Nucleic acid aptamer binding to interleukin-2, molecular beacon and application thereof

Abstract

The invention relates to a nucleic acid aptamer combined with interleukin-2 (IL-2), a molecular beacon and application of the nucleic acid aptamer and the molecular beacon, in particular to application of the nucleic acid aptamer and the molecular beacon in preparation of products for IL-2 targeted diagnosis, IL-2 targeted therapy or detection of the IL-2 level in a sample.

Description

Technical Field

[0001] The present invention pertains to the field of biotechnology and relates to nucleic acid aptamers, molecular beacons that bind interleukin-2 (IL-2) (e.g., mammalian IL-2, primate IL-2, human IL-2), and their uses, particularly in the preparation of products for IL-2 targeted diagnosis, IL-2 targeted therapy, or detecting the level of IL-2 in a sample (e.g., blood such as serum, immune cells like T cells, etc., cell culture medium, or the microenvironment secreted by living cells). Background Art

[0002] Interleukin-2 (IL-2) is a pleiotropic cytokine secreted by activated T cells. It maintains immune homeostasis by regulating the proliferation and function of T cells and NK cells. Abnormal levels of it are closely related to pathological conditions such as tumors, infectious diseases, and immune deficiencies. The amount of IL-2 secretion is also used as a marker of T cell activation. Therefore, its detection is of great significance for evaluating the immune status and treatment effect. A variety of analytical methods have been developed, such as ELISA (enzyme-linked immunosorbent assay) or FCM (flow cytometry), to monitor the level of IL-2 in bulk culture media and cells. These methods are mainly based on antibody-antigen reactions. However, antibodies have defects such as high cost, easy inactivation, and cumbersome detection steps. Antibodies have defects such as high cost, easy inactivation, and cumbersome detection steps.

[0003] Nucleic acid aptamers can be effective alternatives to antibodies and can be used as recognition components in the development of detection probes. Nucleic acid aptamers can bind to targets with high affinity and selectivity, usually obtained through the systematic evolution of ligands by exponential enrichment (SELEX). Nucleic acid aptamers have advantages such as high affinity, low cost, easy chemical modification, and non-immunogenicity. In addition, nucleic acid aptamers can also be used in the development of new tumor immunotherapy systems, providing alternative solutions to problems such as limited targets, high immunogenicity, difficulty in entering tumor tissues, and difficulty in modification and transformation existing in therapies such as bispecific antibodies and CAR-T.

[0004] Molecular aptamer beacon (MAB) is one of the most representative applications of nucleic acid aptamers. It is a fluorescence detection probe (fluorescently labeled oligonucleotide probe) constructed by combining the molecular recognition characteristics of nucleic acid aptamers with molecular beacon technology. It combines the specific targeting of nucleic acid aptamers and the rapid response of beacons, and has the advantages of high sensitivity, good specificity, low background signal, and wide application range. It is a research hotspot in the field of biosensors. The structure of MAB usually includes three components: a loop designed by nucleic acid aptamers, a stem, a part maintaining the conformation, and a reporter gene, which is usually composed of a fluorophore and a quencher group connected to both ends of the sequence respectively. The beacon usually remains in a static state as a closed hairpin structure, and due to fluorescence resonance energy transfer (FRET), the fluorophore is quenched by the quencher group. When binding to the target, the beacon undergoes a conformational change and generates a fluorescence signal to reflect the presence and quantity of the target. Nucleic acid aptamer beacons have the characteristics of easy design and synthesis, simple operation, high sensitivity and specificity, and rapid response, making them an attractive tool in biosensing, bioimaging, and biochemical analysis. In addition, by taking advantage of the convenience of reshaping and modification, nucleic acid aptamer beacons can also be equipped with membrane anchoring functions to achieve cell-level detection with precise spatio-temporal resolution. Several strategies have been developed to design sensors on the cell surface, including covalent coupling, hydrophobic interaction, enzyme ligation, etc. These cell surface sensors are powerful tools for monitoring cell functions and intercellular communication in the cell microenvironment.

