Application of osabcg37 gene in reducing cadmium accumulation in rice
By cloning and editing the OsABCG37 gene, cadmium-sensitive mutant rice was constructed using the CRISPR/Cas9 system. This solved the problem of multi-gene interaction mechanism of Cd transport in rice, effectively controlled Cd accumulation in rice grains, and improved the safety of rice varieties.
Patent Information
- Application Number
- CN202510379182.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-28
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2045-03-28
AI Technical Summary
Existing technologies cannot effectively elucidate the multi-gene interaction mechanism of Cd translocation in rice, making it difficult to accurately predict and control Cd accumulation in rice grains, which affects food security and human health.
By cloning and analyzing the OsABCG37 gene, gene editing was performed using the CRISPR/Cas9 system to construct an OsABCG37 gene knockout recombinant vector, which was then transformed into rice callus tissue to obtain a cadmium-sensitive mutant and regulate the Cd transport process.
It significantly improved the sensitivity of rice to Cd, reduced Cd accumulation in the aboveground parts, improved the cadmium accumulation characteristics of rice, and provided a basis for the development of low-cadmium-accumulation rice varieties.
Smart Images

Figure CN120158475B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application relates to the technical field of genetic engineering, and in particular to application of an OsABCG37 gene in reducing cadmium accumulation in rice. BACKGROUND
[0002] As a heavy metal pollutant with strong toxicity, cadmium (Cd) can be enriched in paddy soil through industrial discharge and fertilizer application, etc., and poses a serious threat to food safety and human health. Rice is a major food crop in China, and the Cd enrichment characteristics of rice grains make the problem of Cd exceeding the standard in rice particularly prominent. The average point exceeding standard rate of heavy metals in existing cultivated land is 19.4%, and the point exceeding standard rate of Cd is 7.0%, ranking first among inorganic pollutants. Therefore, cultivating Cd-low-accumulation rice varieties is a key breakthrough for safe production in contaminated farmland. By analyzing the molecular mechanism of Cd transport in rice and excavating key functional genes, core element support can be provided for precise molecular breeding.
[0003] Current studies have shown that Cd accumulation in rice grains involves multiple regulation processes such as root absorption, xylem transport, node redistribution and phloem unloading. Although some genes (such as OsNramp5 and OsHMA3) have been identified to be involved in the absorption or transport of Cd in rice, existing studies have focused on the regulation of Cd transport in a single organ, which cannot analyze the multi-gene interaction mechanism under complex genetic background, thereby restricting the accurate prediction of Cd accumulation traits. Therefore, it is urgent to excavate more functional genes to perfect the molecular mechanism of Cd transport, and to construct a multi-gene synergistic regulation network to promote the development of Cd-safe rice varieties. SUMMARY
[0004] The application aims to provide an application of an OsABCG37 gene in reducing cadmium accumulation in rice.
[0005] In order to achieve the above application purpose, the application provides the following technical scheme:
[0006] The application provides an application of an OsABCG37 gene in reducing cadmium accumulation in rice, wherein the nucleotide sequence of the OsABCG37 gene is shown in SEQ ID NO. 1.
[0007] Preferably, the application is to use a knockout recombinant vector constructed based on a CRISPR / Cas9 system, to transform the knockout recombinant vector into rice callus through an agrobacterium-mediated method, to perform gene editing on the rice OsABCG37 gene, to cause mutation of the nucleotide sequence of the rice OsABCG37 gene, and to obtain mutant plants after screening.
[0008] The application further provides an application of an OsABCG37 gene in improving the Cd accumulation characteristics of rice or cultivating Cd-low-accumulation rice varieties.
[0009] The application also provides a biological material for increasing the cadmium sensitivity of rice, comprising one or more of the following:
[0010] 1) a target nucleic acid molecule of the OsABCG37 gene, wherein the nucleotide sequence of the target nucleic acid molecule is shown as SEQ ID NO. 1;
[0011] 2) an sgRNA containing the target nucleic acid molecule of 1);
[0012] 3) a knockout recombinant vector containing the sgRNA of 2);
[0013] 4) an engineered bacterium containing the knockout recombinant vector of 2).
