SgRNAs for demethylation editing of fgf2 gene of oryzias melastigma, editing system and application

Abstract

The invention relates to sgRNAs for demethylation editing of an fgf2 gene of oryzias melastigma, an editing system and application, and belongs to the technical field of gene editing, and the sgRNAs are sgRNA1 + sgRNA2 + sgRNA3 or sgRNA2 + sgRNA3 + sgRNA4 + sgRNA5; the system comprises a Fuw-UbC-dCas9-tet1 plasmid and a pGL3-U6-sgRNAs plasmid, and the sequence of a conserved structural domain of a tet1 gene is as shown in SEQ ID NO. 1 (sequence identifier number 1). Through co-transfection of Mix1 or Mix2, the DNA methylation level of the fgf2 gene promoter can be effectively reduced by about 20.41% at most, the off-target efficiency is extremely low, the cell growth speed is remarkably increased, and stable inheritance is achieved.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and relates to sgRNAs, an editing system and applications for demethylation editing of the fgf2 gene of medaka fish. Background Art

[0002] DNA methylation is an important epigenetic modification and a key regulator of gene expression. In particular, DNA methylation occurs in CpG islands within the promoter region and is closely related to transcriptional repression. With the development of high-throughput sequencing technology, the role of DNA methylation in the life process has been gradually revealed. DNA methylation widely exists in the genomes of organisms. By altering chromatin accessibility through histone modification and other epigenetic modifications, it inhibits or promotes gene expression, and thus regulates the life process during biological growth and development. It is one of the important bases for biological development, aging, and diseases. The ten-eleven translocation (TET) enzyme family plays a key role in active DNA demethylation by catalyzing the oxidation of 5-methylcytosine (5mC). In a mouse model of renal fibrosis, lentiviral delivery of dCas9-TET3CD reactivates two antifibrotic genes through promoter demethylation, thereby alleviating renal fibrosis and restoring renal function. In mammals, the demethylase TET1 is involved in various biological processes such as embryonic development, maintenance of stem cell pluripotency, and somatic cell reprogramming. In addition, TET1 mutations have become potential markers for the treatment of cancer immune checkpoint inhibitors.

[0003] Recently, new gene editing systems have been developed by converting Cas9 into a catalytically inactive form, called dead Cas9 (dCas9), which lacks endonuclease activity but retains its DNA binding ability. This CRISPR / dCas9 technology derived from CRISPR / Cas9 has emerged in epigenetic research. While achieving gene regulation, this technology can well avoid related problems such as DNA damage caused by gene editing technology and make up for the shortcomings of gene editing technology. Currently, very fruitful results have been achieved in epigenetic editing research applied to mammals, especially humans and mice, as well as plants. In addition, there is also a small amount of research on the DNA methylation editing system based on CRISPR / dCas9-dnmt3a in half-smooth tongue sole. However, in fish that are deeply affected by epigenetics, tools related to DNA demethylation editing have not been established. Therefore, it is urgent to develop a set of DNA demethylation epigenetic editing systems suitable for fish and apply them to fish gene research, which is of great significance for the research of marine fish. Summary of the Invention

[0004] To solve the above technical problems, the present invention provides sgRNAs, an editing system and an application for demethylation editing of the fgf2 gene of medaka; by targeting and editing the fgf2 gene of medaka through this system, the DNA methylation level in its promoter region is changed, its expression is further affected, and its genetic efficiency is detected.

[0005] The technical solutions provided by the present invention are as follows:

[0006] One of the technical solutions of the present invention is to provide

[0007] One of the technical solutions of the present invention lies in providing sgRNAs for demethylation editing of the fgf2 gene of medaka, and the sgRNAs are sgRNA1 + sgRNA2 + sgRNA3 or sgRNA2 + sgRNA3 + sgRNA4 + sgRNA5;

[0008] The nucleotide sequences of sgRNA1 are SEQ ID NO.2 and SEQ ID NO.3, the nucleotide sequences of sgRNA2 are SEQ ID NO.4 and SEQ ID NO.5, the nucleotide sequences of sgRNA3 are SEQ ID NO.6 and SEQ ID NO.7, the nucleotide sequences of sgRNA4 are SEQ ID NO.8 and SEQ ID NO.9, and the nucleotide sequences of sgRNA5 are SEQ ID NO.10 and SEQ ID NO.11.

