Target adjustable nano pesticide, preparation method and application

By combining dsRNA with luwangolactone and encapsulating it in chitosan shell, target tunable nanopesticides are formed, and the problems of pathogenic bacteria resistance, environmental pollution and inefficient delivery efficiency of RNAi technology in the prior art are solved, and efficient and targeted plant disease prevention and control effects are achieved.

CN120173945APending Publication Date: 2025-06-20YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510225863.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-27
Publication Date
2025-06-20

AI Technical Summary

Technical Problem

The prior art has problems of pathogenic resistance, environmental pollution and agricultural product residues in plant disease prevention and control. The degradation and delivery efficiency of exposed dsRNA of RNAi technology in the field environment is low, and there are non-target biological effects, which limits its large-scale application.

Method used

A target tunable nanopesticide was developed to form nanostructures by combining double-stranded RNA (dsRNA) with lumonocyanide and encapsulating it in a chitosan shell to form nanostructures, improving the stability and delivery efficiency of dsRNA.

Benefits of technology

It significantly improves the efficiency of RNA interference, enhances the targeted prevention and control capabilities of pathogens, and nanopesticides have good stability, wetting and biocompatibility, and are suitable as alternatives to traditional pesticides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120173945A_ABST
    Figure CN120173945A_ABST
Patent Text Reader

Abstract

The invention discloses a target-adjustable nano-pesticide, a preparation method and application, the target-adjustable nano-pesticide is prepared by creatively combining rugocitrinolide with a double-stranded RNA (Ribonucleic Acid) small groove in a groove mode to form a rugocitrinolide-double-stranded RNA compound based on an RNAi (Ribonucleic Acid Interference) technology, and wrapping the rugocitrinolide-double-stranded RNA compound with a chitosan shell. The nano-pesticide can significantly improve the stability of dsRNA so as to improve the RNA interference efficiency; moreover, the pesticide has good wettability and biocompatibility, is green and environment-friendly, and can be used as a substitute for a traditional pesticide; the dsRNA sequence can be designed in a targeted manner according to the actual occurrence condition of field diseases, targeted prevention and control of different pathogenic bacteria are realized by utilizing the difference and specificity of the sequence, and the application potential is huge.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of pesticides, and particularly to a target-adjustable nano-pesticide, a preparation method and an application thereof. Background Art

[0002] Plant diseases have always been major problems plaguing the sustainable development of global agriculture and food security. Diseases caused by some fungi, viruses or bacteria not only result in crop yield reduction, but also the secondary metabolites pose double risks to the quality of agricultural products and food safety. Problems such as pathogen drug resistance, ecological environmental pollution and agricultural product residues caused by the long-term use of traditional chemical fungicides have become increasingly prominent. Developing environment-friendly green prevention and control technologies has become the research focus in the field of plant protection.

[0003] Natural small molecule substances exhibit unique advantages due to their ecological compatibility and multi-target action mechanisms. Among them, rutacarpin, widely present in Rutaceae plants, as a representative of coumarin derivatives, not only has broad-spectrum antifungal properties, but also can interfere with the biosynthesis of fumonisins by inhibiting the transcription mediated by the GAL4-like Zn(II)2Cys6 transcription factor family, providing new ideas for pesticide research and development. However, natural active ingredients have problems such as poor environmental stability and short action time.

[0004] The RNA interference (RNAi) technology based on the principle of gene silencing has opened up a revolutionary new path for plant disease prevention and control. It specifically degrades target mRNA by delivering double-stranded RNA (dsRNA), achieving programmable silencing of pathogen-related genes. Compared with traditional chemical pesticides, RNAi preparations have the characteristics of high target specificity and environmental friendliness, and particularly show unique advantages for pathogens that have developed chemical resistance. Some studies have shown that applying dsRNA can effectively block their pathogenic and toxin-producing processes. However, problems such as the degradation of naked dsRNA in the complex field environment, low delivery efficiency across biological barriers, and potential non-target biological effects severely restrict the large-scale application of this technology.

