Primers, probes and kits and methods for detecting porcine pathogenic e. coli

By designing specific fluorescent quantitative PCR primers and probes, and utilizing the chuS and kpsTII genes, a dual fluorescent quantitative PCR detection technology was established, which solved the problem of rapidly identifying highly pathogenic strains of porcine Escherichia coli and achieved efficient and accurate detection results.

CN120158535BActive Publication Date: 2026-08-04NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510513049.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-23
Publication Date
2026-08-04
Estimated Expiration
2045-04-23

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately distinguish highly pathogenic strains of porcine Escherichia coli, leading to misjudgment of the treatment window period and affecting clinical prevention and control effects. Furthermore, with the development of gene sequencing technology, the number of pathogenic subtypes and heterozygous pathogenic strains has increased, further increasing the difficulty of rapidly identifying highly pathogenic strains.

Method used

Specific quantitative real-time PCR primers and probes were designed, and dual quantitative real-time PCR detection technology was established using the chuS and kpsTII genes as targets to distinguish porcine Escherichia coli into virulent strains that are positive for both chuS and kpsTII, moderately virulent strains that are positive for chuS and negative for kpsTII, weakly virulent strains that are negative for chuS and positive for kpsTII, and avirulent strains that are negative for both.

Benefits of technology

It enables rapid and accurate identification of highly pathogenic strains of porcine Escherichia coli, significantly shortening detection time, improving detection efficiency, reducing costs, and exhibiting high detection sensitivity. It is suitable for large-scale clinical testing and is both innovative and practical.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120158535B_ABST
    Figure CN120158535B_ABST
Patent Text Reader

Abstract

The application provides primers, probes, kits and methods for detecting porcine pathogenic E. coli. Specifically, the application uses a fluorescent quantitative PCR method, takes chuS and kpsTII of porcine E. coli as target genes, designs conservative primer and probe sequences, and establishes a double fluorescent quantitative PCR detection technology, so that porcine E. coli clinical strains can be divided into: virulent strains with positive chuS and kpsTII, moderate virulence strains with positive chuS and negative kpsTII, weak virulence strains with negative chuS and positive kpsTII, and avirulent strains with double negative, which is conducive to rapid identification of pathogenic strains and guidance of the development of clinical prevention and control strategies.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology detection technology, specifically relating to primers, probes, kits, and methods for detecting pathogenic Escherichia coli of porcine origin. Background Technology

[0002] Escherichia coli belongs to the phylum Proteobacteria, class Gamma-Proteobacteria, family Enterobacteriaceae, and genus Enterobacter. It is a Gram-negative bacterium widely distributed in the environment and animal digestive tract. The vast majority are members of the environmental or intestinal commensal flora, but a few E. coli carrying specific virulence factors can invade animal bodies and multiply in tissues or blood, causing infection. There are many pathogenic subtypes of E. coli. Enteropathogenic Escherichia coli (EPEC), enterohemorrhagic Escherichia coli (EHEC), enterotoxigenic Escherichia coli (ETEC), enteroaggregative Escherichia coli (EAEC), and enteroinvasive Escherichia coli (EIEC) are the five main subtypes causing intestinal infections. Among them, ETEC is one of the main pathogens causing bacterial diarrhea in humans and young animals, especially causing yellow-white scours in newborn piglets, with high morbidity and mortality rates.

[0003] Interference from the breeding environment and the presence of *E. coli* in the healthy intestines of pigs hinders the rapid identification of highly pathogenic *E. coli* strains, easily leading to misjudgment of the treatment window and affecting clinical control effectiveness. Furthermore, with the continuous iteration and updating of gene sequencing and genomics analysis technologies, more and more pathogenic subtypes and heterozygous pathogenic strains are being discovered in porcine isolates, further increasing the difficulty of rapidly identifying highly pathogenic strains. Marker virulence factors are important targets for distinguishing between environmental / symbiotic and pathogenic *E. coli* strains; however, *E. coli* has numerous virulence factors, and currently there is no clearly defined virulence factor for differentiating between strong and weak strains. Summary of the Invention

[0004] To address the problems of existing technologies, this invention provides primers, probes, kits, and methods for detecting pathogenic *Escherichia coli* of porcine origin. Specifically, this invention utilizes quantitative real-time PCR (qPCR) to design conserved primer and probe sequences targeting the *chuS* and *kpsTII* genes of *E. coli*, thereby establishing a dual quantitative real-time PCR detection technique. This technique can distinguish clinical strains of *E. coli* of porcine origin into: highly virulent strains that are double-positive for both *chuS* and *kpsTII*, moderately virulent strains that are positive for *chuS* and negative for *kpsTII*, weakly virulent strains that are negative for *chuS* and positive for *kpsTII*, and non-virulent strains that are double-negative. This facilitates rapid identification of pathogenic strains and guides the formulation of clinical prevention and control strategies.