[0009] Another technical solution of the present invention lies in providing a demethylation editing system for the fgf2 gene of medaka. The editing system includes the Fuw-UbC-dCas9-tet1 plasmid and the pGL3-U6-sgRNAs plasmid, and the tet1 gene sequence is as shown in SEQ ID NO.1. The Fuw-UbC-dCas9-tet1 plasmid is respectively a promoter (Fuw-UbC), an anchoring element (dCas9) and an editing effector element (tet1); the pGL3-U6-sgRNAs plasmid is a guiding element;

[0010] The sgRNAs are sgRNA1 + sgRNA2 + sgRNA3 or

[0011] sgRNA2 + sgRNA3 + sgRNA4 + sgRNA5;

[0012] The nucleotide sequences of sgRNA1 are SEQ ID NO.2 and SEQ ID NO.3, the nucleotide sequences of sgRNA2 are SEQ ID NO.4 and SEQ ID NO.5, the nucleotide sequences of sgRNA3 are SEQ ID NO.6 and SEQ ID NO.7, the nucleotide sequences of sgRNA4 are SEQ ID NO.8 and SEQ ID NO.9, and the nucleotide sequences of sgRNA5 are SEQ ID NO.10 and SEQ ID NO.11; the nucleotide sequence of the tet1 gene is SEQ ID NO.1.

[0013] The third technical solution of the present invention is to provide the application of the editing system in editing the fgf2 gene of medaka.

[0014] The fourth technical solution of the present invention is to provide the application of Mix1 (sgRNA1 + sgRNA2 + sgRNA3) and / or Mix2 (sgRNA2 + sgRNA3 + sgRNA4 + sgRNA5) in the DNA demethylation editing system for editing the fgf2 gene of medaka based on CRISPR / dCas9.

[0015] The fifth technical solution of the present invention is to provide a kit, which includes the editing system described in the second technical solution or the sgRNAs described in the first technical solution.

[0016] The beneficial effects of the present invention compared with the prior art: At present, there has been some research on the DNA demethylation editing system based on CRISPR / dCas9. However, the DNA demethylation editing tools applicable to marine fish are still blank, which to a certain extent hinders the targeted research on DNA demethylation in marine fish. The tet1 gene with the catalytic domain of the 2-oxoglutarate-dependent dioxygenase family is widely present and relatively conserved in marine fish, especially in marine fish such as zebrafish, medaka, and sole. The present invention provides a DNA demethylation editing system based on CRISPR / dCas9-tet1 for marine fish, especially medaka, and specifically provides the demethylation editing system and application of the fgf2 gene of medaka, and designs the guide RNAs and combination strategies for the fgf2 gene of medaka, namely Mix1 and / or Mix2, and verifies the high editing efficiency and genetic efficiency of the system, providing a tool for the targeted research on DNA demethylation in marine fish. Brief Description of the Drawings

[0017] Figure 1Construction diagram of the Fuw-UbC-dCas9-tet1 recombinant plasmid. Figure A is the electrophoresis diagram of the tet1 fragment, Figure B is the electrophoresis diagram of the tet1 fusion fragment, and Figure C is the schematic diagram of the construction structure of the Fuw-UbC-dCas9-tet1 recombinant plasmid.

[0018] Figure 2 Verification diagram of the construction of the pGL3-U6-sgRNA recombinant plasmid. A is the electrophoresis diagram of the construction of the pGL3-U6-sgRNA recombinant plasmid, and B is the schematic diagram of the construction structure of the pGL3-U6-sgRNA recombinant plasmid;

[0019] Figure 3 Schematic diagram of the DNA methylation editing system applicable to medaka.

[0020] Figure 4 Effect verification diagram of the demethylation editing system of CRISPR / dCas9-tet1. A shows the expression of the fgf2 gene under the guidance of different sgRNAs (*, p < 0.05; ****, p < 0.01; ***, p < 0.001). B shows the DNA demethylation levels of the fgf2 gene under the guidance of different sgRNAs, respectively representing the DNA demethylation of the Control group without any treatment; the DNA demethylation of the dCas9-tet1 group transfected only with the Fuw-UbC-dCas9-tet1 plasmid; the DNA demethylation of the dCas9-tet1 Mix1 group co-transfected with Fuw-UbC-dCas9-tet1 and pGL3-U6-sgRNA1+sgRNA2+sgRNA3 plasmids; the DNA demethylation of the dCas9-tet1 Mix2 group co-transfected with Fuw-UbC-dCas9-tet1 and pGL3-U6-sgRNA2+sgRNA3+sgRNA4+sgRNA5 plasmids;

[0021] Figure 5 Detection diagram of the fgf2 gene and tet1 gene in each generation of cells using quantitative PCR when the cells of 2 control groups and 2 experimental groups of dCas9 Mix1 and dCas9 Mix2 were continuously passaged in complete medium. Detailed implementation mode

[0022] The technical solutions of the present invention will be further studied through examples below, but the protection scope of the present invention is not limited by any form of the examples.

