Application of OsABCG37 gene in reduction of cadmium accumulation of rice

Abstract

The invention relates to the technical field of gene engineering, in particular to application of an OsABCG37 gene in reduction of cadmium accumulation of rice. The nucleotide sequence of the OsABCG37 gene is shown as SEQ ID NO.1. The application comprises the steps that a gene knockout recombinant vector constructed on the basis of a CRISPR / Cas9 system is transformed into rice callus through an agrobacterium-mediated method, the rice OsABCG37 gene is subjected to gene editing, the nucleotide sequence of the rice OsABCG37 gene is mutated, and a mutant plant is obtained after screening. A hydroponic experiment and a pot experiment of a mutant plant show that the Cd content of the overground part of a knockout strain of the gene is remarkably increased, and the gene has the capability of regulating and controlling Cd accumulation of brown rice.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to the application of the OsABCG37 gene in reducing cadmium accumulation in rice. Background Art

[0002] As a heavy metal pollutant with strong toxicity, cadmium (Cd) can be enriched in paddy soil through industrial emissions, fertilizer application and other ways, posing a serious threat to food security and human health. Rice is the main food crop in China, and the enrichment characteristics of its grains for Cd lead to the particularly prominent problem of excessive Cd in rice. The average over-standard rate of heavy metal sites in existing cultivated land soil is 19.4%, among which the over-standard rate of Cd sites reaches 7.0%, ranking first among inorganic pollutants. Therefore, cultivating rice varieties with low Cd accumulation in brown rice is the key breakthrough for the safe production of polluted farmland. By analyzing the molecular mechanism of Cd transport in rice and mining key functional genes, it can provide core element support for precision molecular breeding.

[0003] Current research shows that Cd accumulation in rice grains involves multiple regulatory processes such as root absorption, xylem transport, nodal redistribution and phloem unloading. Although some genes (such as OsNramp5, OsHMA3) have been identified to participate in the process of Cd absorption or transport in rice, existing research mostly focuses on the regulation of Cd transport in a single organ and cannot analyze the multi-gene interaction mechanism under complex genetic backgrounds, restricting the accurate prediction of Cd accumulation traits. Therefore, it is urgent to discover more functional genes to improve the molecular mechanism of Cd transport and promote the development of rice varieties with safe Cd content in grains by constructing a multi-gene co-regulation network. Summary of the Invention

[0004] The purpose of the present invention is to provide the application of the OsABCG37 gene in reducing cadmium accumulation in rice.

[0005] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:

[0006] The present invention provides the application of the OsABCG37 gene in reducing cadmium accumulation in rice, and the nucleotide sequence of the OsABCG37 gene is as shown in SEQ ID NO.1.

[0007] Preferably, the application is to use a knockout recombinant vector constructed based on the CRISPR / Cas9 system, transform the knockout recombinant vector into rice callus by Agrobacterium-mediated method, perform gene editing on the rice OsABCG37 gene, cause the nucleotide sequence of the rice OsABCG37 gene to mutate, and obtain mutant plants after screening.

[0008] The present invention also provides the application of the OsABCG37 gene in improving the cadmium accumulation characteristics of rice or cultivating rice varieties with low cadmium accumulation.

[0009] The present invention also provides a biological material for increasing the cadmium sensitivity of rice, including one or more of 1) to 4):

[0010] 1) A target nucleic acid molecule of the OsABCG37 gene; the nucleotide sequence of the target nucleic acid molecule is as shown in SEQ ID NO.1;

[0011] 2) An sgRNA containing the target nucleic acid molecule described in 1);

[0012] 3) A knockout recombinant vector containing the sgRNA described in 2);

[0013] 4) An engineered bacterium containing the knockout recombinant vector described in 2).

[0014] The present invention also provides the application of the biological material in increasing the cadmium sensitivity of rice and / or cultivating cadmium-sensitive rice varieties.

[0015] The technical effects of the present invention are as follows:

[0016] (1) The present invention cloned and analyzed the rice OsABCG37 gene for the first time, and published the nucleotide sequence of the coding region of this gene, providing a new perspective for clarifying the unknown molecular mechanism of rice regulating Cd transport.

