OsABCA2 gene mutant and application thereof in improving brown planthopper resistance of rice

By introducing specific mutations into the OsABCA2 gene, CRISPR/Cas9 technology is used to enhance rice's resistance to brown planthoppers, the problem of insufficient insect resistance in the existing technology is solved, and the effect of improving crop insect resistance and yield is achieved.

CN120158461AActive Publication Date: 2025-06-17JIANGSU ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510645581.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-20
Publication Date
2025-06-17
Estimated Expiration
2045-05-20

AI Technical Summary

Technical Problem

The prior art is difficult to effectively improve the resistance of rice to brown planthoppers, resulting in loss of crop yield.

Method used

Mutations were introduced at specific locations of the OsABCA2 gene by CRISPR/Cas9 gene editing technology, and the OsABCA2 gene mutant was obtained, which significantly enhanced the resistance of rice to brown planthoppers.

Benefits of technology

The OsABCA2 gene mutant rice showed significantly enhanced resistance against brown planthoppers, improving the insect resistance of crops, thereby promoting high rice yields.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120158461A_ABST
    Figure CN120158461A_ABST
Patent Text Reader

Abstract

The invention provides an OsABCA2 gene mutant and application of the OsABCA2 gene mutant to improvement of brown planthopper resistance of rice, and belongs to the technical field of agricultural biology. In order to improve the brown planthopper resistance of rice, a CRISPR / Cas9 gene editing technology is utilized, and mutation is introduced at a specific position of the OsABCA2 gene, so that a rice plant with the mutation site is obtained. Detection on gene mutation types, insect resistance and phenotypes of the mutant rice shows that the rice containing the OsABCA2 gene mutant has remarkably enhanced resistance in the aspect of resisting brown planthoppers. The application of the gene mutant achieves the purpose of promoting high yield of the rice by improving the insect resistance of the rice, and has great agricultural production potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of agricultural science and technology. Specifically, it relates to an OsABCA2 gene mutant and its application in improving the resistance of rice to the brown planthopper. Background Art

[0002] Gene editing technologies (such as CRISPR / Cas9) provide a new approach for the directional improvement of insect-resistant traits in rice due to their high efficiency and precision. This technology can precisely perform site-directed editing on the genomic sequence of target genes through the assembly of guide RNA and nuclease, thereby achieving the improvement of specific traits. This study focused on the defense response mechanism of rice after being invaded by the brown planthopper. Through transcriptome analysis, differentially expressed genes induced by brown planthopper feeding were screened, and it was found that the ABC transporter family member OsABCA2 was significantly upregulated in the pest response. Scientists have found that the ABC protein family is widely involved in plant stress resistance, the transport of secondary metabolites, and immune signal transduction. Therefore, we speculate that OsABCA2 may play a key role in the immune response of rice, especially in resisting pests. To verify this hypothesis, we used the CRISPR / Cas9 technology to construct an OsABCA2 gene knockout mutant. The experimental results showed that the mutant rice of OsABCA2 gene showed a significant improvement in resistance to the brown planthopper compared with ordinary rice. This result reveals the negative regulatory role of OsABCA2 in the interaction between rice and the brown planthopper, provides a theoretical basis and technical support for analyzing the insect-resistant molecular mechanism and creating non-chemically dependent insect-resistant rice varieties, and has important significance for promoting the sustainable development of agriculture. Summary of the Invention

[0003] In order to solve the above-mentioned defects and deficiencies in the prior art, the present invention provides an OsABCA2 gene mutant and its application in improving the resistance of rice to the brown planthopper. By using gene editing technology to target and modify specific mutation sites of the OsABCA2 gene, a mutant plant with significantly enhanced resistance is obtained. This mutant can be directly used for the breeding of rice varieties highly resistant to the brown planthopper, effectively improving the yield while enhancing the insect resistance of crops, and providing an efficient technical path for rice insect-resistant breeding.

[0004] To solve the above technical problems: The first object of the present invention is to provide an OsABCA2 gene mutant, and the gene sequence of the mutation site of the OsABCA2 gene is as shown in SEQ ID NO. 4.

[0005] Furthermore, the gene sequence of OsABCA2 is shown as SEQ ID NO.1 (7403bp, including 5' / 3' regulatory regions, 16 exons and 15 introns), the corresponding mRNA sequence is shown as SEQ ID NO.2, and the amino acid sequence of the encoded protein is shown as SEQ ID NO.3.