[0005] Specifically, the technical solutions of the present invention include, but are not limited to, the following:

[0006] In one aspect, the present invention provides a set of fluorescent quantitative PCR primers and fluorescent probes for detecting the pathogenicity of porcine Escherichia coli. The set of fluorescent quantitative PCR primers and fluorescent probes comprises forward and reverse primers and fluorescent probes designed for the chuS gene and the kpsTII gene, respectively. The forward and reverse primers and fluorescent probes designed for the chuS gene specifically amplify and detect the gene fragment shown in SEQ ID NO:18, and the forward and reverse primers and fluorescent probes designed for the kpsTII gene specifically amplify and detect the gene fragment shown in SEQ ID NO:20.

[0007] In one aspect, the 5'-3' sequence of the forward primer designed for the chuS gene provided by the present invention is shown in SEQ ID NO. 1, and the 5'-3' sequence of the reverse primer designed for the chuS gene is shown in SEQ ID NO. 2.

[0008] Alternatively, the fluorescent probe sequence designed for the chuS gene is: 5'-TGCTCCTGTTCGCCTTCTGTACGTT-3', wherein the 3' end of the fluorescent probe is labeled with a fluorescence quenching group, and the 5' end is labeled with a fluorescent reporter group.

[0009] In another aspect, the forward primer 5'-3' sequence designed for the chuS gene provided by the present invention is shown in SEQ ID NO.1, the reverse primer 5'-3' sequence designed for the chuS gene is shown in SEQ ID NO.2, and the fluorescent probe sequence designed for the chuS gene is: 5'-TGCTCCTGTTCGCCTTCTGTACGTT-3', wherein the 3' end of the fluorescent probe is labeled with a fluorescence quenching group, and the 5' end is labeled with different fluorescent reporter groups.

[0010] In one aspect, the 5'-3' sequence of the forward primer designed for the kpsTII gene provided by the present invention is shown in SEQ ID NO.4, and the 5'-3' sequence of the reverse primer designed for the kpsTII gene is shown in SEQ ID NO.5.

[0011] Alternatively, the fluorescent probe sequence designed for the kpsTII gene is: 5'-TGATTTACCCGCTCCGTTGCGACCA-3', wherein the 3' end of the fluorescent probe is labeled with a fluorescence quencher group and the 5' end is labeled with a fluorescent reporter group.

[0012] In another aspect, the forward primer 5'-3' sequence designed for the kpsTII gene provided by the present invention is shown in SEQ ID NO.4, the reverse primer 5'-3' sequence designed for the kpsTII gene is shown in SEQ ID NO.5, and the fluorescent probe sequence designed for the kpsTII gene is: 5'-TGATTTACCCGCTCCGTTGCGACCA-3', wherein the 3' end of the fluorescent probe is labeled with a fluorescence quenching group, and the 5' end is labeled with a fluorescent reporter group.

[0013] In another aspect, the present invention provides a forward primer 5'-3' sequence for the chuS gene as shown in SEQ ID NO.1, a reverse primer 5'-3' sequence for the chuS gene as shown in SEQ ID NO.2, and a fluorescent probe sequence for the chuS gene as: 5'-TGCTCCTGTTCGCCTTCTGTACGTT-3'; and a forward primer 5'-3' sequence for the kpsTII gene as shown in SEQ ID NO.4, a reverse primer 5'-3' sequence for the kpsTII gene as shown in SEQ ID NO.5, and a fluorescent probe sequence for the kpsTII gene as: 5'-TGATTTACCCGCTCCGTTGCGACCA-3'; wherein the 3' end of the fluorescent probe is labeled with a fluorescence quencher group, and the 5' end is labeled with a fluorescent reporter group.

[0014] In one aspect, the 5' fluorescent reporter group of the fluorescent probe of the present invention is selected from FAM, JOE, ROX, TET, TAMRA, HEX, VIC, CY3, CY5 or TexasRed; the 3' fluorescent quencher group of the fluorescent probe is selected from BHQ1, TAMRA, Eclipse, Dabcyl, LowaBlackTMRQ or LowaBlackTMFQ.

[0015] In one aspect, the 5' end fluorescent reporter group of the fluorescent probe of the present invention is FAM or VIC, and the 3' end fluorescent quencher group of the fluorescent probe is BHQ1.

[0016] In one aspect, the 5'-3' sequence of the fluorescent probe designed for the chuS gene according to the present invention is shown in SEQ ID NO.:3.

[0017] In one aspect, the 5'-3' sequence of the fluorescent probe designed for the kpsTII gene according to the present invention is shown in SEQ ID NO.:6.

