaLG2L-1A, 1B, 1D in the homozygous mutant plant 8-4-3 obtained by knocking out TaLG2 and its homologous gene TaLG2L using the CRISPR / CAS9 technology;

[0018] Figure 4 is the homozygous mutant plant 8-4-3 obtained by knocking out TaLG2 and its homologous gene TaLG2L using the CRISPR / CAS9 technology. Compared with the wild type (WT), the pulvinus tissue is missing and the leaf angle is smaller;

[0019] Figure 5 is the scanning electron microscopy result, further showing the homozygous mutant plant 8-4-3. Compared with the wild type (WT), at the cytological level, it is proved that after the mutation of TaLG2 and its homologous gene TaLG2L, the cells of the pulvinus tissue disappear. Specific implementation mode

[0020] The present invention uses transcriptome sequencing and real-time fluorescence quantitative PCR (qRT-PCR) technology to identify the wheat genes TaLG2 (3A, 3B, 3D) and its homologous gene TaLG2L (1A, 1B, 1D). Through wheat genetic transformation experiments and phenotypic analysis, it is found that: using the CRISPR-Cas9 technology to simultaneously knock out TaLG2 (3A, 3B, 3D) and its homologous gene TaLG2L (1A, 1B, 1D), all leaves show the absence of pulvinus tissue, smaller leaf angles, and upright plant types. Therefore, knocking out the TaLG2 gene and TaLG2L gene through genetic engineering technology can change the development of the pulvinus and the formation of leaf angles, thereby improving the plant type and planting density of wheat crops, laying a foundation for wheat trait improvement and yield increase.

[0021] In the following gene synthesis process or wheat application test, unless otherwise specified, they are all conventional test methods and technical means in the art; the reagents or biological materials involved, unless otherwise specified, are all publicly available or commercially available products that can be directly purchased.

[0022] Example 1 Identification of the gene TaLG2 and its homologous gene TaLG2L that control the development of the pulvinus and the size of the leaf angle using transcriptome sequencing and qRT-PCR technology

[0023] Under normal conditions, wheat Chinese Spring seedlings grown for 4, 8, and 12 days starting from seed soaking were respectively defined as the first stage (S1), the second stage (S2), and the third stage (S3) of leaf sheath development. Leaf sheath tissues (LJS1, LJS2, LJS3) at the three stages, as well as leaf tissues (B) and leaf sheath tissues (S) at the S3 stage, were taken for RNA-seq sequencing, and the differential gene TaLG2 (3A, 3B, 3D) and its homologous gene TaLG2L (1A, 1B, 1D) were identified. The results are as Figure 1 shown. It can be seen from the Figure 1 RNA-seq sequencing results that TaLG2-3A is specifically expressed in the late stage of leaf sheath development (LJS3), while TaLG2-3B, 3D and TaLG2L-1A, 1B, 1D are specifically highly expressed in the early stage S1 (LJS1) of leaf sheath development.

[0024] Through bioinformatics analysis, differential genes specifically expressed at the three stages and a set of genes specific to leaf sheath tissues were obtained. Among the differential gene sets, TraesCS3A03G0881600 (denoted as TaLG2-3A), TraesCS3B03G1007900 (denoted as TaLG2-3B), TraesCS3D03G0809000 (denoted as TaLG2-3D), and TraesCS1A03G0698700 (denoted as TaLG2L-1A), TraesCS1B03G0795400 (denoted as TaLG2L-1B), TraesCS1D03G0663600 (denoted as TaLG2L-1D) were identified. qRT-PCR analysis showed that the gene TaLG2-3A was specifically expressed in leaf sheath tissues (LJ). The detection results of the conserved primers for the three genes TaLG2-3A, 3B, and 3D showed that the expression level of the gene TaLG2 in leaf sheath tissues (LJ) was higher than that in leaf tissues (B). The three genes TaLG2L-1A, 1B, and 1D were highly homologous, and specific primers could not be designed. The detection results using conserved primers showed that the expression level of TaLG2L in leaf sheath tissues was higher than that in both leaf tissues (S) and leaf sheath tissues (S), which was consistent with the transcriptome data ( Figure 2 ).

[0025] Example 2 Cloning of the gene TaLG2 and its homologous gene TaLG2L that regulate wheat leaf sheath development and leaf angle size

[0026] 2.1 The total volume of the reaction system was 50 μl, with 1 μl (about 50 ng) of Chinese Spring cDNA as the template, 25 μl of Max DNA Polymerase, 2 μl of primers (1 μl for each primer), and ddH2O (sterile deionized water) was added to 22 μl to make up 50 μl.