[0006] The second object of the present invention is to provide an application of the above-mentioned OsABCA2 gene mutant in improving the resistance of rice to brown planthopper.

[0007] The third object of the present invention is to provide an application of the above-mentioned OsABCA2 gene mutant in breeding rice resistant to brown planthopper.

[0008] Furthermore, it is identified whether the rice plant contains the mutant site gene sequence as shown in SEQ ID NO. 4.

[0009] Furthermore, the base sequences of the specific primers for identifying whether the plant contains the mutant site gene sequence of the OsABCA2 gene are shown as SEQ ID NO. 7 or SEQ ID NO. 8. Through specific primer amplification and sequencing alignment, it is quickly identified whether the mutant site of wild-type rice is a mutant, realizing the efficient screening of resistant rice plants.

[0010] The fourth object of the present invention is to provide a recombinant vector or transgenic cell containing the above-mentioned OsABCA2 gene mutant as shown in SEQ ID NO. 9.

[0011] The fifth object of the present invention is to provide a method for breeding rice resistant to brown planthopper, comprising the following steps: Determine the mutant site of the OsABCA2 gene, and the gene sequence of the mutant site is shown as SEQ ID NO. 4; Transform Agrobacterium tumefaciens EHA105 with pBWA(v)Hu-ylcas-abca2, infect rice callus, and differentiate to obtain T0 generation plants; then, amplify the 820bp target fragment with specific primers with base sequences shown as SEQ ID NO.7 and SEQ ID NO.8, screen positive homozygous mutants by sequencing, and obtain a stable genetic line through multiple generations of cultivation.

[0012] Beneficial technical effects achieved by the present invention: The present invention provides an OsABCA2 gene mutant and its application in improving the resistance of rice to brown planthoppers. In order to improve the brown planthopper resistance of rice, the CRISPR / Cas9 gene editing technology is used to introduce mutations at specific positions of the OsABCA2 gene, thereby obtaining rice plants with this mutation site. Through the detection of the gene mutation type, insect resistance, and phenotype of these mutant rice plants, it is found that the rice containing the OsABCA2 gene mutant has significantly enhanced resistance to brown planthoppers. The application of this gene mutant promotes the high yield of rice by improving the insect resistance of rice, and has great potential for agricultural production.

[0013] On this basis, the present invention also provides a new method for breeding rice with brown planthopper resistance. By detecting whether the rice plants carry the gene sequence of a specific mutation site, excellent plants with strong resistance can be quickly screened out, and plants with poor resistance can be eliminated in time, thereby improving the seed selection efficiency and saving a large amount of breeding costs. This method makes the breeding process of rice with brown planthopper resistance more efficient and accurate, and provides a faster and more effective technical means for rice insect-resistant breeding in agricultural production. Brief Description of the Drawings

[0014] Figure 1 It is the map of the recombinant vector pBWA(v)Hu-ylcas-abca2 of the present invention; Figure 2 It is the mRNA expression level of the OsABCA2 gene in rice at different time points after being fed by brown planthoppers; "**" indicates a difference greater than 2-fold between the treatment group and the control group; Figure 3 It is the amino acid sequence of the expressed protein after the mutation of the OsABCA2 gene in the OsABCA2 gene mutant rice; the gray shaded part indicates the same amino acid sequence; Figure 4 It is the statistical detection of the brown planthopper resistance characteristics of the OsABCA2 gene mutant rice. Among them, 4A is the effect on the feeding (honeydew amount) of brown planthoppers, 4B is the effect on the survival rate of nymphs, 4C is the effect on the egg-laying amount of female adults, 4D is the feeding selectivity of the abca2-6 plant to female adults, 4E is the effect of the abca2-6 plant on the egg-laying amount, 4F is the feeding selectivity of the abca2-12 plant to female adults, 4G is the effect of the abca2-12 plant on the egg-laying amount, and "**" indicates a highly significant difference between the treatment group and the control group; Figure 5 It is the statistical detection of the growth and development index of the OsABCA2 gene mutant rice. Among them, 5A is the effect on the germination rate, 5B is the effect on the plant height, and 5C is the growth phenotype of rice. Detailed Embodiments

[0015] The present invention will be further described below in conjunction with specific embodiments. The following embodiments are only used to more clearly illustrate the technical solution of the present invention, and cannot be used to limit the protection scope of the present invention.