[0018] In one aspect, the present invention provides a forward primer 5'-3' sequence for the chuS gene as shown in SEQ ID NO. 1, a reverse primer 5'-3' sequence for the chuS gene as shown in SEQ ID NO. 2, and a fluorescent probe 5'-3' sequence for the chuS gene as shown in SEQ ID NO. 3; and a forward primer 5'-3' sequence for the kpsTII gene as shown in SEQ ID NO. 4, a reverse primer 5'-3' sequence for the kpsTII gene as shown in SEQ ID NO. 5, and a fluorescent probe 5'-3' sequence for the kpsTII gene as shown in SEQ ID NO. 6.

[0019] In another aspect, the present invention also provides a kit for rapid detection of pathogenicity of porcine Escherichia coli, characterized in that it comprises the fluorescent quantitative PCR primer set and fluorescent probe described in the present invention.

[0020] In one aspect, the kit of the present invention further comprises a positive plasmid standard, said positive plasmid standard being a recombinant plasmid wherein a sequence comprising the chuS gene amplification segment of SEQ ID NO:18 and a sequence comprising the kpsTII gene amplification segment of SEQ ID NO:20 is introduced.

[0021] In one aspect, the positive plasmid standard of the present invention is a recombinant plasmid wherein a target fragment comprising sequences SEQ ID NO:17 and SEQ ID NO:19 is introduced.

[0022] In one aspect, the positive plasmid standard of the present invention is a recombinant plasmid wherein the target fragments of SEQ ID NO:17 and SEQ ID NO:19 are introduced.

[0023] In one aspect, the recombinant plasmid of the present invention is the recombinant pUC57 plasmid.

[0024] In one aspect, the concentration of the positive plasmid standard of the present invention can be as low as 10 copies / μL.

[0025] In one aspect, the present invention provides a method for detecting porcine pathogenic Escherichia coli, the method comprising the following steps:

[0026] (1) Use the bacterial culture to be tested or the extracted DNA as a template; and

[0027] (2) Use the fluorescent quantitative PCR primer set and fluorescent probe described in this invention or the kit described in this method to perform dual fluorescent quantitative PCR detection on the template.

[0028] In one aspect, the dual real-time PCR reaction system of the present invention is 20 μL, comprising 6.5 μL of water, 10 μL of 2×Q3Probe qPCR Master Mix (Universal), 0.4 μL each of the forward and reverse primers designed for the chuS gene, 0.2 μL of the fluorescent probe designed for the chuS gene, 0.2 μL each of the forward and reverse primers designed for the kpsTII gene, 0.1 μL of the fluorescent probe designed for the kpsTII gene, and 2 μL of DNA template.

[0029] In one aspect, in the dual real-time PCR reaction system described in this invention, the final concentration of each primer is 0.2-0.1 μM, and the final concentration of the probe is 0.05-0.1 μM.

[0030] In one aspect, the dual fluorescence quantitative PCR amplification conditions of the present invention are: pre-denaturation at 95°C for 30 s; cycling reaction at 95°C for 10 s, 60°C for 30 s, for 40 cycles.

[0031] In one aspect, the concentration of Escherichia coli in the culture detected by this invention can be as low as 10. 2 CFU / mL.

[0032] In one aspect, the DNA template concentration detected by this invention can be as low as 10. 3 Copy / μL. In one aspect, the DNA template concentration detected by this invention can be as low as 10 copies / μL.

[0033] In one aspect, the present invention has a detection accuracy of more than 96% for double positive, double negative, or one positive and the other negative kpsTII and chuS genes.

[0034] In one aspect, the present invention achieves a 100% detection rate for Escherichia coli that is double-positive for both the kpsTII and chuS genes.

[0035] The beneficial effects of this invention are as follows:

[0036] (1) This invention uses specific primers, probes or kits composed of them to identify highly virulent strains of pathogenic Escherichia coli from pigs by fluorescence quantitative PCR, with double positivity of chuS and kpsTII genes as the criterion. As a new identification method for highly virulent strains of pathogenic Escherichia coli from pigs, it has achieved beneficial technical effects and is creative and practical.

[0037] (2) Specifically, the present invention can simultaneously detect the chuS and kpsTII genes of porcine Escherichia coli in one reaction system, which significantly shortens the detection time compared with conventional PCR methods, improves detection efficiency and saves costs, and has good application prospects.

[0038] (3) The detection primer set of the present invention is designed for the chuS and kpsTII gene sequences. Intraspecific and interspecific tests were conducted using this primer set, and no positive results were found, indicating that the primer set has strong specificity.

[0039] (4) The present invention has high sensitivity for detecting chuS and kpsTII genes, reaching 10 copies / μL.

[0040] (5) The detection method of the present invention has stable inter-group and intra-group repeatability, and is suitable for large-scale clinical testing. Attached Figure Description

[0041] Figure 1 The results of forward and reverse screening using the chuA primer probe are shown.