[0017] (2) The present invention confirmed for the first time through yeast functional complementation experiments that the OsABCG37 gene has Cd transport ability, transiently expressed the OsABCG37 gene in rice protoplast cells, and found that the protein expressed by this gene is located on the cell membrane. By knocking out the rice OsABCG37 gene through CRISPR / Cas9 technology, two homozygous mutant lines were obtained. In hydroponic experiments and pot experiments, it was found that the Cd content in the above-ground parts of the knockout lines of this gene increased significantly, and it has the ability to regulate the Cd accumulation in brown rice of rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained according to the provided drawings without creative efforts.

[0019] Figure 1 It is the vector map of the ligation product of the product recovered by cutting the OsABCG37 gene and the pYES2 vector linearized by double digestion;

[0020] Figure 2 It is the transport activity of OsABCG37 to Cd in yeast functional complementation experiments

[0021] Figure 3 Subcellular localization results of OsABCG37 in rice protoplasts; Scale bar: 5 μm;

[0022] Figure 4 Target site position of the OsABCG37 gene in the CRISPR / Cas9 target system;

[0023] Figure 5 Biomass of osabcg37 mutants and wild-type seedlings;

[0024] Figure 6 Biomass of osabcg37 mutants and wild-type at maturity;

[0025] Figure 7 Cd content in different parts of osabcg37 mutants and wild-type seedlings;

[0026] Figure 8 Cd content in each organ of osabcg37 mutants and wild-type at maturity. Detailed implementation mode

[0027] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0028] Example 1 Yeast functional complementation assay of OsABCG37 gene

[0029] (1) Amplification of OsABCG37 gene and yeast transformation

[0030] The CDS region of rice OsABCG37 was amplified by PCR using the 2×Phanta Max Master Mix kit (Vazyme). The amplification primers were Primer F (shown in SEQ ID NO.2): actatagggaatattaagcttATGGATCGGGAGGTGCACA, and Primer R (shown in SEQ ID NO.3): tagatgcatgctcgagcggccgcTCATCTCCTCTGGAAGTTGAACTTC.

[0031] The PCR amplification system is shown in Table 1 below:

[0032] Table 1 PCR amplification system

[0033]

[0034] The PCR amplification program is shown in Table 2 below:

[0035] Table 2 PCR Amplification Program

[0036]

[0037] The PCR products were subjected to 1% agarose gel electrophoresis, and the target fragments were excised and recovered. Their nucleotide sequences are shown in SEQ ID NO.1. The product recovered by excising the OsABCG37 gene shown in SEQ ID NO.1 was ligated to the pYES2 vector linearized by double digestion (Hind III and Not I) using seamless cloning enzyme (ClonExpress Ultra One Step Cloning Kit V3, Vazyme). The ligated product (see Figure 1 , whose nucleotide sequences are shown in SEQ ID NO.4 - 5) was transformed into competent Escherichia coli DH5α cells and spread on LB solid medium supplemented with ampicillin. Positive clones were selected, the plasmids were amplified, and then transferred into the Cd-sensitive mutant yeast competent strain △ycf1.

[0038] (2) Analysis of Cd Tolerance of Transgenic Yeast

[0039] The transformed monoclonal yeast was taken and cultured in liquid SD-URA medium at 30 °C for 2 days. The yeast was resuspended with sterile deionized water, and the OD 600 was adjusted to 0.2 and then serially diluted to 0.02, 0.002, and 0.0002. 5 μL of yeast cell suspension at each concentration gradient was pipetted onto solid SD-URA medium containing 0 μM, 10 μM, 30 μM, and 50 μM CdCl2 concentrations, and cultured upside down at 30 °C for 3 days, then photographed to observe and record the growth of yeast.

[0040] The results are as Figure 2 shown. With the increase of Cd concentration, the growth of Cd-tolerance defective yeast △ycf1 (Empty vector) transformed with the empty vector and Cd-tolerance defective yeast △ycf1 (OsABCG37) transformed with the OsABCG37 gene was inhibited. However, there were also obvious differences in the degree of Cd stress between the yeast transformed with the empty vector and OsABCG37. The overall growth of the yeast transformed with the OsABCG37 gene was much better than that of the yeast transformed with the empty vector. It indicates that the OsABCG37 transporter has the activity of transporting Cd.