[0005] The natural polysaccharide material chitosan has attracted wide attention due to its unique biological properties. Research shows that chitosan has dual biological functions: on the one hand, chitosan can promote plant growth and prevent and control pests and diseases to a certain extent; on the other hand, it can be used as a plant immune activator to induce the burst of reactive oxygen species, the deposition of callose and the expression of pathogenesis-related proteins, enhancing the host defense ability through systemic acquired resistance. However, the single use of chitosan is not ideal and cannot be effectively used in the increasingly complex field environment. There is still a lack of application methods that can effectively overcome the inherent defects of the above technologies. Summary of the Invention

[0006] Object of the Invention: The object of the present invention is to provide a target-adjustable nano-pesticide based on RNAi technology that can simultaneously target single or multiple pathogen infections. The second object is to provide a preparation method and application of the nano-pesticide.

[0007] Technical Solution: The target-adjustable nano-pesticide described in the present invention includes double-stranded RNA (dsRNA), rovalide embedded in its minor groove, and a chitosan outer shell wrapped around the two.

[0008] Preferably, the dsRNA contains at least one sequence with no less than 80% sequence complementarity to the essential gene of the pathogen, and can specifically inhibit the infection of the pathogen to plants through the RNA interference mechanism.

[0009] Preferably, the pathogen is any one of fungi, bacteria or viruses that can infect plants.

[0010] Preferably, the length of the dsRNA is 400 - 700 bp.

[0011] Preferably, the chitosan is chitosan modified with hydrophilic groups by quaternization, sulfonation, carboxymethylation or hydroxypropylation.

[0012] Preferably, the chitosan is quaternary ammonium salt modified chitosan, and more preferably hydroxypropyl trimethyl ammonium chloride chitosan.

[0013] The preparation method of the target-adjustable nano-pesticide described in the present invention includes the following steps:

[0014] (1) Design and prepare a dsRNA solution according to the essential gene of the plant pathogen;

[0015] (2) Add a rovalide solution to the dsRNA solution obtained in step 1, and mix well to obtain a dsRNA-rovalide complex solution;

[0016] (3) Add a chitosan solution to the dsRNA-rovalide complex solution obtained in step 2, mix well and incubate to obtain the target-adjustable nano-pesticide.

[0017] Preferably, in step 2, the mass ratio of the double-stranded RNA to rovalide is 1:0.5 - 1. The solvent of the double-stranded RNA solution is water, and the solvent of the rovalide solution is 10% ethanol-aqueous solution. After mixing the double-stranded RNA solution and the rovalide solution, heat in a water bath at 50 - 60 °C, vortex and oscillate, and incubate at room temperature for not less than 1 h before use.

[0018] Preferably, the preparation method of the chitosan solution in step 3 is: after the chitosan is dissolved in water, it is heated in a water bath at 50-60°C, vortexed, and incubated at room temperature for not less than 1 hour to obtain a chitosan aqueous solution with a concentration of not less than 2 mg / mL for standby use; the mass ratio of the dsRNA-luwangcitrus lactone complex to chitosan is 1:0.5-1, and the two are mixed and heated in a water bath at 50-60°C, vortexed, and incubated at room temperature for not less than 1 hour.

[0019] The target-adjustable nanopesticide of the present invention is used in preventing and controlling pathogens from infecting plants.

[0020] Preferably, the use is for controlling one or more fungi, bacteria or viruses that can infect plants and infect plants.

[0021] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0022] 1. This nanopesticide creatively proposed to utilize the binding activity of the natural small molecule compound Luwangcitrus lactone and dsRNA, and use the complex of the two as the main active substance to prepare the nanopesticide, which can significantly improve the stability of dsRNA, thereby improving the efficiency of RNA interference;

[0023] 2. The nanopesticide has good stability, wettability and biocompatibility, is green and environmentally friendly, and can be used as a substitute for traditional pesticides;

[0024] 3. This nanopesticide can design dsRNA sequences according to the actual occurrence of field diseases, and use the differences and specificity of the sequences to achieve targeted prevention and control of different pathogens, and has great application potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The results of isothermal titration calorimetry for determination of the binding activity of double-stranded RNA (dsRNA) and luvangetin (A) and molecular docking simulation (B);

[0026] Figure 2 RNase III resistance (A), thermal stability (B), UV resistance (C) and zeta potential (D) of the dsRNA-Luvangetin complex;