[0042] Figure 2 The results of forward and reverse screening using the chuS primer probe are shown.

[0043] Figure 3 The results of forward and reverse screening using kpsMII primers and probes are shown.

[0044] Figure 4 The results of forward and reverse screening using the kpsTII primer-probe method are shown.

[0045] Figure 5 The amplification curve and standard curve of chuS① are shown.

[0046] Figure 6 The amplification curve of chuS② and the standard curve are shown.

[0047] Figure 7 The amplification curve and standard curve of chuA① are shown.

[0048] Figure 8 The amplification curve of chuA② and the standard curve are shown.

[0049] Figure 9 The amplification curve and standard curve of kpsTII① are shown.

[0050] Figure 10 The amplification curve of kpsTII② and the standard curve are shown.

[0051] Figure 11 The amplification curves and standard curves of the combination chuS①kpsTII① are shown.

[0052] Figure 12 The amplification curves and standard curves of the combination chuA①kpsTII① are shown.

[0053] Figure 13 The sensitivity test results are shown.

[0054] Figure 14 The results of the intraspecific amplification curves are shown.

[0055] Figure 15 The results of the interspecific amplification curves are shown.

[0056] Figure 16 The results of a standard PCR sensitivity test are shown.

[0057] Figure 17 The results of pathogenicity assessment in mouse infection models after clinical strain detection and grouping are shown. Detailed Implementation

[0058] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are now described clearly and completely. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0059] The experimental materials used in the examples were: the plasmid extraction kit was FastPure Plasmid Mini Kit purchased from Novizan Biotechnology Co., Ltd., and the qPCR reaction reagent was 2×Q3Probe qPCR Master Mix (Universal) purchased from Shanghai Tulugang Biotechnology Co., Ltd.

[0060] In a specific implementation, quantitative real-time PCR is used to identify virulent and attenuated strains of pathogenic Escherichia coli from pigs. Using the DNA of the sample to be tested as a template, four key virulence genes of virulent pathogenic Escherichia coli from pigs—chuA, chuS, kpsMII, and kpsTII—are selected as target genes. The target gene sequences are then compared to determine conserved sequence regions. Primers for quantitative real-time PCR amplification are designed based on the gene sequences, and probes are designed within these primers. Four combinations are designed by pairwise pairwise combinations of genes from the chu gene cluster and the capsule synthesis gene cluster within the designed primer-probe combinations. Through positive and negative screening of the quantitative real-time PCR primers and probes, as well as optimal screening using single and multiple standard curves, the combination of chuS and kpsTII is finally selected as the target gene of this invention. The dual quantitative real-time PCR method established in this way can identify the presence of highly pathogenic Escherichia coli strains in porcine clinical samples by analyzing the quantitative real-time PCR amplification curve and Ct value.

[0061] Example 1: Primer and probe design and preliminary screening of candidate target genes

[0062] Based on the genomic sequences of strains isolated from our laboratory and uploaded to GenBank, the virulence genes chuA, chuS, kpsMII, and kpsTII were selected as target genes. MegAlign was used to perform conservation analysis on the sequences to identify candidate regions for amplification. Quantitative PCR primers were then designed based on the identified gene sequences, and probe primers were designed between these primers. The quantitative PCR primers and probes were synthesized by Sangon Biotech. For each candidate target gene, four pairs of upstream and downstream primers and probes were designed, resulting in a total of 16 sets of probes and corresponding primer pairs. The designed primer pairs were screened using forward and reverse screening methods, and the results are shown below. Figure 1-4 As shown, where Figure 1 A and 1B Figure 2 A and 2B Figure 3 A and 3B Figure 4 A and 4B correspond to the positive and negative screening results of chuA, chuS, kpsMII, and kpsTII primer probes, respectively. Based on their amplification curves, primers with small CT values, high relative fluorescence values, good amplification curves, and negative normal CT values ​​were selected. Two pairs of primers each for chuA, chuS, and kpsTII were obtained, and their sequences are shown in Table 1 below:

[0063] Table 1 Primer and probe sequences for candidate target genes

[0064]

[0065] Example 2: Preparation of plasmid standards corresponding to the target gene

[0066] (1) Target segment selection

[0067] Based on the sequencing results, a segment containing the amplified portion was selected from the chosen chuA, chuS, and kpsTII genes as the target fragment.

[0068] The target fragment sequence, which includes the amplified segment of the chuA gene, is as follows:

[0069] TTGGGCGAACTGAAAATCTGGATGGTATTGTGGCCTGGTCCAGTCGCGAT ①CGG②GGTGATTTACG CCAGAGCAATGGTGAAACCGCGCCGAATGACGAGTCCATTAATAACAT GCTGGCGAAAGGGACCTGGCAA③ATT ④GATTCAGCCCAGTCTCTGAGCGGTTTAGTG CGTTACTACAACAACGACGC (SEQ ID NO:16), where the underlined part is the amplified segment, and the ununderlined parts are the upstream and downstream sequences of the amplified segment. Together, they constitute the target fragment sequence containing the amplified segment as referred to in the text. ②-④ are the ChuAqF1R1 amplified segment, and ①-③ are the ChuAqF2R2 amplified segment.