[0023] Example 1

[0024] The present invention constructs a DNA demethylation editing system based on CRISPR / dCas9 applicable to medaka, including a Fuw-UbC-dCas9-tet1 plasmid and a pGL3-U6-sgRNAs plasmid that can act sequentially. The Fuw-UbC-dCas9-tet1 plasmid is respectively a promoter (Fuw-UbC), an anchoring element (dCas9), and an editing effector element (tet1); the pGL3-U6-sgRNAs plasmid is a guiding element.

[0025] Construction of the Fuw-UbC-dCas9-tet1 plasmid of a DNA methylation editing system applicable to medaka, as Figure 1 shown, the steps are as follows:

[0026] (1) Using the cDNA of medaka gonad tissue as a template, perform PCR amplification with primers tet1-1 F and tet1-1 R to obtain fragment 1 ( Figure 1 A in); the nucleotide sequence of the primer tet1-1 F is shown in SEQ ID NO.22 (5'-aagaagaggaaggtgggatccatgGCTGATCTTCCATCCTGTCAGTG-3'), and the nucleotide sequence of the primer tet1-1 R is shown in SEQ ID NO.23 (5'-TTCAGACGAGCCTCTTGTCTGA-3').

[0027] (2) Using the cDNA of medaka gonad tissue as a template, perform PCR amplification with primers tet1-2 F and tet1-2 R to obtain fragment 2 ( Figure 1 A in); the nucleotide sequence of the primer tet1-2 F is shown in SEQ ID NO.24 (5'-agacaagaggctcgtctgaaGGCCCAAGCGGAGAGGAT-3'), and the nucleotide sequence of the primer dnm3a-2R is shown in SEQID NO.25 (5'-gataagcttgatatcgaattcTTAGGTCCAGCGGTTGTAAGGG-3').

[0028] (4) Mix the fragment 1 obtained in step (1) and the fragment 2 obtained in step (2), and perform PCR cloning amplification with primers tet1-1 F and tet-2R to obtain a fusion fragment 3 ( Figure 1 B in), the sequence is shown in SEQ ID NO.1; the mixed fragment is diluted 100 times with sterile and enzyme-free water as a template.

[0029] (5) The fusion fragment obtained in step (4) and the Fuw-UbC-dCas9 vector (a commercially purchased plasmid, purchased from Addgene) were respectively double digested. The fusion fragment 3 and the Fuw-UbC-dCas9-dnmt3a vector were double digested with EcoRⅠ and BamHⅠ. After digestion, the fusion fragment 3 and the digested vector were reacted at a molar ratio of 1:1 for 1 hour at 37°C under the action of T4 ligase to obtain the Fuw-UbC-dCas9-tet1 recombinant plasmid containing the medaka tet1 gene, as Figure 1 shown in C of

[0030] Example 2

[0031] Construction of the pGL3-U6-sgRNA plasmid of a DNA methylation editing system suitable for medaka, the steps are as follows:

[0032] (1) Using the pGL3-U6-sgRNA plasmid (purchased from Addgene, a general series with sgRNA) as a template, and using primers sgRNAF and sgRNAR, reverse PCR amplification was carried out using TOYOBO KOD high-fidelity enzyme; the system used was: KOD 2×Master Mix 12.5 μL, primers were 0.7 μL each, Pgl3-U6-sgRNA 20 ng, and the system was made up to 25 μL with sterile and enzyme-free water.