[0027] Figure 3 The flow chart for the preparation of [dsRNA-Luvangetin]@quaternary ammonium salt modified chitosan (CQAS) target-adjustable nanopesticide;

[0028] Figure 4Scanning electron microscope (A) and transmission electron microscope (B) images and particle size distribution range (C) of [dsRNA-Luvangetin]@CQAS target-tunable nano-pesticide;

[0029] Figure 5 Zeta potential (A), infrared spectrum (B), ultraviolet spectrum (C) and XRD spectrum (D) of [dsRNA-Luvangetin]@CQAS target-tunable nano-pesticide;

[0030] Figure 6 Contact angle (A) and liquid holding capacity (B) measurements of [dsRNA-Luvangetin]@CQAS target-tunable nano-pesticide;

[0031] Figure 7 Bio-safety measurements of [dsRNA-Luvangetin]@CQAS target-tunable nano-pesticide on earthworms (A) and zebrafish (B);

[0032] Figure 8 Control effect of [dsRNA-Luvangetin]@CQAS target-tunable nano-pesticide on Sclerotinia sclerotiorum on rape (A), lesion area statistics (B) and relative expression levels of Ss-VPS51, Ss-DCTN, Ss-SAC1 target genes detected by RT-qPCR (C);

[0033] Figure 9 Control effect of [dsRNA-Luvangetin]@CQAS target-tunable nano-pesticide on combined infection of fungi and viruses on tobacco (A), and fluorescence intensity of TMV-GFP, relative expression level of CP TMV and statistical results of Sclerotinia sclerotiorum lesion area (B). Detailed implementation manners

[0034] The technical solution of the present invention will be further described below.

[0035] Example 1: Determination of the binding ability between Luvangetin and double-stranded RNA (dsRNA)

[0036] 1. Isothermal titration calorimetry experiment

[0037] Titrate 50 μL of a dsRNA solution with a concentration of 0.5 mM and a sequence as shown in SEQ ID NO: 1 into 300 μL of a luvangetin solution with a concentration of 20 μM (the solvent is 10% ethanol-aqueous solution), and use 10% ethanol-aqueous solution as a blank control. The experiment was carried out at 25 °C, with a titration interval of 120 seconds and a stirring speed of 350 rpm. The experimental data was fitted to obtain the corresponding dissociation constant Kd (the reciprocal of the binding constant Ka), stoichiometric ratio n, enthalpy change ΔH, and entropy change ΔS.

[0038] 2. Molecular docking

[0039] Use the 3dRNA web server (v2.0) to construct a 3D model of dsRNA based on the sequence as shown in SEQ ID NO: 1, and obtain the mol file of luvangetin from the PubChem database. Use HEX (v6.3) for docking simulation and PyMOL (v0.1) for visualization analysis.

[0040] The results are as Figure 1 shown in A. In the isothermal titration calorimetry experiment, the change in Gibbs free energy ΔG = -34.67 kJ / mol is negative, and it has a high affinity constant (Ka) and a low dissociation constant (Kd), indicating that Luvangetin can spontaneously bind to dsRNA and has a strong binding ability; in addition, the enthalpy change (ΔH) is -52.53 kJ / mol and the entropy change (ΔS) is -058.93 J / mol·K, both of which are negative, indicating that the main binding between Luvangetin and dsRNA is through hydrogen bonds. The results of molecular docking are as Figure 1 shown in B. Luvangetin binds to the minor groove of dsRNA, and the two bind in a groove mode, with a binding energy of -6.9 kcal / mol.

[0041] Example 2: Exploration of the stability of the dsRNA-Luvangetin complex

[0042] 1. Preparation of the dsRNA-Luvangetin complex

[0043] According to the binding ratio of 17 luvangetin molecules per 20 bp of dsRNA molecule, that is, the mass ratio of double-stranded RNA to luvangetin is 1:0.719, add luvangetin to the dsRNA solution, heat in a water bath at 55 °C, vortex at 3000 rpm, and incubate at room temperature for 1 h to obtain a dsRNA-luvangetin complex solution.