[0070] The target fragment sequence containing the amplified segment of the chuS gene is as follows:

[0071] GCTGAAACCTGGGTAACCCGTAAACCTGCTAGTGACGGTTATGTGACCAG ①TCTG GAAT②TGTTT GCCCATGATGGTACGCAGATAGCGCAACTTTATGGTCAACGTACAGAAG GCGAACAGGAGCAAGCGCAATGGCGT AAGCAAATTGCTTCGCTGATACCGG③A④ AGG CGTTACTGCATAA (SEQ ID NO:17), where the underlined part is the amplified segment, and the ununderlined parts are the upstream and downstream sequences of the amplified segment. Together, they constitute the target fragment sequence containing the amplified segment as referred to in the text. ②-④ are the ChuSqF1R1 amplified segment. TGTTTGCCCATGATGGTACGCAGATAGCGCAACTTTATGG TCAACGTACAGAAGGCGA ACAGGAGCAAGCGCAATGGCGTAAGCAAATTGCTTCGCTGATACCGGA (SEQ ID NO: 18), ①-③ are ChuSqF2R2 amplified segments.

[0072] The target fragment sequence containing the amplified segment of the kpsTII gene is as follows:

[0073] CGAAGTCCTATGCACGCCAACGGGTCGACATTATGTCTTTAAGGATTTA ①AACA②TCGAAATCCC TTCAGGAAAAAGTGTCGCCTTTATTGGTCGCAACGGAGCGGGTAAAT CAACGTTACTGAGAATGATTGGCGGC③ ATT4 GACCGCCCCGACAGTGGAAAGATCAT CACTAATAAAACAATATCATGGCC (SEQ ID NO:19), where the underlined part is the amplified segment, and the ununderlined parts are the upstream and downstream sequences of the amplified segment. Together, they constitute the target fragment sequence containing the amplified segment as referred to in the text. ②-③ are the KPSTIIqF1R1 amplified segment. TCGAAATCCCTTCAGGAAAAAGTGTCGCCT TTATTGGTCGCAACGGAGCGGGTAAAT CAACGTTACTGAGAATGATTGGCGGC (SEQ ID NO:20), ①-④ are KPSTIIqF2R2 amplified segments.

[0074] (2) Target fragment synthesis

[0075] The target fragment was introduced into the standard plasmid pUC57 (Thermo Scientific) and sent to a biotechnology company for gene synthesis to obtain a synthetic plasmid.

[0076] (3) Transformation

[0077] The synthesized plasmid was transferred into competent cells (ice bath for 30 min; heat shock at 42℃ for 90 s; ice bath for 2 min). The bacterial culture was transferred to antibiotic-free LB medium and cultured with shaking at 37℃ and 220 rpm for 45 min. 50 μL of the bacterial culture was evenly spread on LB agar plates containing ampicillin and incubated overnight at 37℃.

[0078] (4) Screening and identification of positive clones

[0079] Single colonies were picked from LB agar plates and added to 5 mL of ampicillin-resistant LB medium. The culture was incubated at 37°C and 220 rpm for 12 h with shaking. Using the corresponding primers, bacterial culture was validated by PCR (amplifying the target fragment) and sequenced. Plasmids were extracted using a plasmid DNA extraction kit. The identified positive recombinant plasmids were named pUC57-chuA, pUC57-chuS, and pUC57-kpsTII. The plasmid concentrations were determined using a Nano-300 microspectrophotometer. The concentrations of pUC57-chuA, pUC57-chuS, and pUC57-kpsTII were 55 ng / μL, 60 ng / μL, and 59 ng / μL, respectively. The copy numbers of these recombinant plasmids were calculated to be 1.63 × 10^10 copies / μL, 1.78 × 10^10 copies / μL, and 1.75 × 10^10 copies / μL, respectively, and these were used as plasmid standards.

[0080] The formula for calculating the copy number is as follows: Copy number = plasmid concentration × 6.02 × 10⁻⁶ 23 / (660×total plasmid length).

[0081] Example 3: Screening of target genes and probe-prime combinations using singleton quantitative PCR standard curves

[0082] Crude DNA was extracted from the sample, and quantitative real-time PCR was performed using a 2×Q3Probe qPCR Master Mix (Universal). The reaction mixture consisted of 20 μL of water, 7 μL of water, 10 μL of 2×Q3Probe qPCR Master Mix (Universal), 0.4 μL each of forward and reverse primers, 0.2 μL of probe, and 2 μL of template DNA. The quantitative real-time PCR program was: 95℃ for 30 s; 95℃ for 10 s, 60℃ for 30 s, for 40 cycles.