[0005] Currently, there are still limitations in the research on aptamers against IL-2. For example, Mohsen Momeni et al. [1] reported a G-quadruplex nucleic acid aptamer that binds to murine IL-2 (Kd≈91 nM), but its binding ability to human IL-2 has not been verified. At the same time, the anti-interference ability of such technologies in complex samples such as high-concentration serum still needs to be improved, and the development of specific aptamer beacons against IL-2 has not been reported.

[0006] Developing new detection and treatment tools based on nucleic acid aptamers is of great significance for breaking through the bottlenecks of existing antibody-based methods. As a new type of recognition molecule, nucleic acid aptamers show broad development and application prospects in the biomedical field. However, there are still a large number of targets for which specific and high-affinity nucleic acid aptamers have not been screened. Therefore, there is an urgent need in this field to develop a highly efficient, stable, and specific nucleic acid aptamer suitable for detecting IL-2 in biological samples and living cells, and based on this nucleic acid aptamer, explore its feasibility in substance detection and immunotherapy by modifying the nucleic acid aptamer. Summary of the Invention

[0007] This disclosure is based on the classical Protein-SELEX technology and uses the recombinant protein hIL-2-Fc-His to screen for ssDNA nucleic acid aptamers. Since this protein contains specific epitopes, it is theoretically possible to obtain specific aptamers against IL-2. We bound the purified protein to the solid-phase carrier Protein A agarose purification resin through the Fc fragment, then incubated it with a random ssDNA library, and innovatively obtained nucleic acid aptamers that specifically bind to IL-2 with high affinity by setting different controls and screening conditions. Subsequently, the inventors modified the nucleic acid aptamers and further constructed molecular beacons with high specificity and high affinity. Finally, the inventors explored the feasibility of applying these nucleic acid aptamers and / or molecular beacons to substance detection, IL-2 targeted diagnosis, immunotherapy (e.g., IL-2 targeted therapy), etc. For example, the inventors developed a detection technology capable of detecting different concentrations of IL-2 and achieved rapid detection of IL-2 at the in-situ and live cell levels (such as detecting the IL-2 secretion level of T cell activation in tumor immunotherapy).

[0008] In one aspect, there is provided a nucleic acid aptamer that binds to interleukin-2 (IL-2), wherein the nucleic acid aptamer comprises a nucleotide sequence selected from the group consisting of or a nucleotide sequence having at least 80% homology with any one of the nucleotide sequences selected from the group consisting of: Apt8-1 (SEQ ID NO: 16); Apt8-2 / Apt8-core (SEQ ID NO: 17); Apt24-1 (SEQ ID NO: 18); Apt24-2 (SEQ ID NO: 19); Apt35 (SEQ ID NO: 20); Apt24-core (SEQ ID NO: 22); and / or Apt35-core (SEQ ID NO: 23).

[0009] In some embodiments, the nucleic acid aptamer is a modified nucleic acid aptamer, and the modification includes one or more modifications selected from the group consisting of: at least one modified sugar moiety, at least one modified internucleoside bond, at least one modified nucleotide, at least one terminal modification, at least one spacer modification, and combinations thereof. In certain embodiments, the at least one modified sugar moiety includes, but is not limited to, a 2′-O-methoxyethyl (2’-OH) modified sugar moiety, a 2′-methoxy modified sugar moiety, a 2′-O-alkyl modified sugar moiety, a bicyclic sugar moiety, a 2’-OH modified sugar moiety, a fluorine-substituted modified sugar moiety, and combinations thereof. In certain embodiments, the at least one modified internucleoside bond includes, but is not limited to, phosphorothioate, alkyl phosphonate, dithiophosphate, alkylthiophosphonate, phosphoramidate, carbamate, carbonate, phosphotriester, acetamidate, carboxymethyl ester, and combinations thereof. In certain embodiments, the at least one modified nucleotide includes, but is not limited to, peptide nucleic acid (PNA), locked nucleic acid (LNA), arabinonucleic acid, derivatives of peptide nucleic acid (PNA), derivatives of locked nucleic acid (LNA), derivatives of arabinonucleic acid, and combinations thereof. In certain embodiments, the at least one terminal modification includes, but is not limited to, a terminal modified with a poly-T sequence (T-strand), a PEG-modified terminal, a fluorescent group-modified terminal, a quencher group-modified terminal, an affinity tag (e.g., biotin, digoxin, etc.)-modified terminal, a phosphorylated modified terminal, a hydrophobic group (e.g., dilauroyl lipid, cholesterol, etc.)-modified terminal, an amino-modified terminal, an adapter-modified terminal, a Spacer (e.g., C3Spacer, Spacer 18)-modified terminal, an insert sequence-modified terminal, a functionalized terminal, or combinations thereof. In certain embodiments, the at least one spacer modification includes, but is not limited to, a non-terminal region modified with a fluorescent group, a non-terminal region modified with a quencher group, a non-terminal region modified with an affinity tag (e.g., biotin, digoxin, etc.), a non-terminal region modified with a hydrophobic group (e.g., dilauroyl lipid, cholesterol, etc.), a non-terminal region modified with a complementary sequence (e.g., a neck modified with a complementary sequence (Cstrand)), a non-terminal region modified with a Spacer (e.g., C3Spacer, Spacer 18), a non-terminal region modified with an insert sequence, or combinations thereof.