[0044] 2. Agarose gel electrophoresis after degradation by RNase III enzyme

[0045] Take 20 μL of free dsRNA and dsRNA - luvangetin complex with an RNA concentration of 200 ng / μL, and add 5 μL of RNase III with a concentration of 0.5 U / μL respectively. Incubate at 37 °C for 15 minutes. Re - extract dsRNA using the phenol - chloroform method, analyze it by 2% agarose gel electrophoresis, electrophorese at 100 V for 15 minutes, observe the band brightness, and judge whether dsRNA is degraded by RNase III.

[0046] 3. Thermal stability experiment

[0047] Perform thermogravimetric analysis using a Pyris 1 TGA instrument. The temperature range is 0 - 400 °C, nitrogen is used as the experimental gas, and the heating rate is 20 °C / min. During this process, continuously record the weight change of the sample as a function of temperature to determine the decomposition temperature, weight loss rate, and residue.

[0048] 4. Ultraviolet irradiation experiment

[0049] Place 1 mL of dsRNA, luvangetin, and dsRNA - luvangetin complex in solution state in test tubes respectively, expose them to a 254 - nm ultraviolet lamp for 3 hours, and use a NanoPhotometer N50 Touch to measure the concentration of the solute contained in each solution.

[0050] 5. Zeta potential measurement

[0051] Measure the zeta potential of the sample at 25 °C using a Malvern particle size analyzer ES29.

[0052] The results are as Figure 2 shown. Compared with free dsRNA, the RNase III enzyme resistance, thermal stability, and ultraviolet resistance of the dsRNA - Luvangetin complex are significantly improved. The zeta potential of the dsRNA - Luvangetin complex is 34.9 mV, which has higher dispersion stability compared to dsRNA (- 23.1 mV) and is not easily polymerized.

[0053] Example 3: Design and preparation of target - adjustable nano - pesticides

[0054] In this example, the key gene in Sclerotinia sclerotiorum is used for the design and preparation of target - adjustable nano - pesticides.

[0055] 1. Design of dsRNA: The SsVPS51, SsDCTN1, and SsSAC1 genes in Sclerotinia sclerotiorum play crucial roles in pathogenicity, mycelial growth, and sclerotial development, making them ideal targets for RNAi-mediated control of Sclerotinia stem rot of rapeseed. Partial sequences of these three genes were selected and integrated into a sequence of 620 bp as shown in SEQ ID NO: 1;

[0056] 2. Expression and extraction of dsRNA: The sequence described in step 1 was synthesized and constructed into the L4440 vector, transformed into Escherichia coli HT115(DE3), and dsRNA was produced in large quantities. Total RNA was extracted using the phenol-chloroform method. After extraction, 5 μL of RNase A and DNase I with a concentration of 0.5 U / μL were added and incubated at 35 °C for 15 minutes to enzymatically digest ssRNA and DNA;

[0057] 3. Preparation of dsRNA-Luvangetin complex: According to the binding ratio of 17 luvangetin molecules per 20 bp of dsRNA molecule, that is, the mass ratio of double-stranded RNA to luvangetin is 1:0.719, luvangetin solution (solvent is 10% ethanol-aqueous solution) was added to the dsRNA solution, heated in a water bath at 55 °C, vortexed at 3000 rpm, and incubated at room temperature for 1 h to obtain the dsRNA-luvangetin complex solution.

[0058] 4. Preparation of chitosan quaternary ammonium salt (CQAS) nanocarrier: Chitosan quaternary ammonium salt powder was dissolved in water to make an aqueous solution of 2 mg / mL, heated in a water bath at 55 °C for 60 s, vortexed at 3000 rpm for 30 s, and then incubated at room temperature for 1 h to promote the formation of spherical nanoparticles.

[0059] 5. Preparation of target-adjustable nano-pesticide: According to the mass ratio of 1:0.5 - 1, the dsRNA-Luvangetin complex was added to the prepared aqueous solution of chitosan quaternary ammonium salt, heated in a water bath at 55 °C for 60 s, shaken at 3000 rpm for 30 s, and incubated at room temperature for 1 h. Electrostatic interaction was formed between the positively charged amino groups on chitosan quaternary ammonium salt and the negatively charged phosphate groups on the dsRNA backbone to form [Ss-dsRNA-Luvangetin]@CQAS nano-pesticide.

[0060] The preparation process of the target-adjustable nano-pesticide is as Figure 3 shown.