[0033] When the first base of the designed sgRNA sequence is not G, the sequence of primer sgRNA F is: G--------------------GTTTTAGAGCTAGAAATAGCAAG (SEQ ID NO.31, where - represents the designed sgRNA sequence, a total of 20 bases); the sequence of primer sgRNA R is--------------------CGTCCTTTCCACAAGATATATAAAG (SEQ ID NO.32, where - represents the reverse complementary sequence of the designed sgRNA sequence, a total of 20 bases); when the first base of the designed sgRNA sequence is G, the sequence of primer sgRNA F is-------------------GTTTTAGAGCTAGAAATAGCAAG (SEQ ID NO.33, where - represents the designed sgRNA sequence, a total of 20 bases); the sequence of primer sgRNA R is--------------------GTCCTTTCCACAAGATATATAAAG (SEQ ID NO.34, where - represents the reverse complementary sequence of the designed sgRNA sequence, a total of 20 bases);

[0034] (2) The obtained PCR product was digested with DpnⅠ. The volume ratio of the PCR product to Dpn1 enzyme was 10:1, and digestion was carried out at 37 °C for 30 minutes. The recombinant plasmid was obtained;

[0035] (3) The recombinant plasmid was transformed into competent cells, and monoclonal colonies were picked for sequencing verification. The sequencing primer used the universal primer RV3 (SEQ ID NO.26) (CTAGCAAATAGGCTGTCCC) for single-direction sequencing.

[0036] Example 3

[0037] A DNA demethylation editing system based on CRISPR / dCas9-tet1 applicable to medaka (Oryzias melastigma), taking the medaka fgf2 gene (XM_024279997.2) as an example, includes the following steps:

[0038] (1) Clone the conserved sequence of the medaka tet1 gene, and ligate the tet1 gene with the linearized Fuw-UbC-dCas9-tet1 plasmid using T4 ligase to construct a recombinant plasmid;

[0039] (2) Using the method of inverse PCR, the sequences (20 nt) of sgRNAs targeting different sites of the fgf2 gene were recombined into the pGL3-U6-sgRNA plasmid;

[0040] (3) Transfect the Fuw-UbC-dCas9-tet1 plasmid and the pGL3-U6-sgRNA plasmid of the DNA demethylation editing system into medaka testis cells;

[0041] (4) Use the qPCR method to measure the expression level of the fgf2 gene;

[0042] (5) Use the bisulfite sequencing method to measure the DNA demethylation level in the promoter region of the fgf2 gene;

[0043] The effect of the above system on the fgf2 gene in medaka cells is specifically illustrated by the following examples.

[0044] Example 4: Design pGL3-U6-sgRNA vectors targeting different sites of the fgf2 gene.

[0045] To obtain an sgRNA sequence that can target the fgf2 gene, the present invention targeted the promoter sequence of the fgf2 gene, analyzed the CpG island of the gene through the online tool MethPrimer (www.urogene.org / cgi-bin / methprimer / methprimer.cgi), and designed 5 sequences specifically targeting fgf2. The sense sequence of sgRNA1: ATTCATGGCGTGAGCTCCGC (SEQ ID NO.2); the antisense sequence of sgRNA1: GCGGAGCTCACGCCATGAAT (SEQ ID NO.3); the sense sequence of sgRNA2: GCGTTTGCTGTTCCGAACGT (SEQ ID NO.4): the antisense sequence of sgRNA2: ACGTTCGGAACAGCAAACGC (SEQ ID NO.5); the sense sequence of sgRNA3: GATGGCCTTTGGTCTGTATA (SEQ ID NO.6): the antisense sequence of sgRNA3: TATACAGACCAAAGGCCATC (SEQ ID NO.7); the sense sequence of sgRNA4: CCTTGTAGCACCTGATCGGC (SEQ ID NO.8): the antisense sequence of sgRNA4: GCCGATCAGGTGCTACAAGG (SEQ ID NO.9); the sense sequence of sgRNA5: TGGAACAGTCAAGCTACGAT (SEQ ID NO.10): the antisense sequence of sgRNA5: ATCGTAGCTTGACTGTTCCA (SEQ ID NO.11).

[0046] The primer sequences for artificially synthesizing and constructing the pGL3-U6-sgRNA plasmid. The forward primer of sgRNA1 (SEQ ID NO.12): gATTCATGGCGTGAGCTCCGCgttttagagctagaaatagcaag; the reverse primer of sgRNA1 (SEQ ID NO.13):

[0047] GCGGAGCTCACGCCATGAATcgtcctttccacaagatatataaag; the forward primer of sgRNA2 (SEQ ID NO.14): GCGTTTGCTGTTCCGAACGTgttttagagctagaaatagcaag;

[0048] The reverse primer of sgRNA2 (SEQ ID NO.15):

[0049] ACGTTCGGAACAGCAAACGCgtcctttccacaagatatataaag; Forward primer of sgRNA3 (SEQ ID NO.16): GATGGCCTTTGGTCTGTATAgttttagagctagaaatagcaag;

[0050] Reverse primer of sgRNA3 (SEQ ID NO.17):