[0010] In some embodiments, the nucleic acid aptamer further comprises one or more moieties selected from the group consisting of: a fluorophore, a quencher, an intercalating sequence, a linker, a Spacer, a functionalized terminus, and / or combinations thereof. In certain embodiments, the fluorophore is located at the 5'-end, 3'-end or non-terminal region of the nucleic acid aptamer, at the 5'-end, 3'-end or non-terminal region of other moieties, and / or between the nucleic acid aptamer and other moieties. In certain embodiments, the quencher is located at the 5'-end, 3'-end or non-terminal region of the nucleic acid aptamer, at the 5'-end, 3'-end or non-terminal region of other moieties, and / or between the nucleic acid aptamer and other moieties. In certain embodiments, for example, the intercalating sequence is located at the 5'-end, 3'-end or non-terminal region of the nucleic acid aptamer, at the 5'-end, 3'-end or non-terminal region of other moieties, and / or between the nucleic acid aptamer and other moieties. In certain embodiments, the linker is located at the 5'-end, 3'-end or non-terminal region of the nucleic acid aptamer, at the 5'-end, 3'-end or non-terminal region of other moieties, and / or between the nucleic acid aptamer and other moieties. In certain embodiments, the Spacer is located at the 5'-end, 3'-end or non-terminal region of the nucleic acid aptamer, at the 5'-end, 3'-end or non-terminal region of other moieties, and / or between the nucleic acid aptamer and other moieties.

[0011] In certain embodiments, the fluorophore comprises one or more fluorophores selected from the group consisting of: small molecule fluoresceins, nanomaterials, quantum dots, macromolecular fluorophores, and / or combinations thereof; for example, the small molecule fluoresceins include, but are not limited to, 6-carboxyfluorescein (6-FAM), tetramethylrhodamine, 5-carboxytetramethylrhodamine (5-TAMRA), tetramethylrhodamine isothiocyanate (TRITC), coumarin, fluorescein isothiocyanate (FITC), cyanine dyes (such as Cy2, Cy3, Cy5, PE-Cy5.5), lanthanide chelates (such as europium Eu 3+)、ROX, JOE, APC\VIC, hexachlorofluorescein; for example, the macromolecular fluorescent group includes but is not limited to fluorescent proteins (such as phycoerythrin (PE)), intercalating dyes: ethidium bromide (EB), SYBR Green, ATTO647, ATTo565, Alexa Fluor488. In certain embodiments, the quenching group includes one or more quenching groups selected from the group consisting of small molecule quenchers, nanomaterial quenchers, and / or combinations thereof; for example, the small molecule quenchers include but are not limited to black hole quenchers (BHQ), black hole quencher 1 (BHQ1), black hole quencher 2 (BHQ2), black hole quencher 3 (BHQ3), black hole quencher 650 (BHQ650), 4-(4-dimethylaminophenylazo)-benzoic acid (DABCYL), TAMRA, Eclipse, MGB, BHQ1; for example, the nanomaterials include but are not limited to nanocarbon materials (such as carbon nanotubes, graphene, etc.), metal nanoparticles (such as gold nanoparticles AuNP). In certain embodiments, the insertion sequence includes a nucleotide sequence of any length that does not change the property of the nucleic acid aptamer binding to IL-2, for example, a nucleotide sequence with a length of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases. In certain embodiments, the linker includes a nucleotide sequence of any length, for example, a linker with a length of at least 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70 or more bases; preferably a linker with a length of 20 bases, for example, AAACATCAACTGTACTAATC (SEQ ID NO: 43) or a nucleotide sequence having at least 80% homology thereto. In certain embodiments, the Spacer includes one or more selected from the group consisting of hydrophobic SpacerC3, C6, C12, hydrophilic Spacer9, Spacer 18 or dSpacer, PC linker, and / or combinations thereof. In certain embodiments, the functionalized terminus includes one or more selected from the group consisting of hydroxyl, carboxyl, amino, or thiol modifications, and / or combinations thereof. In one embodiment, the 5' end of the nucleic acid aptamer includes a fluorescent group and the 3' end includes a quenching group; more preferably, the 5' end of the nucleic acid aptamer includes 6-carboxyfluorescein (6-FAM) and the 3' end includes black hole quencher 1 (BHQ1).