[0061] Example 4: Physical characterization of [dsRNA-Luvangetin]@CQAS target-adjustable nano-pesticide

[0062] Characterize the target - adjustable nano - pesticide [Ss - dsRNA - Luvangetin]@CQAS prepared in Example 3:

[0063] 1. Dry the [dsRNA - Luvangetin]@CQAS prepared in Example 3 to obtain a powdery target - adjustable nano - pesticide sample. Conduct sputtering coating with gold, and then observe the morphology using a Gemini 300 scanning electron microscope;

[0064] 2. Stain the [dsRNA - Luvangetin]@CQAS prepared in Example 3 with 2% phosphotungstic acid, and then observe it using an HT7800 transmission electron microscope;

[0065] 3. Use a Malvern particle size analyzer ES90 to measure the average particle size and zeta potential of the target - adjustable nano - pesticide sample prepared in Example 3 at 25 °C;

[0066] 4. Use a spectrophotometer N50 Touch to record the ultraviolet absorption spectrum of the target - adjustable nano - pesticide sample prepared in Example 3 in the wavelength range of 200 - 500 nm;

[0067] 5. Dry the [dsRNA - Luvangetin]@CQAS prepared in Example 3 to obtain a powdery target - adjustable nano - pesticide sample. Mix it with potassium bromide at a ratio of 1:99 (w / w), grind it thoroughly, press it into a sample tablet, and use a Fourier transform infrared spectrometer Nicolet iS20 for measurement. Set the scanning range to 4000–500 cm - 1;

[0068] 6. Use a D8 Advance instrument to measure the XRD spectrum of the sample, and scan the diffraction angle range from 0° to 80° (2θ);

[0069] 7. Use a dynamic contact angle measuring instrument XG - CAM to measure the wettability of the nano - pesticide on the surface of rapeseed leaves. Use a [dsRNA - Luvangetin]@CQAS droplet with a volume of 3 μL and record the contact angle once per second within 200 s;

[0070] 8. Weigh the initial mass of rapeseed leaves, then immerse them in ddH2O, dsRNA - luvangetin, CQAS, and [dsRNA - luvangetin]@CQAS respectively for 1 minute. Subsequently, place the treated leaves in the air until no water droplets fall off naturally, record the weight, and then calculate the liquid - holding capacity.

[0071] The results of scanning electron microscopy, transmission electron microscopy, and particle size measurement are as Figure 4 shown. [dsRNA - Luvangetin]@CQAS is in the shape of a uniform sphere, and the average particle size is about 450 nm.

[0072] Characterize the chemical characteristics of [dsRNA-Luvangetin]@CQAS using zeta potential, Fourier transform infrared spectroscopy, ultraviolet-visible spectroscopy, and X-ray diffraction analysis. The characterization results are as Figure 5 shown, further indicating the successful preparation of the target-tunable nano-pesticide [dsRNA-Luvangetin]@CQAS and its high stability.

[0073] Investigate the wetting performance of [dsRNA-Luvangetin]@CQAS by measuring the contact angle and liquid holding capacity. The results are as Figure 6 shown. The contact angle of CQAS on rapeseed leaves is the smallest, 44.85°, and the liquid holding capacity is the largest, 12.31 mg / cm 2 . After the dsRNA-luvangetin complex is modified with CQAS, the wetting performance is significantly improved. The contact angle of the [dsRNA-Luvangetin]@CQAS nano-pesticide is 54.13°, and the liquid holding capacity is 11.58 mg / cm 2 .

[0074] Example 5: Biocompatibility of the target-tunable nano-pesticide [dsRNA-Luvangetin]@CQAS

[0075] 1. Use earthworms and zebrafish as model organisms to evaluate the toxicity of the target-tunable nano-pesticide to soil and water.

[0076] 2. Treat earthworms or zebrafish with ddH2O or [dsRNA-Luvangetin]@CQAS prepared in Example 3 at 500 and 1000 mg / L for 20 days, spraying 1 mL each time.

[0077] 3. Record the survival rates of earthworms and zebrafish every 5 days.