[0014] The application also provides the use of the biological material in increasing the cadmium sensitivity of rice and / or cultivating a cadmium-sensitive rice variety.
[0015] The technical effects of the application are as follows:
[0016] (1) The application first clones and analyzes the rice OsABCG37 gene, discloses the coding region nucleotide sequence of the gene, and provides a new perspective for elucidating the unknown molecular mechanism of rice Cd transport regulation.
[0017] (2) The application first confirms the Cd transport capacity of the OsABCG37 gene through a yeast functional complementation experiment, and finds that the protein expressed by the gene is located on the cell membrane by transiently expressing the OsABCG37 gene in rice protoplast cells. By knocking out the rice OsABCG37 gene through CRISPR / Cas9 technology, two homozygous mutant strains are obtained, and it is found that the Cd content in the aboveground part of the knockout strain of the gene significantly increases in water culture experiments and pot experiments, and the knockout strain has the ability to regulate the Cd accumulation in rice brown rice. BRIEF DESCRIPTION OF DRAWINGS
[0018] In order to more clearly illustrate the technical solutions of the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiment or prior art description. Obviously, the drawings in the following description are only embodiments of the application, and for those skilled in the art, other drawings can also be obtained without creative labor on the basis of the provided drawings.
[0019] Figure 1 Vector map of the product of OsABCG37 gene gel recovery and the product of double enzyme digestion linearized pYES2 vector connection;
[0020] Figure 2 Cd transport activity of OsABCG37 in the yeast functional complementation test;
[0021] Figure 3 Subcellular localization results of OsABCG37 in rice protoplast; scale 5 μm;
[0022] Figure 4 Target position of OsABCG37 gene in CRISPR / Cas9 target system;
[0023] Figure 5 osabcg37 mutant and wild type seedling biomass;
[0024] Figure 6 osabcg37 mutant and wild type mature biomass;
[0025] Figure 7 osabcg37 mutant and wild type seedling Cd content in different parts;
[0026] Figure 8 osabcg37 mutant and wild type mature organ Cd content. DETAILED DESCRIPTION
[0027] The technical solutions provided by the present application will be described in detail below in conjunction with the examples, but they should not be understood as limiting the scope of protection of the present application.
[0028] Example 1 Yeast functional complementation test of OsABCG37 gene
[0029] (1) Amplification and yeast transformation of OsABCG37 gene
[0030] The CDS region of rice OsABCG37 was amplified by PCR using 2xPhanta Max Master Mix kit (Vazyme), and the amplification primers were Primer F (as shown in SEQ ID NO. 2): actatagggaatattaagcttATGGATCGGGAGGTGCACA, and Primer R (as shown in SEQ ID NO. 3): tagatgcatgctcgagcggccgcTCATCTCCTCTGGAAGTTGAACTTC.
[0031] The PCR amplification system is shown in Table 1 as follows:
[0032] Table 1 PCR amplification system
[0033]
[0034] The PCR amplification program is shown in Table 2 as follows:
[0035] Table 2 PCR amplification procedure
[0036]
[0037] PCR products were electrophoresed on 1% agarose gel, and the target fragments were recovered. The nucleotide sequence of the recovered product is shown in SEQ ID NO. 1. The product shown in SEQ ID NO. 1 was ligated with the pYES2 vector linearized by double digestion (Hind III and Not I) by using a seamless cloning enzyme (ClonExpress Ultra One Step Cloning Kit V3, Vazyme). The ligated product (see Figure 1 , the nucleotide sequences of which are shown in SEQ ID NO. 4-5) was transformed into E. coli DH5a competent cells, and then plated on LB solid medium containing ampicillin. After selecting positive clones and expanding the plasmid, the plasmid was transformed into the Cd-sensitive mutant yeast strain Δycf1.
[0038] (2) Analysis of the Cd tolerance of transgenic yeast
[0039] The transformed single colony yeast was cultured in liquid SD-URA medium at 30°C for 2 days. The yeast was resuspended with sterile deionized water, and the OD 600 was adjusted to 0.2, and then gradient diluted to 0.02, 0.002, and 0.0002. 5 μL of each concentration of yeast solution was taken and plated on solid SD-URA medium containing 0 μM, 10 μM, 30 μM, and 50 μM CdCl2, and then cultured at 30°C for 3 days. Photographs were taken, and the growth of the yeast was observed and recorded.