[0016] The present invention patent will be further described below in conjunction with the accompanying drawings and embodiments.

[0017] Example 1 Detection of the mRNA expression level of the OsABCA2 gene in rice at different time points after feeding by the brown planthopper

[0018] At present, there is no research report on the response of the OsABCA2 gene when insects feed on rice. In this example, the mRNA expression levels of the OsABCA2 gene in rice at different time points after feeding by the brown planthopper were detected to verify its association with the feeding of the brown planthopper. The experimental operation process is as follows: Xiushui 11 rice plants (from Jiaxing Academy of Agricultural Sciences) with consistent growth at about 50 days old were selected, and glass tubes (8 cm high and 4 cm in diameter) with small holes were put on the base of the stems. 20 gravid female brown planthoppers were placed in the tubes for feeding, and the tube openings were sealed with breathable sponges. After feeding for 1, 3, 8, 24, and 48 hours, the outermost three layers of the leaf sheaths were taken and quickly frozen in liquid nitrogen for RNA extraction. Each experiment was repeated biologically 3 times, and each time was a mixture of 5 randomly selected plants. After reverse transcription, quantitative PCR detection was carried out (reaction program: 95°C for 30 seconds, 95°C for 5 seconds, 60°C for 30 seconds, 40 cycles). The quantitative primers for the OsABCA2 gene were: forward primer (F) as shown in SEQ ID NO.10: 5’-TTCAAGGAGTTCGCTCACCC-3’; reverse primer (R) as shown in SEQ ID NO.11: 5’-ATGTGACGAAAGCCTCCCAG-3’. As an internal reference gene, the Osactin gene of rice was selected: forward primer (F) as shown in SEQ ID NO.12: 5’-CTGGTATTGCTGACCGTAT-3’, reverse primer (R) as shown in SEQ ID NO.13: 5’-GTTGGAAGGTGCTAAGGGA-3’.

[0019] The experiment used rice plants without feeding as the control group, and the relative mRNA expression level of the OsABCA2 gene was calculated by method. The results are as Figure 2 shown: After the brown planthopper fed for 1, 3, 8, 24, and 48 hours, the expression level of the OsABCA2 gene was significantly higher than that of the control group. Therefore, it was shown that the feeding of the brown planthopper significantly induced the expression of the OsABCA2 gene in rice.

[0020] Example 2 Cultivation of OsABCA2 gene mutant plants It was found in Example 1 that the feeding of Nilaparvata lugens on rice can significantly increase the expression level of the OsABCA2 gene. Therefore, in this example, the OsABCA2 gene was mutated by gene editing technology to improve the resistance of rice to Nilaparvata lugens. The breeding process is as follows: (1) Determine the gene sequence of the mutation site: Search for the wild-type OsABC gene sequence (as shown in SEQ ID NO. 1) through the Nipponbare rice genome database, and use the CRISPR / Cas9 technology to determine the mutation site (as shown in SEQ ID NO. 4).

[0021] (2) Construct mutant rice of OsABCA2: Synthesize the sgRNA expression cassette by total gene synthesis, and use the primer combination abca2-F (as shown in SEQ ID NO. 5) and abca2-R (as shown in SEQ ID NO. 6) to ligate the expression cassette to the plant binary vector pBWA(v)Hu-ylcas with the Cas9 gene through BsaI endonuclease to obtain the recombinant vector pBWA(v)Hu-ylcas-abca2 (part of the vector sequence is as shown in SEQ ID NO. 9), and its spectrogram is as Figure 1 shown. Then, the plasmid with correct sequencing was transfected into Agrobacterium tumefaciens EHA105 to infect the callus of Nipponbare rice seeds. After differentiation and rooting, the rice seedlings were transplanted into pots to obtain T0 generation rice.

[0022] (3) Mutant detection: When the T0 generation rice grew to the three-leaf stage, extract the leaf DNA, and use the detection primers (as shown in SEQ ID NO. 7 and SEQ ID NO. 8) to clone the mutation site fragment and sequence alignment. The sequencing results are shown in Table 1.