[0078] The results are as Figure 7 shown. The statistical analysis of the survival rate of earthworms shows that [dsRNA-Luvangetin]@CQAS at 500 mg / L has no significant toxicity to earthworms. Among them, the survival rate of the control group is 95.57%, and the survival rate of the treatment group is 93.33%. The statistical analysis results of the survival rate of zebrafish are similar. The survival rate of the control group is 95.57%, and the survival rate of the treatment group is 92.2%, with no significant difference. At the ultra-high dose of 1000 mg / L, the toxicity of [dsRNA-Luvangetin]@CQAS is also within the controllable range. That is, the target-tunable nano-pesticide [dsRNA-Luvangetin]@CQAS has environmental friendliness and biocompatibility.

[0079] Example 6: Field Efficacy Determination of [dsRNA-Luvangetin]@CQAS Target-Adjustable Nano-Pesticide

[0080] 1. Efficacy Determination of Single Fungal Infection

[0081] (1) Prepare [Ss-dsRNA-Luvangetin]@CQAS target-adjustable nano-pesticide according to the method described in Example 3 for subsequent field efficacy determination;

[0082] (2) Randomly select healthy rapeseed plants in the field and spray ddH2O, luvangetin, free-Ss-dsRNA, Ss-dsRNA-luvangetin complex, and [Ss-dsRNA-Luvangetin]@CQAS nano-pesticide on rapeseed in the field for 3 days, 1 mL each time;

[0083] (3) Select rapeseed leaves at the same leaf position and of the same size, inoculate a 5-mm Sclerotinia sclerotiorum cake on the back of the leaf. Three days after inoculation, record the lesion area, then extract total RNA and reverse transcribe it into cDNA. Use the primers shown in Table 1 to detect the relative expression levels of three target genes by RT-qPCR. The reaction system is shown in Table 2 and the reaction conditions are shown in Table 3.

[0084] Table 1 Primer Sequences

[0085] SsVPS51-F CTGGTACAGGCTCTTTGC SsVPS51-R CACCTGATGTCTCCTGGTTCG SsDCTN1-F GGATATGCCACCAGCAGGC SsDCTN1-R CACACTGCCGACAAATCTG SsSAC1-F GCTCGGGACACATTGAGAAG SsSAC1-R GCCACAGGTTCATCATTCTACC SsActin-F GAGCTGTTTTCCCTTCCATTGTC SsActin-R GACGACACCGTGCTCGATTGG

[0086] Table 2 Reaction System

[0087]

[0088]

[0089] Table 3 Reaction Conditions

[0090]

[0091] Statistical results showed that the inhibition rate of [Ss-dsRNA-Luvangetin]@CQAS nano-pesticide against Sclerotinia sclerotiorum was 83.62%, which was better than that of the Ss-dsRNA-Luvangetin complex (65.32%). In contrast, the control effects of the individual luvangetin and free-dsRNA treatment groups were poor, with inhibition rates of 43.16% and 20.13% respectively. In addition, the results of RT-qPCR showed that there were significant differences in the relative expression levels of three target genes (Ss-VPS51, Ss-DCTN1, Ss-SAC1) between the [Ss-dsRNA-Luvangetin]@CQAS and free-dsRNA treatment groups. It can be seen that Figure 8 . The [Ss-dsRNA-Luvangetin]@CQAS nano-pesticide showed excellent field control efficacy against Sclerotinia sclerotiorum and significantly improved the RNA interference efficiency.

[0092] 2. Efficacy determination for combined infection of fungi and virus

[0093] (1) Design dsRNA (SEQ ID NO: 2) targeting the CP sequence of tobacco mosaic virus, and prepare [CP TMV -dsRNA-Luvangetin]@CQAS nano-pesticide according to the method described in Example 3.

[0094] (2) Select healthy tobacco plants with consistent growth, and spray them with ddH2O, luvangetin, free-CP TMV -dsRNA, CP TMV -dsRNA-luvangetin complex and [CP TMV -dsRNA-Luvangetin]@CQAS nano-pesticide, 1 mL each time, 3 days after spraying tobacco;

[0095] (3) Select the systemic leaves of tobacco, that is, the lower three leaves, and inoculate the green fluorescent protein-labeled tobacco mosaic virus (TMV-GFP) by the method of agroinfiltration;

[0096] (3) Five days after virus inoculation, select the same systemic leaves, inoculate a 5 mm Sclerotinia sclerotiorum mycelial disc on the back of the leaf. Three days after fungal inoculation, that is, 8 days after TMV inoculation, select the upper leaves to observe the virus infection situation, select the fungal inoculated leaves to observe the combined infection situation, and then extract the total RNA and reverse transcribe it into cDNA. Use the primers shown in Table 4 to detect the relative expression level of the CP gene of TMV by RT-PCR. The reaction system is shown in Table 5, and the reaction conditions are shown in Table 6.