[0040] The results are shown in Figure 2 . With the increase of Cd concentration, the growth of the Cd tolerance-deficient yeast Δycf1 transformed with the empty vector (Empty vector) and the Cd tolerance-deficient yeast Δycf1 transformed with the OsABCG37 gene (OsABCG37) were both inhibited. However, there was a significant difference in the degree of Cd stress between the yeast transformed with the empty vector and the yeast transformed with the OsABCG37 gene. The overall growth of the yeast transformed with the OsABCG37 gene was much better than that of the yeast transformed with the empty vector. This indicates that the OsABCG37 transporter protein has the activity of transporting Cd.
[0041] Example 2 Subcellular localization of OsABCG37
[0042] The cloned OsABCG37 gene shown in SEQ ID NO. 1 was connected to the linear vector pYBA1132 digested by Hind III and Not I by seamless cloning enzyme (ClonExpress Ultra One Step Cloning Kit V3, Vazyme). The recombinant plasmid pYBA1132-OsABCG37-GFP and the pYBA1132-GFP empty vector were transformed into rice protoplast cells. The transformed cells were cultured in a 28°C incubator for 10h under weak light, and the distribution of fluorescence in the protoplast cells was observed using a laser confocal scanning microscope after staining with cell membrane fluorescent dye FM4-64.
[0043] The results are shown in Figure 3 After the cells expressing the pYBA1132-GFP empty vector (green fluorescence) were stained with FM4-64 (red fluorescence), the green fluorescence was distributed in the cell membrane, nucleus, cytoplasm, etc., and the red fluorescence was only shown on the cell membrane Figure 3 In the cells expressing GFP-OsABCG37 and stained with FM4-64, the green fluorescence and red fluorescence can be fused on the cell membrane Figure 3 E-H). This result shows that OsABCG37 is a protein located on the cell membrane.
[0044] Example 3 Construction and identification of OsABCG37 mutant
[0045] The rice OsABCG37 mutant germplasm was purchased from Hangzhou Baige Biotechnology Co., Ltd. According to the CDS sequence information of OsABCG37 (LOC_Os01g42410) on the Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu / index.shtml), a target site (as shown in SEQ ID NO. 6) was designed: GTAGGAAATGAGATGTTAAGGGG, and an sgRNA sequence (as shown in SEQ ID NO. 7) was designed: GTAGGAAATGAGATGTTAAG. According to the sgRNA sequence, an Oligo dimer was prepared, and the synthesized upstream Oligo and downstream Oligo were dissolved in water to 10 μM. After mixing according to the following reaction system (see Table 3), heating at 95°C for 3 minutes, and then slowly reducing to 20°C at about 0.2°C / s. After the Oligo dimer was prepared, the Oligo dimer was constructed into a CRISPR / Cas vector, and the components were mixed on ice according to the following reaction system (see Table 4). After mixing well, the reaction was carried out at room temperature (20°C) for 1 hour, and a knockout recombinant vector was constructed.
[0046] Table 3. Preparation of Oligo dimer system
[0047]
[0048] Table 4. Construction of Hybrid Systems of Knockout Recombinant Vectors
[0049]
[0050]
[0051] After construction, the knockout recombinant vector was transformed into callus tissue of rice Zhonghua 11 using Agrobacterium-mediated transformation. DNA was extracted from transgenic candidate plants and wild-type plants, and mutant plants were obtained by PCR amplification and sequencing verification. The verification primers were F (as shown in SEQ ID NO. 8): 5'-GGTACAGTCTGCTAGCTGTGG-3' and R (as shown in SEQ ID NO. 9): 5'-AGAACAACCCCCATCTTGCT-3'.