[0023] Table 1 Detection seedling number Genotype analysis Mutation type abca2-3 <![CDATA[Allele1: CCGCCTA A CCGCAACGTCCCCGAC (insert A) Allele2: CCGCCTA T CCGCAACGTCCCCGAC (insert T)]]> Heterozygous base insertion mutation abca2-4 Allele1: CCGCCTACCGCAACGTCCCCGAC Allele2: CCGCCTACCGCAACGTCCCCGAC No mutation abca2-5 Allele1: CCGCCTA---------------------------GC (50bp deletion) Allele2: CCGCCTA---------------------------GC (50bp deletion) Homozygous base deletion mutation abca2-6 Allele1: CCGCCT-----------------------------GA (55bp deletion) Allele2: CCGCCT-----------------------------GA (55bp deletion) Homozygous base deletion mutation abca2-12 <![CDATA[Allele1: CCGCCT T ACCGCAACGTCCCCGAC (insert T) Allele2: CCGCCT T ACCGCAACGTCCCCGAC (insert T)]]> Homozygous base insertion mutation abca2-18 Allele1: CCGCCT----------------------TT (49bp deletion and T insertion) Allele2: CCGCCT----------------------TT (49bp deletion and T insertion) Homozygous base deletion and base insertion mutation abca2-24 Allele1: CCGCCTACCGCAACGTCCCCGAC Allele2: CCGCCTACCGCAACGTCCCCGAC No mutation abca2-27 Allele1: CCGC--------------------------------------GA (58bp deletion) Allele2: CCGC-----------------------------GA (58bp deletion) Homozygous base deletion mutation The results shown in Table 1 are as follows: Excluding some browning seedlings during the genetic transformation process, a total of 8 rice seedlings were obtained in the T0 generation, the mutation rate was 75%, and the homozygous mutation rate was 62.5%. Target site analysis showed that: 1 homozygous line (abca2-12) had a base insertion, 3 (abca2-5 / 6 / 27) had base deletions, and 1 (abca2-18) had both insertions and deletions. After phenotypic screening, the homozygous mutants abca2-6 (deletion type) and abca2-12 (insertion type) with no significant difference from the wild type (WT) were selected for multi-generation breeding. Both mutations led to frameshift mutations, causing premature termination of protein translation (shortening from 968 amino acids to 63 / 131), and sequence changes occurred before the first functional domain (the 186th amino acid). The specific mutated amino acid sequences are shown in Figure 3 .

[0024] Example 3: Determination of Insect Resistance of OsABCA2 Gene Mutant Rice

[0025] The T2 generation homozygous positive OsABCA2 gene mutant rice (abca2-6 and abca2-12) and the parental rice (WT) obtained in Example 2 were used for the experiment, including the following steps: (1) Determination of the honeydew secretion amount of the brown planthopper: Fix a pre-weighed Parafilm bag at the base of the rice stem, put 2 short-winged female adults in each bag, remove the insects after 48 h and reweigh, and calculate the honeydew amount per single female adult (using WT as the control, n = 10). The results Figure 4 are shown in Figure 4A: The honeydew secretion amount of the brown planthopper on the mutant rice abca2-6 and abca2-12 was significantly lower than that of WT.

[0026] (2) Determination of the survival rate of the brown planthopper: Using the cylindrical glass cover method, cover the base of the rice stem, introduce 20 third-instar nymphs, and seal the top with a sponge. Continuously observe for 7 days and record the number of survivors (n = 10). The results Figure 4 are shown in Figure 4B: The survival rate of the nymphs on the mutant rice abca2-6 and abca2-12 was significantly lower than that of the wild type (WT), confirming that the mutation of the OsABCA2 gene would cause a large number of deaths of the brown planthopper.

[0027] (3) Determination of the egg-laying amount of the brown planthopper: Cover the base of the rice stem, introduce 1 female adult and 2 male adults, and seal the top with a sponge. After 5 days, count the egg-laying amount on each rice seedling under a microscope. The results Figure 4 are shown in Figure 4C: The egg-laying amount of the female adults on the mutant rice abca2-6 and abca2-12 was significantly lower than that of the wild type (WT), confirming that the mutation of the OsABCA2 gene would significantly reduce the egg-laying amount of the brown planthopper.