[0027] 2.2 The reaction procedure was as follows: denaturation at 98°C for 3 min, followed by 35 cycles of 98°C for 15 s, 55°C for 15 s, and 72°C for 40 s, and then extension at 72°C for 5 min.

[0028] 2.3 The primers used were as follows:

[0029] TaLG2-DF ATGGTGCAAGGTGAGGAGGC

[0030] TaLG2-DR TCAAAATCCGGAGAACTGATTCT

[0031] TaLG2L-AF ATGAGTAGAGTTCTTCCACTCATTG

[0032] TaLG2L-AR TCAGAGGCCGGAGAACT Obtain the TaLG2-3A, 3B, 3D nucleotide sequences described in SEQ ID NO.1-3 and the nucleotide sequences of TaLG2L-1A, 1B, 1D described in SEQ ID NO.4-6. The amino acid sequences encoded by the TaLG2-3A, 3B, 3D genes are shown in SEQ ID NO.7, 8, 9, and the amino acid sequences encoded by the TaLG2L-1A, 1B, 1D genes are shown in SEQ IDNO.10, 11, 12.

[0033] Example 3 Regulation of wheat leaf sheath development and leaf angle size by TaLG2 and its homologous gene TaLG2L

[0034] 3.1 Construction of the CRISPR / Cas9 vector

[0035] Select target sites (Grna1, Grna2) containing the conserved sequences of TaLG2 and its homologous gene TaLG2L, and construct the CRISPR / Cas9 vector.

[0036] The target sites used were:

[0037] Grna1 CCCCACGCTGGAGATCTTCCCTT

[0038] Grna2 CCGCTGCTTACTTTGGCGAGTTG

[0039] Among them, the total volume of the CRISPR / Cas9 vector construction was 50 μl, with 1 μl (about 50 ng) of template, 25 μl of Max DNA Polymerase, 2 μl of primers (1 μl for each primer), and ddH2O (sterile deionized water) was added to 22 μl to make up 50 μl.

[0040] The reaction program was: denaturation at 98°C for 3 min, 35 cycles of 98°C for 15 s, 55°C for 15 sec, and 72°C for 40 sec, and extension at 72°C for 5 min.

[0041] Take 2 μl of CRISPR / Cas9 vector containing Grna1 and Grna2 targets, add it to 50 μl EHA105 competent cells, mix thoroughly, add it to the pre-cooled electroporation cup, and perform electroporation transformation. The parameters of the electroporation instrument are: voltage 2.45 kV, resistance 200 Ω, and capacitance 200 μF.

[0042] 3.2 Wheat genetic transformation

[0043] Select wheat seeds with full grains and no damage, and wash them with ddH2O three times, 5 minutes each time. Place the seeds in a sterile conical flask, add 75% ethanol, mix well and let stand for 5 minutes. Pour out the ethanol, add seed disinfectant to the conical flask, shake the conical flask to mix well, and let stand for 15 minutes. Rinse the wheat seeds with sterile ddH2O 5 times, and then add enough ddH2O to soak for 12 hours. Place the seeds in a sterile culture dish, use a sterile scalpel to peel off the endosperm, place the embryo on the callus induction medium, and culture in the dark at 25°C in the tissue culture room for 10 days to obtain wheat callus induced by mature embryos. Agrobacterium EHA105 carrying CRISPR / Cas9 plasmids targeting Grna1 and Grna2 was inoculated into 5 mL of YEB liquid medium containing 50 mg / L rifampicin and 50 mg / L kanamycin sulfate, placed in an air bath shaker, and cultured at 28°C, 170 r / min until OD600≈1.0. The cultured bacterial solution was inoculated into 50 mL of YEB liquid medium containing 50 mg / L rifampicin and 50 mg / L kanamycin sulfate at 1:100 (v:v), placed in an air bath shaker, and cultured at 28°C, 170 r / min until OD600≈0.5. The bacterial solution was centrifuged at 5000×g for 2 min, the supernatant was discarded, and the bacteria were washed twice with sterile ddH2O. The bacteria were resuspended in the callus infection solution to an OD600≈0.5. The callus was placed in the infection solution and allowed to stand for 30 min. Use sterile filter paper to absorb the residual bacterial liquid on the callus, and place the callus on the co-cultivation medium, and culture it in the tissue culture room at 25°C and darkness for 3 days to complete the Agrobacterium-mediated infection of wheat callus. Remove the callus from the co-cultivation medium and wash it 3 times with sterile ddH2O, 5 minutes each time. Transfer the washed callus to the differentiation medium and culture it in the tissue culture room at 25°C and light for 20 days. The differentiated sterile seedlings are transferred to the screening medium and continue to be cultured in the tissue culture room for 20 days. The sterile seedlings that survived the screening were transferred to the rooting medium, and after the length of the growing root system is greater than 3 cm, they were transplanted into a culture pot filled with vermiculite and continued to be cultured in the greenhouse.