[0051] TATACAGACCAAAGGCCATCgtcctttccacaagatatataaag; Forward primer of sgRNA4 (SEQ ID NO.18): gCCTTGTAGCACCTGATCGGCgttttagagctagaaatagcaag; Reverse primer of sgRNA4 (SEQ ID NO.19):

[0052] GCCGATCAGGTGCTACAAGGcgtcctttccacaagatatataaag; Forward primer of sgRNA5 (SEQ ID NO.20): gTGGAACAGTCAAGCTACGATgttttagagctagaaatagcaag; Reverse primer of sgRNA5 (SEQ ID NO.21):

[0053] ATCGTAGCTTGACTGTTCCAcgtcctttccacaagatatataaag.

[0054] The designed sgRNAs primers were ligated with the vector pGL3-U6-sgRNA (purchased from Addgene, with a general series of sgRNAs) using the method of inverse PCR. TOYOBO KOD (2×MasterMix) high-fidelity enzyme was selected for PCR. The specific steps are as follows:

[0055]

[0056] Inverse PCR amplification was carried out in a PCR instrument. The reaction program is as follows:

[0057]

[0058] The PCR product and Dpn1 enzyme were mixed at a volume ratio of 10:1 and digested with the enzyme at 37°C for 30 minutes.

[0059] The digested plasmid was verified by electrophoresis as Figure 2 shown.

[0060] The verified plasmid was subjected to sequencing verification. The sequencing primer selected was the universal primer RV3 (CTAGCAAATAGGCTGTCCC) for single-direction sequencing.

[0061] Example 5

[0062] The DNA demethylation editing system targeting fgf2 prepared in Example 3 and Example 4 was transfected into medaka testis cells. The process of DNA demethylation is as Figure 3 shown, and the specific steps are as follows:

[0063] (1) Use a spectrophotometer to measure the concentrations of the two plasmids in the DNA methylation editing system;

[0064] (2) Inoculate the cells into a six-well plate and culture them at 24 °C for about 24 hours. When the cell density grows to 60%-70%, perform transfection;

[0065] (3) Replace the cell culture medium with 3% reduced-serum medium, and keep other culture conditions unchanged;

[0066] (4) Use Lipofectamine TM 3000 reagent for transfection and perform transfection according to the steps in the instruction manual. A total of 2 control groups were designed, namely the control group without plasmid transfection and the control group transfected only with the Fuw-UbC-dCas9-tet1 editing plasmid without transfection of the pGL3-U6-sgRNA targeting plasmid; a total of 7 experimental groups were designed, namely the co-transfection group of pGL3-U6-dCas9-tet1 + pGL3-U6-sgRNA1, the co-transfection group of pGL3-U6-dCas9-tet1 + pGL3-U6-sgRNA2, the co-transfection group of pGL3-U6-dCas9-tet1 + pGL3-U6-sgRNA3, the co-transfection group of pGL3-U6-dCas9-tet1 + pGL3-U6-sgRNA4, the co-transfection group of pGL3-U6-dCas9-tet1 + pGL3-U6-sgRNA5, the co-transfection group of pGL3-U6-dCas9-tet1 + pGL3-U6-Mix1, and pGL3-U6-dCas9-tet1 + pGL3-U6-Mix2. Among them, the transfection amount of the pGL3-U6-dCa9-tet1 plasmid was 1000 ng, and the total transfection amount of the sgRNA plasmid was 1000 ng. Among them, Mix1 was sgRNA1 + sgRNA2 + sgRNA3, and Mix2 was sgRNA2 + sgRNA3 + sgRNA4 + sgRNA5.

[0067] (5) After transfection, culture for about 8 hours and then replace it with complete-serum medium;

[0068] (6) Continuously culture for 3 days.

[0069] Example 6: Measuring the expression levels of the fgf2 gene under the guidance of different sgRNAs

[0070] Collect the medaka cells edited in Example 5, extract the total cellular RNA by the Trizol method, perform reverse transcription using the Takara Primescript RT Reagent kit with gDNA Eraser kit to obtain cDNA. Use the QuantiNova SYBR PCR Mix Kit kit for qPCR, and the results are as shown in Figure 4 A in. The qPCR results indicate that the expression of the fgf2 gene was significantly increased (p<0.01). Among the 5 experimental groups transfected with only 1 sgRNA, the gene expression of the target gene was upregulated by about 1.5 - 2 folds, while the gene expressions targeted by Mix1 and Mix2 were both upregulated by approximately 2.1 - 2.3 folds.