[0028] (4) Determination of the feeding selectivity and egg-laying amount of the female adults of the brown planthopper: Expose the OsABCA2 mutant and WT rice (50-day-old seedlings) to 15 gravid female adults at the same time, and count the number of insects on the rice at 1, 2, 4, 8, 12, 24, and 48 h. The results are as Figure 4 shown in Figures 4D and 4F: The brown planthopper significantly preferred to feed on the WT plants. After 72 h, remove the insects, cut the stems and count the egg-laying amount per single plant under a microscope. The results are as Figure 4 shown in Figures 4E and 4G: The egg-laying amount on the WT plants was significantly higher than that on the mutants. It shows that the mutation of the OsABCA2 gene enhanced the resistance of rice to the feeding and egg-laying of the brown planthopper.

[0029] Example 4: Detection of Phenotypic Differences in OsABCA2 Gene Mutant Rice

[0030] The T2 homozygous mutants (abca2-6, abca2-12) and WT obtained in Example 2 were used as materials to determine the germination rate and plant height. Full seeds were selected for shading and germination. After 5 days, the germination rate was calculated. Figure 5 As shown in 5A in FIG. 5A; the seedlings were transplanted to the greenhouse for 60 days and the plant height was measured. Figure 5 As shown in 5B in Figure 5, and take a photo. Figure 5 As shown in Figure 5C, there was no significant difference in germination rate and plant height between the mutant and WT, indicating that OsABCA2 gene knockout did not have a negative impact on the rice growth phenotype.

[0031] Example 5 Breeding method for rice resistant to brown planthopper

[0032] Identify whether the plant contains the mutation of the mutation site gene sequence, and the specific detection primer sequence of the mutation site gene sequence is shown in SEQ ID NO. 7 or SEQ ID NO. 8. Specifically, extract the mutant rice leaf DNA according to the conventional DNA extraction kit operation steps, use the specific primer sequence shown in SEQ ID NO. 7 or SEQ ID NO. 8 to amplify the target fragment including the mutation site gene sequence, the fragment size is 820bp, and then sequence it, and identify whether the plant to be tested is a mutant plant by sequence comparison. If it does not contain the mutation site gene sequence, it means that the mutation site gene sequence has mutated and the plant to be tested is a mutant plant. Otherwise, it is a non-mutant plant.

[0033] The present invention has been disclosed above with preferred embodiments, but they are not intended to limit the present invention. Any technical solutions obtained by adopting equivalent replacement or equivalent transformation solutions fall within the protection scope of the present invention.

Claims

1. An OsABCA2 gene mutant, characterized in that: The gene sequence of the mutation site of the OsABCA2 gene is shown in SEQ ID NO.

4.

2. The OsABCA2 gene mutant according to claim 1, characterized in that: The gene sequence of OsABCA2 is shown as SEQ ID NO.

1.

3. The OsABCA2 gene mutant according to claim 1, characterized in that: The amino acid sequence of the protein encoded by the OsABCA2 gene is shown in SEQ ID NO.

3.

4. The OsABCA2 gene mutant according to claim 1, characterized in that: The mRNA sequence of the OsABCA2 gene is shown in SEQ ID NO.

2.

5. Use of the OsABCA2 gene mutant according to any one of claims 1 to 4 in improving the resistance of rice to brown planthoppers.

6. Use of the OsABCA2 gene mutant according to any one of claims 1 to 4 in breeding rice resistant to brown planthopper.

7. The use according to claim 6, characterized in that: Identify whether the rice plant contains the mutation site gene sequence shown in SEQ ID NO.

4.

8. The use according to claim 7, characterized in that: The base sequence of the specific primer for identifying whether the plant contains the mutation site gene sequence of the OsABCA2 gene is shown in SEQ ID NO. 7 or SEQ ID NO.

8.

9. A recombinant vector or transgenic cell containing the OsABCA2 gene mutant according to any one of claims 1 to 4.

10. A method for breeding rice resistant to brown planthopper, characterized in that The following steps are involved: Determine the mutation site of the OsABCA2 gene, the gene sequence of the mutation site is shown in SEQ ID NO. 4; Agrobacterium EHA105 was transformed with pBWA(v)Hu-ylcas-abca2, and rice callus was infected to differentiate and obtain T0 generation plants; then, a 820 bp target fragment was amplified using specific primers with base sequences as shown in SEQ ID NO.7 and SEQ ID NO.8, positive homozygous mutants were screened by sequencing, and stable genetic strains were obtained after multiple generations of culture.

Citation Information

Patent Citations

  • Application of miR-3032-z in preparation of product for inhibiting expression of CYP15A1 gene of brown planthopper

    CN119120470A