[0012] In some embodiments, the nucleic acid aptamer that binds to IL-2 forms a secondary structure through base complementary pairing, and the secondary structure includes but is not limited to hairpin structures, stem-loop structures, pseudoknots, G-quadruplexes, etc.

[0013] In another aspect, a molecular beacon for detecting IL-2 is provided, which comprises the nucleic acid aptamer described in any one of the foregoing embodiments. In some embodiments, the molecular beacon further comprises a fluorescent group and a quenching group. In one embodiment, the sequence of the molecular beacon nucleotides is SEQ ID NO: 37 or SEQ ID NO: 38.

[0014] In another aspect, a product comprising the nucleic acid aptamer and / or the nucleic acid aptamer molecular beacon described in any one of the foregoing embodiments is provided. In some embodiments, the product is a magnetic bead or gel resin for IL-2 detection and / or purification, a reagent and / or kit for detecting IL-2 levels, a pharmaceutical composition for IL-2 targeted therapy, etc. In some embodiments, the product is a non-diagnostic / therapeutic product.

[0015] In another aspect, the application of the nucleic acid aptamer and / or the nucleic acid aptamer molecular beacon described in any one of the foregoing embodiments in the preparation of a product for IL-2 targeted diagnosis, IL-2 targeted therapy or detecting IL-2 levels in a sample is provided. In some embodiments, the sample is blood, such as serum, immune cells such as T cells, etc., cell culture medium or the microenvironment secreted by living cells. In some embodiments, the subject is a mammal, such as a human, a non-human primate (such as an orangutan, an ape), a rodent (such as a rat, a mouse, a guinea pig), a pet (such as a cat, a dog), a livestock (such as a horse, a cow, a sheep, a pig, a rabbit). In some embodiments, the product is a magnetic bead or gel resin for IL-2 detection and / or purification, a reagent and / or kit for detecting IL-2 levels, a pharmaceutical composition for IL-2 targeted therapy, etc.; preferably, the product is a kit, which comprises other compositions or components and / or instructions.

[0016] In another aspect, a method for detecting IL-2 is provided, comprising: a) mixing the nucleic acid aptamer, the nucleic acid aptamer molecular beacon and / or the product described in any one of the foregoing embodiments with a sample to be tested; b) measuring the level of IL-2 in the sample. In some embodiments, the sample is blood, such as serum, immune cells such as T cells, etc., cell culture medium or the microenvironment secreted by living cells. In some embodiments, the detection method is not directly aimed at obtaining a diagnostic result or a health condition, and is a non-diagnostic / therapeutic method.

[0017] On the other hand, a construct for screening IL-2 nucleic acid aptamers is provided, and the core sequence of the protein expression of the construct is selected from the following group: SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28 or SEQ ID NO: 30; and / or the amino acid sequence of the protein expressed by the construct is selected from the following group: SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29 or SEQ ID NO: 31.