[0052] The PCR amplification system is shown in Table 5 below:
[0053] Table 5 PCR amplification system
[0054]
[0055] The PCR amplification procedure is shown in Table 6 below:
[0056] Table 6 PCR Amplification Procedure
[0057]
[0058] After identification and screening, two mutant plants with different mutation types, osabcg37-1 and osabcg37-2, were obtained. Stable lines were obtained by propagating each mutant for two generations. Figure 4 As shown, (A) is the target location of OsABCG37 in the CRISPR / Cas9 target system, and the triangular arrow indicates the specific location of the knockout target. (B) is the mutation site of the OsABCG37 gene in different mutant lines. These two mutation types have a deletion of 4 bases and a deletion of 22 bases at the two target locations, respectively.
[0059] Example 4: Analysis of differences in biomass and Cd content in different organs of the OsABCG37 mutant
[0060] Seeds of wild type rice Nongke 11 and OsABCG37 mutants (osabcg37-1 and osabcg37-2) were sterilized with 30% H2O2 for 30 min, then soaked with 0.1% NaClO for 1 d, and then germinated in a constant temperature and humidity incubator (temperature 35℃, humidity 60%). After the seed coat was broken, the seeds were moved to 1 L black hydroponic boxes, and irrigated with appropriate amounts of deionized water every day to maintain a certain humidity. When the seedlings reached the three-leaf stage, seedlings with consistent growth vigor were selected for transplanting. There were 6 seedlings per pot in the hydroponic test, and the complete nutrient solution was replaced every 3 d during the culture period. The pH of the nutrient solution was adjusted to 5.5 with HCl or NaOH, and natural light was used for illumination, and appropriate amounts of deionized water were supplemented. The samples were taken after 7 d of Cd treatment (seedling stage), and the samples were divided into underground and aboveground parts. The samples were taken at the mature stage in the pot experiment, and the plants were divided into roots, stems, leaves, and ears. -1 The Cd treatment was 5 μmol L -1 (Cd5) and 20 μmol L (Cd20). The nutrient solution was replaced every 3 d during the culture period, the pH of the nutrient solution was adjusted to 5.5 with HCl or NaOH, natural light was used for illumination, and appropriate amounts of deionized water were supplemented. The samples were taken after 7 d of Cd treatment (seedling stage), and the samples were divided into underground and aboveground parts. The samples were taken at the mature stage in the pot experiment, and the plants were divided into roots, stems, leaves, and ears.
[0061] The biomass differences in the hydroponic test are shown in Figure 5 , and * indicates a significant difference (p<0.05) compared with the wild type. There were no significant differences in the underground biomass of the OsABCG37 mutants among different materials Figure 5 (A), but the aboveground biomass of the OsABCG37 mutants was significantly lower than that of the wild type rice Figure 5 (B) under Cd5 and Cd20 treatments. The biomass differences in the pot experiment are shown in Figure 6 , and different lowercase letters represent significant differences (p<0.05) between different parts of the same material. In the pot experiment, there were no significant differences in the biomass of different parts between the OsABCG37 mutants and the wild type. This indicates that the OsABCG37 mutants are more sensitive in the hydroponic environment, and the aboveground growth is easily affected by Cd stress.
[0062] The Cd content differences in different parts in the hydroponic test are shown in Figure 7 , and * indicates a significant difference (p<0.05) compared with the wild type. There were no significant differences in the underground Cd content among different materials Figure 7 (A), but the aboveground Cd content of the OsABCG37 mutants was significantly higher than that of the wild type rice Figure 7 (B) under Cd stress. The Cd content differences in different parts in the pot experiment are shown in Figure 8As shown, * indicates significant difference (p<0.05) compared with wild type. In pot experiment, the stem, leaf and brown rice Cd contents of OsABCG37 mutant rice materials were significantly higher than those of wild type rice, while there was no significant difference in root. The above results show that OsABCG37 regulates Cd accumulation in brown rice by limiting the transport of Cd from the root to the aboveground part.
[0063] The above only describes the preferred embodiments of the present application, and it should be noted that those skilled in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.
Claims
1. Knockout OsABCG37 The application of genes in increasing cadmium accumulation in rice is characterized by, The OsABCG37 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, The application utilizes a knockout recombinant vector constructed based on the CRISPR / Cas9 system, which is transformed into rice callus tissue via Agrobacterium-mediated transformation. This process is effective for rice... OsABCG37 Gene knockout in rice OsABCG37 Mutations occur in the nucleotide sequence of the gene, and mutant plants are obtained through screening.