[0097] Table 4 Primer sequences

[0098] TMV-CP-F AAACTGATTTCCTAAGGCA TMV-CP-R TTCGTGTTCTTGTCATCAG

[0099] Table 5 Reaction system

[0100] Composition Volume Total RNA(100ng / μL) 1μL PCR Reverse Primer(10M) 1μL dNTP Mixture(10mM each) 0.5μL <![CDATA[RNase free H2O]]> 5μL Total system 7.5μL

[0101] Table 6 Reaction conditions

[0102] Reaction temperature Time 65℃ 5min 42℃ 1h 70℃ 15min

[0103] The results are as Figure 9 shown in A. Compared with the leaves treated with ddH2O, the leaves treated with the dsRNA-luvangetin complex had fewer green fluorescent dots, while the leaves treated with [[CP TMV -dsRNA-Luvangetin]@CQAS had almost no green fluorescent dots, and at the same time, the lesion area was the smallest. Figure 9 The results shown in B further indicated that [[CP TMV -dsRNA-Luvangetin]@CQAS treatment could not only effectively reduce the relative accumulation amount of the CP gene of tobacco mosaic virus, and the reduction amount could reach 85.2%; it could also reduce the lesion area caused by Sclerotinia sclerotiorum infection. The lesion area after [[CP TMV -dsRNA-Luvangetin]@CQAS treatment was only 2.13 cm 2 , which was reduced by 76.5% compared with the control group.

[0104] In summary, the [dsRNA-Luvangetin]@CQAS target-adjustable nano-pesticide can not only effectively prevent and control the infection of a single pathogen, but also effectively cope with the combined infection of multiple pathogens such as fungi and viruses.

Claims

1. A target-adjustable nanopesticide, characterized in that: The nano pesticide comprises double-stranded RNA, luwangju lactone embedded in the minor groove of the double-stranded RNA, and a chitosan shell wrapped outside the double-stranded RNA.

2. The target-adjustable nanopesticide according to claim 1, characterized in that: The double-stranded RNA comprises at least one sequence having no less than 80% sequence complementarity with an essential gene of a pathogen, and can specifically inhibit the infection of the pathogen to a plant through an RNA interference mechanism.

3. The target-adjustable nanopesticide according to claim 2, characterized in that: The pathogen is any one or more of fungi, bacteria or viruses that can infect plants.

4. The target-adjustable nanopesticide according to claim 1, characterized in that: The length of the double-stranded RNA is 400-700 bp.

5. The target-adjustable nanopesticide according to claim 1, characterized in that: The chitosan is chitosan with hydrophilic groups modified by quaternization, sulfonation, carboxymethylation or hydroxypropylation.

6. A method for preparing the target-adjustable nanopesticide according to claim 1, characterized in that the steps include: (1) Designing and preparing a double-stranded RNA solution based on essential genes of plant pathogens; (2) adding the luwangcitrus lactone solution to the double-stranded RNA solution obtained in step 1, and mixing thoroughly to obtain a double-stranded RNA-luwangcitrus lactone complex solution; (3) Adding chitosan solution to the double-stranded RNA-luwangcitrus lactone complex solution obtained in step 2, mixing thoroughly and incubating to obtain a target-adjustable nanopesticide.

7. The preparation method according to claim 6, characterized in that: In the step 2, the mass ratio of double-stranded RNA to luwangcitrus lactone is 1:0.5-1.

8. The preparation method according to claim 6, characterized in that: In the step 3, the mass ratio of the double-stranded RNA-luwangcitrus lactone complex to chitosan is 1:0.5-1.

9. Use of the target-adjustable nanopesticide according to claim 1 in preventing and controlling pathogens from infecting plants.

10. The use according to claim 9, characterized in that: The application is an application for controlling one or more fungi, bacteria or viruses that can infect plants to infect plants.