[0018] On the other hand, a system is provided, which includes: a module for obtaining the IL-2 level in an object sample; a module for analyzing the IL-2 level in the sample obtained from the object (for example, a module for comparing the IL-2 level in the sample obtained from the object with a reference level); and a module for evaluating IL-2 in the object; a module for outputting and / or storing the analysis result. In some embodiments, the system may optionally further include one or more modules selected from the following group: an object sample collection or receiving module; a module for detecting the IL-2 level in the sample; an IL-2 level input, comparison, storage and / or output module; a local, remote or cloud data storage, reading and / or analysis module.

[0019] Those skilled in the art can make any combination of the technical solutions and technical features described herein without departing from the inventive concept and protection scope of the present invention. Other aspects of the present invention will be apparent to those skilled in the art from the disclosure herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The specific features of the invention involved in this application are shown in the appended claims. The features and advantages of the invention involved in this application can be better understood by referring to the exemplary embodiments and the drawings described in detail below. A brief description of the drawings is as follows.

[0021] Figure 1 : Monitoring of library enrichment process. Figure 1 A: Detection of the binding of ssDNA libraries after the 2nd, 4th, 5th, and 6th rounds of enrichment to proteins such as IL-2 by ELONA; Figure 1 B: Detection of the binding of the 5th, 6th, 7th, and 8th round libraries to proteins such as IL-2 by LONA; Figure 1 C: Optimization of the cycle number by agarose gel electrophoresis of the 5th, 6th, 7th, and 8th rounds.

[0022] Figure 2 : Detection of the binding ability of 10 enriched sequences to proteins such as IL-2.

[0023] Figure 3 : Secondary structure prediction of the truncated and optimized sequences of Apt8, Apt24, and Apt35.

[0024] Figure 4 : SDS-Page electrophoresis diagrams of IL-2-6H, IL-2-catch-6H and IL-15-catch-6H proteins after purification.

[0025] Figure 5 : Detection of the binding specificity and affinity of each sequence. Figure 5 A: Detection of the binding of 5 truncated and optimized sequences to IL-2, IL-2-Fc-His, IgG1-Fc-His and BSA by ELONA; Figure 5 B: Detection of the binding of different concentrations of Apt8-2, 24-2 and 35 to IL-2 by ELONA and calculation of the affinity dissociation constant.

[0026] Figure 6 : Detection of the specificity of three nucleic acid aptamers for IL-2 and IL-15 by ELONA.

[0027] Figure 7 : Detection of proteins such as IL-2-6H in solution by Apt24-MB and Apt35-MB. Figure 7 A: Detection of proteins IL-2-6H and IL-2-Fc-His in solution by Apt24-MB and Apt35-MB, with IgG1-Fc-His, IgG1-Fc, BSA and PBS as controls; Figure 7 B: Detection of proteins such as IL-2-catch-6H and IL-15-catch-6H in solution by Apt24-MB and Apt35-MB, and detection of the specificity of the two probes for IL-2 and IL-15; Figure 7 C: Detection of different concentrations of IL-2-6H solution by Apt24-MB and Apt35-MB and plotting of the standard curve (E x = 485 am, E m = 528 nm).

[0028] Figure 8 : Detection of human cytokines by Apt24-MB and Apt35-MB.

[0029] Figure 9 : Detection capabilities of Apt24-MB and Apt35-MB in solutions with different FBS contents. Detailed implementation manners

[0030] Before describing the present invention, it should be understood that the present invention is not limited to the specific embodiments described, and thus can of course be different. It should also be understood that the terms used herein are only for the purpose of describing specific embodiments and are not intended to be limiting, because the scope of the present invention is only defined by the appended claims.

[0031] Although various embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided by way of example only. Many variations, changes, and substitutions will occur to those skilled in the art without departing from the present invention. It should be understood that various alternatives to the embodiments of the present invention described herein may be employed.