[0071] Example 7: Measuring the DNA methylation levels in the promoter region of the fgf2 gene under the guidance of different sgRNAs

[0072] Set aside a portion of the cells collected in Example 6, extract the genomic DNA of the cells using a DNA extraction kit, treat the genomic DNA by the bisulfite treatment method, amplify the promoter region of the fgf2 gene by methylation-specific PCR, and use sanger sequencing to determine the DNA methylation of the promoter region of the fgf2 gene. The forward primers for the methylation-specific PCR used are BS-1-F: 5'-TTTGTTATTGTTGTTGTGTTTTTTG-3' (SEQ ID NO.27), and the reverse primers are BS-1-R: 5'-CTAAAACCTAAAAAACTCCTACACC-3' (SEQ ID NO.28) and BS-2-F: 5'-GGTTAGGGTGTAGGAGTTTTTTAGG-3' (SEQ ID NO.29), and the reverse primers are BS-2-R: 5'-ATCAACTAAAACTATCAAATTTATC-3' (SEQ ID NO.30). The bisulfite sequencing results are as shown in Figure 4 B in. Co-transfection of sgRNAs (Mix1 and Mix2) can effectively reduce the DNA methylation levels in the promoter of the fgf2 gene, reducing by approximately 20.41% and 19.39% respectively.

[0073] Example 8: Detecting the genetic efficiency of the CRISPR / dCas9-tet1 editing system

[0074] The cells of the 2 control groups and the 2 experimental groups of dCas9 Mix1 and dCas9 Mix2 collected in Experiment 6 were continuously passaged and cultured with complete medium, once every 3 days, until the second generation (9 days). The fgf2 gene and tet1 gene of each generation of cells were subjected to qPCR using the QuantiNova SYBR PCR Mix Kit. As Figure 5 shown, after 9 days of continuous passage, the expression level of the pGL3-U6-dCas9-tet1 plasmid gradually decreased and returned to the control group level. However, the expression level of the fgf2 gene was always about 2-fold upregulated compared with the control group, which had a significant promoting effect on cell proliferation.

[0075] tet1 gene conserved sequence DNA (SEQ ID NO.1)

[0076]

Claims

1. A sgRNA for demethylation editing of the fgf2 gene of medaka, characterized in that: The sgRNAs are sgRNA1+sgRNA2+sgRNA3 or sgRNA2+sgRNA3+sgRNA4+sgRNA5; The nucleotide sequence of sgRNA1 is SEQ ID NO.2 and SEQ ID NO.3, the nucleotide sequence of sgRNA2 is SEQ ID NO.4 and SEQ ID NO.5, the nucleotide sequence of sgRNA3 is SEQ ID NO.6 and SEQ ID NO.7, the nucleotide sequence of sgRNA4 is SEQ ID NO.8 and SEQ ID NO.9, and the nucleotide sequence of sgRNA5 is SEQ ID NO.10 and SEQ ID NO.

11.

2. A demethylation editing system for the fgf2 gene of medaka, characterized in that: The editing system includes a Fuw-UbC-dCas9-tet1 plasmid and a pGL3-U6-sgRNAs plasmid, wherein the tet1 gene sequence is shown in SEQ ID NO.1; the Fuw-UbC-dCas9-tet1 plasmid contains a promoter Fuw-UbC, an anchor element dCas9, and an editing effect element tet1; and the pGL3-U6-sgRNAs plasmid is a guide element; The sgRNAs are sgRNA1+sgRNA2+sgRNA3 or sgRNA2+sgRNA3+sgRNA4+sgRNA5; The nucleotide sequence of sgRNA1 is SEQ ID NO.2 and SEQ ID NO.3, the nucleotide sequence of sgRNA2 is SEQ ID NO.4 and SEQ ID NO.5, the nucleotide sequence of sgRNA3 is SEQ ID NO.6 and SEQ ID NO.7, the nucleotide sequence of sgRNA4 is SEQ ID NO.8 and SEQ ID NO.9, and the nucleotide sequence of sgRNA5 is SEQ ID NO.10 and SEQ ID NO.11; the nucleotide sequence of the tet1 gene is SEQ ID NO.

1.

3. Use of the editing system according to claim 2 in editing the demethylation of the fgf2 gene of medaka.

4. A kit, characterized in that: The kit comprises the editing system of claim 2 or the sgRNAs of claim 1.

Images