[0083] Using the above system, the primer-probe combinations of six different candidate target genes selected in Example 1, including chuS①: chuSqF1\R1\P, chuS②: chuSqF2\R2\P, chuA①: chuAqF1\R1\P, chuA②: chuAqF1\R1\P, kpsTII①: kpsTIIqF1\R1\P, and kpsTII②: kpsTIIqF2\R2\P, were further evaluated and screened by plotting a standard curve.

[0084] To plot the standard curve for singlet real-time PCR amplification, the three plasmid standards from Example 3 were serially diluted 10-fold (using 10... 3 10 4 10 5 10 6 10 7 10 8 Using copies / μL (6 dilutions) as template, quantitative PCR was performed on a QuantStudio 6 real-time PCR instrument to obtain amplification curves. A standard curve was plotted with the logarithm of template concentration on the x-axis and Ct value on the y-axis, and the correlation coefficient R was analyzed. 2 The values ​​are: 0.9949 (chuS①), 0.9958 (chuS②), 0.9986 (chuA①), 0.9986 (chuA②), 0.9971 (kpsTII①), and 0.9902 (kpsTII②). All six combinations exhibit a good linear relationship and meet the requirements of the standard curve (R²). 2 >0.99), the standard curve established is as follows Figures 5-10 As shown, where Figure 5 A and 5B Figure 6 A and 6B Figure 7 A and 7B Figure 8 A and 8B, Figure 9 A and 9B Figure 10 A and 10B correspond to the amplification curves and standard curves of chuS①, chuS②, chuA①, chuA②, kpsTII①, and kpsTII②, respectively. The standard curves, i.e., the linear equation between the copy number logarithm (x) and the Ct value (y), are as follows:

[0085] chuS①:Y=-3.279*X+41.63,R 2 =0.9949, eff% = 101.8%

[0086] chuS②: Y=-2.951*X+37.75, R2=0.9958, eff%=118.2%

[0087] chuA①:Y=-3.553*X+44.16,R 2 =0.9986, eff% = 91.2%

[0088] chuA②: Y=-3.041*X+38.48, R2=0.9886, eff%=113.2%

[0089] kpsTII①: Y=-3.275*X+44.03, R2=0.9971, eff%=102.0%

[0090] kpsTII②: Y=-3.406*X+42.60, R2=0.9902, eff%=96.6%

[0091] The amplification efficiency of the primers (optimal 90%-110%) and the standard curve R 2 Based on results such as (>0.99), the best combination of primers and probes, chuS①, chuA①, and kpsTII①, was finally selected and used in Example 4.

[0092] Example 4: Screening of target genes and probe-prime combinations using dual-fluorescence quantitative PCR standard curves

[0093] Quantitative real-time PCR was performed using 2×Q3Probe qPCR Master Mix (Universal). The reaction volume was 20 μL, including 6.5 μL water, 10 μL 2×Q3Probe qPCR Master Mix (Universal), 0.4 μL each of chuSqF and chuSqR, 0.2 μL chuSqP, 0.2 μL each of kpsTIIqF and kpsTIIqR, 0.1 μL kpsTIIqP, and 2 μL template. The dual quantitative real-time PCR reaction program was: 95℃ for 30 s, 95℃ for 10 s, 60℃ for 30 s, for 40 cycles.

[0094] In the three examples, three sets of primer-probe combinations for candidate target genes were obtained through screening. Based on the combination of chu gene cluster genes and capsule synthesis gene cluster genes, there are two sets of dual real-time PCR probe-primer combinations: chuS①kpsTII① and chuA①kpsTII①.

[0095] To plot the standard curve for dual-fluorescence quantitative PCR amplification, the two prepared plasmid standards were serially diluted 10-fold, with concentration ranges of 10... 8 -10 3 After each copy number (μL), quantitative real-time PCR amplification was performed. A standard curve for quantitative real-time PCR was plotted with the logarithm of the copy number on the x-axis and the Ct value on the y-axis. The results are shown below. Figure 11 and12 As shown, where Figure 11 A and 11B are the amplification curve and standard curve of the combination chuS①kpsTII①. Figure 12 A and 12B are the amplification curve and standard curve of combination chuA①kpsTII①. The linear equation between the above copy number log (x) and Ct value (y) is as follows:

[0096] Combination chuS①kpsTII①

[0097] chuS①:Y=-3.328*X+42.43, R2=0.9958, eff%=99.7%

[0098] kpsTII①:Y=-3.148*X+41.38, R2=0.9943, eff%=107.8%

[0099] Combination chuA①kpsTII①

[0100] chuA①:Y=-3.716*X+44.45, R2=0.9990, eff%=85.8%

[0101] kpsTII①:Y=-3.475*X+42.70, R2=0.9987, eff%=94.0%

[0102] As can be seen from the above, the combination chuS①kpsTII① is in 10 8 -10 3 The amplification efficiencies of standards constructed in the range of copies / μL were all greater than 99% and less than 110%, with correlation coefficients R0. 2 All values ​​were above 0.99, indicating a good linear relationship between the standard plasmid template number logarithm and the Ct value, and demonstrating good amplification efficiency. However, the combination chuA①kpsTII① showed poor amplification efficiency, with chuA① having an amplification efficiency of less than 90%. Therefore, based on the principle of selection, the combination chuS①kpsTII① will be used in subsequent examples.