[0032] All numerical ranges provided herein are intended to clearly include all numerical values falling between the range endpoints and the numerical ranges therebetween. The features mentioned in connection with the present invention or the features mentioned in connection with the embodiments can be combined. All features disclosed in this specification can be used in any combination with any composition form, and each feature disclosed in the specification can be replaced by any alternative feature that provides the same, equivalent, or similar purpose. Therefore, unless otherwise specified, the disclosed features are only general examples of equivalent or similar features.

[0033] As used herein, "comprising", "having", or "including" include "containing", "consisting essentially of", "consisting substantially of", and "consisting of"; "consisting essentially of", "consisting substantially of", and "consisting of" are sub-concepts of "comprising", "having", or "including".

[0034] The numerical ranges herein include their endpoints as well as each specific numerical point and sub-range within the numerical range. For example, 1 to 3 includes the endpoints 1 and 3, the specific integer numerical point 2 and non-integer numerical points therebetween (such as but not limited to: 1.2, 1.5, 1.8, 2.1, 2.3, 2.4, 2.8, etc.), and its sub-ranges (such as but not limited to: 1 to 2, 2 to 3, 1 to 1.2, 1.5 to 1.8, etc.).

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although exemplary methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice and testing of the present invention. All publications mentioned herein are incorporated by reference herein to disclose and describe the methods and / or materials related to the cited publications. It should be understood that in case of conflict, the content of the present disclosure supersedes any disclosure of the incorporated publications.

[0036] As used herein, "Interleukin-2 (IL-2)" refers to a pleiotropic cytokine secreted by activated T cells, which maintains immune homeostasis by regulating the proliferation and function of T cells and NK cells. Abnormal levels of IL-2 are closely related to pathological conditions such as tumors, infectious diseases, and immune deficiencies. It is known that IL-2 belongs to the members of the γc receptor cytokine family, and its structure contains four tightly stacked α-helices. The protein sequence contains 133 amino acid residues, and the molecular weight is about 15.5 kDa. At rest, IL-2 is mainly secreted at a low level by CD4+ helper T cells. After activation, the secretion amount increases significantly. CD8+ T cells, NK cells, and dendritic cells can also produce a small amount of IL-2, which binds to the IL-2 receptor (IL-2R) on the cell surface in an autocrine or paracrine manner to play a role in regulating the activity and homeostasis of the immune system. IL-2 can not only stimulate the immune system, promote the proliferation and activation of T cells and NK cells, enhance the killing activity and cytokine secretion, and promote the proliferation of B cells and antibody secretion, but also participate in immune tolerance, help the development and maintenance of Treg cells, mediate activation-induced cell death (AICD), and is also related to the exhaustion of CD8+ T cells in the tumor microenvironment. In this article, the IL-2 refers to IL-2 from mammals, such as humans, non-human primates (such as orangutans, apes), rodents (such as rats, mice, guinea pigs), pets (such as cats, dogs), and livestock (such as horses, cows, sheep, pigs, rabbits).

[0037] As used herein, the term "nucleic acid aptamer" is used interchangeably with terms such as "aptamer (apt)", "nucleic acid aptamer", "aptamer", etc. and has the same meaning, referring to a single-stranded DNA or RNA sequence about 15-90 bases in length (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or each intermediate value between the upper and lower limits of the range), usually with a size of 10-15 kD, capable of specifically recognizing a target. In some embodiments, the nucleic acid aptamer can form a secondary structure through base complementary pairing, such as a hairpin structure, pseudoknot, G-quadruplex, etc., and then fold under intermolecular forces such as electrostatic interaction, hydrophobic interaction, hydrogen bond, van der Waals force, etc. to form a thermodynamically stable three-dimensional spatial structure, achieving specific and efficient recognition of the target through intermolecular forces and structural embedding. In the field of biomedicine, the application scenarios of nucleic acid aptamers involve many aspects such as biomarker discovery, disease diagnosis, molecular imaging, and disease treatment. In some embodiments, a nucleic acid aptamer that binds interleukin-2 (IL-2) is provided, wherein the nucleic acid aptamer comprises a nucleotide sequence selected from the group consisting of or a nucleotide sequence having at least 80% homology with any nucleotide sequence selected from the group consisting of: Apt8-1 (SEQ ID NO: 16); Apt8-2 / Apt8-core (SEQ ID NO: 17); Apt24-1 (SEQ ID NO: 18); Apt24-2 (SEQ ID NO: 19); Apt35 (SEQ ID NO: 20); Apt24-core (SEQ ID NO: 22); and / or Apt35-core (SEQ ID NO: 23).