[0044] Example 4 Transplanting, Genotype Mutation Identification and Phenotype Analysis

[0045] Take the leaves of transgenic T1 and T2 generation plants, extract DNA, and amplify the edited fragments to identify homozygous mutant plants. Figure 3 In the homozygous mutant plant 8-4-3 obtained by using the CRISPR / CAS9 technology to knockout TaLG2 and its homologous gene TaLG2L, the mutation types of TaLG2-3A, 3B, 3D and TaLG2L-1A, 1B, 1D are as follows. Figure 3 It can be seen that the mutant genotypes of the homozygous mutant plants 8-4-3 of TaLG2 and TaLG2L. Among them, the mutation type of TaLG2-3A is the deletion of 2 bases, TaLG2-3B is the deletion of 1 base, TaLG2-3D is the deletion of 5 bases, TaLG2L-1A is the deletion of 17 bases, TaLG2L-1B is the insertion of 1 base, and TaLG2L-1D is the deletion of 16 bases. The sequencing results are all single peaks, indicating that they are all homozygous mutations, and all lead to premature termination of translation, indicating that they are the homozygous mutation types of TaLG2 and TaLG2L genotypes.

[0046] The primers used to identify the mutation types are as follows:

[0047] TaLG2-3A-genomeF TACACCAGCAGCCAACAGTGTA

[0048] TaLG2-3A-genomeR ATGTGCCTCTGAGACGAGACGGG

[0049] TaLG2-3B-genomeF TCTTCCATGCACCTTAGCCAC

[0050] TaLG2-3B-genomeR ATGTATGGATCTTGTGAGTGAG

[0051] TaLG2-3D-genomeF ACATGCAGCTAGCAGCTCGGC

[0052] TaLG2-3D-genomeR AACAGTGAGGGAGAGTGGTCA

[0053] TaLG2L-1A-genomeF CAACTGCTAGTGTACGTGCG

[0054] TaLG2L-1A-genomeR GTCACCATCAACGCCTCCT

[0055] TaLG2L-1B-genomeF CATGTTGCCTTTACATTCTTGAA

[0056] TaLG2L-1B-genomeR CAAAGAGAGGAGAGCGAGGTGA

[0057] TaLG2L-1D-genomeF TCTGCTATCTCAACTGCTAGT

[0058] TaLG2L-1D-genomeR TTGCTGTTGCCGCACCTT

[0059] Phenotypic analysis is as Figure 4 and Figure 5 shown below:

[0060] It can be seen from Figure 4 that the homozygous mutant plants 8-4-3 of TaLG2 and TaLG2L showed the absence of pulvinus tissue and a smaller leaf angle compared with the wild type (WT) in terms of morphology. It can be seen from Figure 5 that the homozygous mutant plants 8-4-3 of TaLG2 and TaLG2L showed the absence of pulvinus tissue in terms of cytological structure compared with the wild type (WT).

Claims

1. A wheat gene, the nucleotide sequence of which is shown in SEQ ID NO.1, or in SEQ ID NO.2, or in SEQ ID NO.

3.

2. A protein whose amino acid sequence is shown in SEQ ID NO.7, or in SEQ ID NO.8, or in SEQ ID NO.

9.

3. A wheat gene, the nucleotide sequence of which is shown in SEQ ID NO.4, or in SEQ ID NO.5, or in SEQ ID NO.

6.

4. A protein whose amino acid sequence is shown in SEQ ID NO.10, or in SEQ ID NO.11, or in SEQ ID NO.

12.

5. Use of the gene as claimed in claim 1 or 3 or the protein as claimed in claim 2 or 4 in regulating the development of wheat pulvinus and / or the size of leaf angle.

6. The use according to claim 5, characterized in that The angle of wheat leaves can be regulated by controlling the presence or absence of wheat pulvinus organs.

7. The use according to claim 6, characterized in that: Select the sgRNA containing the gene described in claim 1 and the gene conserved sequence target site described in claim 3, construct a CRISPR / CAS9 vector, transfer it into wheat Fielder, and use gene editing technology to Base insertion or deletion mutations occur in the coding regions of the three genes described in claim 1 and the three genes described in claim 3, resulting in loss of function of the three genes described in claim 1 and the three genes described in claim 3, leading to the loss of pulvinus tissue of all leaves of the wheat plant and a decrease in leaf angle.

Images