[0103] The target gene primer and probe set obtained after screening is shown in the table below.

[0104] Table 2 Basic Information on Target Gene Primers and Probes

[0105]

[0106] The primers and probes used in subsequent embodiments are all those shown in Table 2.

[0107] Example 5: Sensitivity Test

[0108] Plasmid standards were serially diluted 10-fold for dual quantitative PCR, with a detection limit of 10 copies / μL. This indicates that the dual quantitative PCR constructed using the chuS and kpsTII genes has high sensitivity, as shown in the amplification curves. Figure 13 As shown, NC is the negative control for deionized water.

[0109] chuS-positive and kpsTII-positive E. coli cultures were serially diluted 10-fold and subjected to dual quantitative PCR. Both chuS and kpsTII were detected down to a minimum of 10. 2 CFU / mL.

[0110] Example 6: Specificity Test

[0111] Intraspecificity: chuS-positive and kpsTII-positive Escherichia coli were used as positive controls for highly virulent strains. Three different types of Escherichia coli with varying virulence were used: chuS-negative and kpsTII-positive, chuS-positive and kpsTII-negative, and chuS-negative and kpsTII-negative. Water was used as a negative control. The specific selection of Escherichia coli is shown in Table 3.

[0112] Table 3. Basic information on the selection of intraspecific strains.

[0113]

[0114] + indicates positive, - indicates negative.

[0115] DNA was extracted from the selected bacterial strain and used as a template for quantitative real-time PCR. Quantitative real-time PCR amplification was performed under the established optimal reaction conditions, and the results are as follows: Figure 14 As shown, Figure 14 A represents the chuS detection status. Figure 14 B represents the kpsTII detection results, and 1-8 represent PE008, PE098, FTEC11, FTEC79, SXE21, U90, K12, and deionized water, respectively, as shown in Table 3. The amplification curves show that both chuS and kpsTII positive virulent strains can be detected with their respective amplification curves, while strains with corresponding negative genes and negative controls did not show corresponding amplification curves. This indicates that the method has good intraspecific specificity.

[0116] Interspecies specificity: *ChuS-positive* and *KpsTII-positive* *E. coli* were used as positive controls for highly virulent strains. *Salmonella*, *Pasteurella*, *Klebsiella pneumoniae*, *Clostridium perfringens*, *Streptococcus suis*, and deionized water were used as negative controls. Crude DNA was extracted and used as a template for quantitative real-time PCR. Quantitative real-time PCR amplification was performed under the established optimal reaction conditions. The results are as follows: Figure 15As shown, sample 1, representing chuS-positive and kpsTII-positive Escherichia coli, showed amplification curves corresponding to the chuS and kpsTII genes, while no amplification curves were observed for other pathogens and the negative control, indicating that this method has good interspecies specificity.

[0117] Example 7: Repeatability Test

[0118] The chuS and kpsTII recombinant plasmids were each serially diluted 10-fold and then mixed in equal proportions, resulting in four concentration gradients (final concentrations of 10, ... 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 A standard plasmid mixture (copies / μL) was prepared, with deionized water used as a negative control. The established quantitative real-time PCR method was used to perform three repeated detections for intra-group repeatability testing. Inter-group repeatability testing was also performed on the same concentration of standards diluted at three different time points. The results were statistically analyzed to evaluate the repeatability of the method, and the results are shown in Table 4. Table 4 shows that the intra-group coefficient of variation was less than 2%, and the inter-group coefficient of variation was less than 4%, indicating that the multiplex quantitative real-time PCR method established in this invention has good repeatability.

[0119] Table 3 Results of Repeatability Tests

[0120]

[0121] Example 8: Sensitivity comparison with conventional PCR

[0122] A virulent strain of porcine Escherichia coli positive for both chuS and kpsTII genes was used as a positive control and serially diluted to 10⁻⁶. 8 -10 2 CFU / ml concentration was used to detect the chuS and kpsTII genes using conventional PCR methods. Figure 16 It is evident that conventional PCR can detect at least 10 chuS and kpsTII genes. 4 CFU / ml. The sensitivity of quantitative real-time PCR is about 100 times higher than that of conventional PCR.