[0038] As used herein, the term "molecular beacon (MB)" refers to an oligonucleotide fluorescent probe having a loop-stem structure. The MB structure generally consists of a loop portion, a stem portion, and a fluorescent and a quenching group. Usually, the loop portion is a nucleic acid or polypeptide sequence capable of specifically recognizing a target molecule, the stem portion is a 5-8 base complementary sequence, and the fluorescent group and the quenching group are covalently linked to the 5'-end and 3'-end of the molecular beacon, respectively. As used herein, "molecular aptamer beacon (MAB)" refers to a novel probe that combines an aptamer with a molecular beacon. By utilizing the recognition and binding ability of the aptamer to the target, an MB is designed through certain sequence trimming, extension, or combination for the detection of non-nucleic acid targets such as proteins and small molecules. MAB can not only detect the content of substances such as proteins, metal ions, and toxins in solution, but also directly detect cells, bacteria, viruses, etc. Unless otherwise specified, the "molecular beacon" and "molecular aptamer beacon (MAB)" herein can be used interchangeably. In some embodiments, the "molecular beacon for detecting IL-2" described herein includes any of the aforementioned aptamers. In some embodiments, the aptamer or molecular beacon further includes a fluorescent group and a quenching group. Preferably, the 5'-end of the aptamer or molecular beacon includes a fluorescent group and the 3'-end includes a quenching group or the 3'-end includes a fluorescent group and the 5'-end includes a quenching group; more preferably, the 5'-end of the aptamer or molecular beacon includes 6-carboxyfluorescein (6-FAM) and the 3'-end includes Black Hole Quencher 1 (BHQ1). In one embodiment, the nucleotide sequence of the molecular beacon is SEQ ID NO: 37 or SEQ ID NO: 38.

[0039] As used herein, the terms "nucleic acid", "nucleotide", "nucleotide sequence", "oligonucleotide", or "oligonucleotide agent" are used interchangeably and refer to a polymer of nucleotides and include, but are not limited to, single-stranded or double-stranded nucleic acid molecules of DNA, RNA, or DNA / RNA hybrids, oligonucleotide chains containing regularly and irregularly alternating deoxyribose moieties and ribose moieties, and modified and naturally or non-naturally occurring frameworks of such oligonucleotides.

[0040] As used herein, the terms "identity" and "homology" are used interchangeably and mean that there is at least 70% similarity between the nucleotide sequences. It should be understood that the specific sequences shown in the specification and claims of this application are exemplary sequences, and any sequence with more than 70% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, 99%, more than 99.5%, or any numerical value or range therebetween) homology, similarity, and / or identity and that can constitute constructs such as nucleic acid aptamers, molecular beacons, probes, biosensors, etc. that bind interleukin-2 (IL-2) is within the scope of the nucleotide sequences described in this application.

[0041] All nucleotides of the nucleotide sequences constituting constructs such as nucleic acid aptamers, molecular beacons, probes, biosensors, etc. described herein can be natural nucleotides, i.e., unmodified nucleotides, or at least one nucleotide can be a modified nucleotide. The modifications include one or more modifications selected from the group consisting of: at least one modified sugar moiety, at least one modified internucleoside bond, at least one modified nucleotide, at least one terminal modification, at least one spacer modification, and combinations thereof. As used herein, "spacer modification" includes inserting a non-nucleotide chemical group (such as an alkyl chain, PEG chain, etc.) at a specific position in the oligonucleotide chain as a "spacer arm" or "cleavage point" for 1) connecting functional groups (such as fluorescent labels, biotin, etc.) to reduce steric hindrance; 2) regulating the nucleic acid structure (such as adjusting double-stranded stability and avoiding interference of functional groups with hybridization); 3) introducing restriction enzyme sites or cleavage sites (such as abasic spacers).