[0041] Example 2 Subcellular Localization of OsABCG37

[0042] Using seamless cloning enzyme (ClonExpress Ultra One Step Cloning Kit V3, Vazyme), the cloned OsABCG37 gene shown in SEQ ID NO.1 was ligated into the linear vector pYBA1132 digested with Hind III and Not I. The recombinant plasmids pYBA1132 - OsABCG37 - GFP and the empty vector pYBA1132 - GFP were transfected into rice protoplast cells. The transformed cells were cultured under weak light in an incubator at 28°C for 10 h, stained with the cell membrane fluorescent dye FM4 - 64, and then the distribution of fluorescence in the protoplast cells was observed using a laser confocal scanning microscope.

[0043] The results are as Figure 3 shown. In the cells expressing the empty vector pYBA1132 - GFP (green fluorescence) and stained with FM4 - 64 (red fluorescence), the green fluorescence was distributed in positions such as the cell membrane, nucleus, and cytoplasm, while the red fluorescence was only shown on the cell membrane ( Figure 3 A - D). In the cells expressing GFP - OsABCG37 and stained with FM4 - 64, the green fluorescence and red fluorescence could fuse on the cell membrane ( Figure 3 E - H). This result indicates that OsABCG37 is a protein localized on the cell membrane.

[0044] Example 3 Construction and Identification of OsABCG37 Mutants

[0045] The rice OsABCG37 mutant germplasm was purchased from Hangzhou Baige Biotechnology Co., Ltd. According to the CDS sequence information of OsABCG37 (LOC_Os01g42410) on the Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu / index.shtml), the target site (shown in SEQ ID NO.6): GTAGGAAATGAGATGTTAAGGGG and the sgRNA sequence (shown in SEQ ID NO.7): GTAGGAAATGAGATGTTAAG were designed. According to the sgRNA sequence, Oligo dimers were prepared. The synthesized upstream Oligo and downstream Oligo were dissolved in water to 10 μM, and after mixing according to the following reaction system (see Table 3), they were heated at 95°C for 3 minutes and then slowly cooled to 20°C at about 0.2°C / second. After the Oligo dimers were prepared, the Oligo dimers were constructed into the CRISPR / Cas vector. Each component was mixed on ice according to the following reaction system (see Table 4), and after mixing, the reaction was carried out at room temperature (20°C) for 1 hour to construct the knockout recombinant vector.

[0046] Table 3 Preparation of Oligo dimer system

[0047]

[0048] Table 4 Construction of knockout recombinant vector mixed system

[0049]

[0050]

[0051] After construction, the knockout recombinant vector was transformed into the callus of Zhonghua 11 rice by Agrobacterium-mediated method. DNA of transgenic candidate plants and wild-type plants was extracted, and mutant plants were obtained by PCR amplification and sequencing verification method. The verification primers were F (shown in SEQ ID NO.8): 5’-GGTACAGTCTGCTAGCTGTGG-3’ and R (shown in SEQ ID NO.9): 5’-AGAACAACCCCCATCTTGCT-3’.

[0052] The PCR amplification system is shown in Table 5 below:

[0053] Table 5 PCR amplification system

[0054]

[0055] The PCR amplification program is shown in Table 6 below:

[0056] Table 6 PCR amplification program

[0057]

[0058] After identification, mutant plants with two different mutation types, osabcg37-1 and osabcg37-2, were screened and propagated for 2 generations to obtain stable lines. As Figure 4 shown, (A) is the target position of OsABCG37 in the CRISPR / Cas9 target system, and the triangular arrow indicates the specific target position of knockout. (B) are the mutation sites of the OsABCG37 gene in different mutant lines. These two mutation types have a 4-base deletion and a 22-base deletion at the two target positions respectively.