[0123] Example 9: Detection and virulence assessment of clinical isolates

[0124] The qPCR detection method described above was used to detect 313 strains of porcine Escherichia coli isolated in the laboratory. The results showed (Table 5) that 19 strains were double-positive for both chuS and kpsTII, accounting for 6.07%; 136 strains were double-negative, accounting for 43.45%; and 158 strains were positive for only one of them, accounting for 50.48%.

[0125] Table 4 Results of Clinically Isolated Strains

[0126]

[0127] Based on the above grouping, representative strains from each group were selected for evaluation of the mouse intraperitoneal infection model. 1×10 8 The mortality rate of mice at the challenge dose of CFU / mouse was shown to be ( Figure 17 The mortality rate of *Escherichia coli* strains positive for both *chuS* and *kpsTII* was over 80%; the mortality rate of *chuS*-positive and *kpsTII*-negative strains ranged from 20% to 40%; the mortality rate of *chuS*-negative and *kpsTII*-positive strains was below 20%; and double-negative strains did not cause death in infected mice. These results indicate that the qPCR detection method can classify porcine *Escherichia coli* into highly virulent, moderately virulent, weakly virulent, and non-virulent strains, facilitating rapid identification of pathogenic strains and guiding the development of clinical prevention and control strategies.

[0128] Example 10: Concordance rate between clinical sample detection and isolated bacterial strain detection results

[0129] Using the clinical samples corresponding to the strains isolated in Example 9, nucleic acids were extracted using a Vazyme nucleic acid extractor and used as templates for dual real-time PCR. The detection results are shown in Table 6, corresponding to those in Example 9.

[0130] Table 5 Results of Clinically Isolated Strains

[0131]

[0132] As shown in the table above, the accuracy rate of this method is above 96%, indicating that this method can be directly used to assess whether highly pathogenic strains exist in clinical samples.

[0133] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A set of primers and fluorescent probes for quantitative real-time PCR detection of porcine pathogenic Escherichia coli, characterized in that, The primer set and fluorescent probe for the quantitative PCR comprise forward and reverse primers and a fluorescent probe designed for each of chuS gene and kpsTII gene, respectively, wherein the forward and reverse primers and the fluorescent probe designed for chuS gene specifically amplify and detect a gene fragment as shown in SEQ ID NO: 18, and the forward and reverse primers and the fluorescent probe designed for kpsTII gene specifically amplify and detect a target fragment as shown in SEQ ID NO: 20; against chuS The 5'-3' sequence of the gene-designed forward primer is shown in SEQ ID NO.: 1, and against chuS The 5'-3' sequence of the reverse primer for gene design is shown in SEQ ID NO.:

2. against chuS The sequence of the genetically designed fluorescent probe is: 5'-TGCTCCTGTTCGCCTTCTGTACGTT-3', with a fluorescent quenching group labeled at the 3' end and a fluorescent reporter group labeled at the 5' end. against kpsTII The 5'-3' sequence of the gene-designed forward primer is shown in SEQ ID NO.: 4, and against kpsTII The 5'-3' sequence of the reverse primer for gene design is shown in SEQ ID NO.:

5. against kpsTII The genetically designed fluorescent probe sequence is: 5'-TGATTTACCCGCTCCGTTGCGACCA-3', with a fluorescent quencher group labeled at the 3' end and a fluorescent reporter group labeled at the 5' end.

2. The real-time PCR primer set and fluorescent probe according to claim 1, characterized in that, The 5' end fluorescent reporter group of the fluorescent probe is selected from FAM, JOE, ROX, TET, TAMRA, HEX, VIC, CY3, CY5 or TexasRed; the 3' end fluorescent quencher group of the fluorescent probe is selected from BHQ1, Eclipse, Dabcyl, LowaBlackTMRQ or LowaBlackTMFQ.

3. A kit for detecting porcine pathogenic Escherichia coli, characterized in that, It includes the fluorescent quantitative PCR primer set and fluorescent probe as described in claim 1 or 2.

4. The reagent kit according to claim 3, characterized in that, The kit also includes a positive plasmid standard, which is a plasmid standard in which plasmid containing SEQ ID NO: 18 has been introduced. chuS The sequence of the gene amplification segment and containing SEQ ID NO: 20 kpsTII Recombinant plasmids containing gene amplification segments.

5. Use of the fluorescent quantitative PCR primer set and fluorescent probe according to claim 1 or 2, or the kit according to claim 3 or 4, in the preparation of a kit for use in a method for detecting porcine pathogenic Escherichia coli, characterized in that, The method includes the following steps: (1) Extract DNA from the sample to be tested as a template; and (2) Perform dual quantitative PCR detection on the template using the quantitative PCR primer set and fluorescent probe according to claim 1 or 2 or the kit according to claim 3 or 4.