[0059] Example 4 Analysis of differences in biomass and Cd content in different organs of OsABCG37 mutants

[0060] Seeds of wild-type rice Zhonghua 11 and OsABCG37 mutants (osabcg37-1 and osabcg37-2) were disinfected with 30% H2O2 for 30 min, and then soaked in 0.1% NaClO for 1 day, and germinated in a constant temperature and humidity incubator (temperature 35 °C, humidity 60%). After the seeds showed visible germination, they were transferred to a 1-L black hydroponic box and watered with appropriate amount of deionized water every day to maintain a certain humidity. Uniform seedlings at the three-leaf and one-heart stage were selected for transplantation. There were 6 plants per pot in the hydroponic experiment. After 7 days of cultivation with complete nutrient solution, Cd treatments of 5 μmol L -1 (Cd5) and 20 μmol L -1 Cd (Cd20) were carried out. The nutrient solution was changed every 3 days during the cultivation period, and the pH of the nutrient solution was adjusted to 5.5 with HCl or NaOH. Natural light was used, and appropriate amount of deionized water was supplemented. Samples were collected 7 days after Cd treatment (seedling stage) in the hydroponic experiment. The samples were divided into underground and aboveground parts. Samples were collected at the mature stage in the pot experiment. The plants were divided into roots, stems, leaves and ears.

[0061] The differences in biomass in the hydroponic experiment are as Figure 5 shown. * indicates significant difference compared with the wild type (p < 0.05), and different lowercase letters represent significant differences among different treatments of the same material (p < 0.05). The hydroponic results showed that there were no significant differences in the underground biomass among different materials in the OsABCG37 mutants of rice ( Figure 5 A), but the aboveground biomass of the OsABCG37 mutants was significantly lower than that of the wild-type rice under Cd5 and Cd20 treatments ( Figure 5 B). The differences in biomass in the pot experiment are as Figure 6 shown. Different lowercase letters represent significant differences among different parts of the same material (p < 0.05). In the pot experiment, there were no significant differences in the biomass of different parts between the OsABCG37 mutants and the wild type. It indicates that the OsABCG37 mutants are more sensitive in the hydroponic environment, and the aboveground growth is easily affected by Cd stress.

[0062] The differences in Cd content in different parts in the hydroponic experiment are as Figure 7 shown. * indicates significant difference compared with the wild type (p < 0.05), and different lowercase letters represent significant differences among different treatments of the same material (p < 0.05). In the hydroponic experiment, there were no significant differences in the underground Cd content among different materials ( Figure 7 A), but the Cd content in the aboveground part of the OsABCG37 mutants was significantly higher than that of the wild-type rice under both Cd stress treatments ( Figure 7 B). The differences in Cd content in different parts in the pot experiment are as Figure 8As shown, * indicates a significant difference compared with the wild type (p < 0.05). In the pot experiment, the Cd contents in the stems, leaves, and brown rice of the OsABCG37 mutant rice materials were significantly higher than those of the wild type rice, while there was no significant difference in the roots. The above results indicate that OsABCG37 regulates the Cd accumulation in brown rice by restricting the transport of Cd from the roots to the above-ground parts.

[0063] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. An application of OsABCG37 gene in reducing cadmium accumulation in rice, characterized in that: The nucleotide sequence of the OsABCG37 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The application is to utilize a knockout recombinant vector constructed based on the CRISPR / Cas9 system, transform the knockout recombinant vector into rice callus through the Agrobacterium-mediated method, perform gene editing on the rice OsABCG37 gene, mutate the nucleotide sequence of the rice OsABCG37 gene, and obtain mutant plants after screening.

3. Application of an OsABCG37 gene in improving the cadmium accumulation characteristics of rice or cultivating rice varieties with low cadmium accumulation.

4. A biomaterial for increasing cadmium sensitivity of rice, characterized in that: Including one or more of 1) to 4): 1) A target nucleic acid molecule of the OsABCG37 gene; the nucleotide sequence of the target nucleic acid molecule is shown in SEQ ID NO.1; 2) an sgRNA containing the target nucleic acid molecule described in 1); 3) a knockout recombinant vector containing the sgRNA described in 2); 4) An engineered bacterium containing the knockout recombinant vector described in 2).

5. Use of the biomaterial according to claim 4 in increasing the cadmium sensitivity of rice and / or cultivating cadmium-sensitive rice varieties.

Images