[0042] In some embodiments, the at least one modified sugar moiety includes, but is not limited to, a 2′-O-methoxyethyl (2’-OH) modified sugar moiety, a 2′-methoxy modified sugar moiety, a 2′-O-alkyl modified sugar moiety, a bicyclic sugar moiety, a 2′-OH modified sugar moiety, a fluorine-substituted modified sugar moiety, and combinations thereof. In some embodiments, the at least one modified internucleoside linkage includes, but is not limited to, phosphorothioate, alkyl phosphonate, dithiophosphonate, alkylthiophosphonate, phosphoramidate, carbamate, carbonate, phosphotriester, acetamidate, carboxymethyl ester, and combinations thereof. In some embodiments, the at least one modified nucleotide includes, but is not limited to, peptide nucleic acid (PNA), locked nucleic acid (LNA), arabinonucleic acid, derivatives of peptide nucleic acid (PNA), derivatives of locked nucleic acid (LNA), derivatives of arabinonucleic acid, and combinations thereof. In some embodiments, the at least one terminal modification includes, but is not limited to, a modification of the terminal with a poly-T sequence (T-strand), a PEG modification of the terminal, a fluorescent group modification of the terminal, a quenching group modification of the terminal, an affinity tag (e.g., biotin, digoxin, etc.) modification of the terminal, a phosphorylation modification of the terminal, a hydrophobic group (e.g., dilauroyl lipid, cholesterol, etc.) modification of the terminal, an amino modification of the terminal, an adaptor modification of the terminal, a Spacer (e.g., C3 Spacer, Spacer 18) modification of the terminal, an insert sequence modification of the terminal, a functionalized terminal, or combinations thereof. In some embodiments, the at least one spacer modification includes, but is not limited to, a fluorescent group modification of a non-terminal region, a quenching group modification of a non-terminal region, an affinity tag (e.g., biotin, digoxin, etc.) modification of a non-terminal region, a hydrophobic group (e.g., dilauroyl lipid, cholesterol, etc.) modification of a non-terminal region, a complementary sequence modification of a non-terminal region (e.g., a modification of the neck with a complementary sequence (C strand)), a Spacer (e.g., C3 Spacer, Spacer 18) modification of a non-terminal region, an insert sequence modification of a non-terminal region, or combinations thereof.

[0043] In this article, constructs such as nucleic acid aptamers, molecular beacons, probes, and biosensors include one or more moieties selected from the group consisting of: fluorophores, quenching groups, intercalating sequences, linkers, spacers, functionalized termini, and / or combinations thereof. In some embodiments, the fluorophore is located at the 5'-end, 3'-end, or non-terminal region of the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct, at the 5'-end, 3'-end, or non-terminal region of other moieties, and / or between the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct and other moieties. In some embodiments, the quenching group is located at the 5'-end, 3'-end, or non-terminal region of the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct, at the 5'-end, 3'-end, or non-terminal region of other moieties, and / or between the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct and other moieties. In some embodiments, the intercalating sequence is located at the 5'-end, 3'-end, or non-terminal region of the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct, at the 5'-end, 3'-end, or non-terminal region of other moieties, and / or between the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct and other moieties. In some embodiments, the linker is located at the 5'-end, 3'-end, or non-terminal region of the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct, at the 5'-end, 3'-end, or non-terminal region of other moieties, and / or between the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct and other moieties. In some embodiments, the spacer is located at the 5'-end, 3'-end, or non-terminal region of the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct, at the 5'-end, 3'-end, or non-terminal region of other moieties, and / or between the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct and other moieties.

[0044] As used herein, the term "fluorophore" includes one or more fluorophores selected from the group consisting of: small molecule fluoresceins, nanomaterials, quantum dots, macromolecular fluorophores, and / or combinations thereof; for example, the small molecule fluoresceins include, but are not limited to, 6-carboxyfluorescein (6-FAM), tetramethylrhodamine, 5-carboxytetramethylrhodamine (5-TAMRA), tetramethylrhodamine isothiocyanate (TRITC), coumarin, fluorescein isothiocyanate (FITC), cyanine dyes (such as Cy2, Cy3, Cy5, PE-Cy5.5), lanthanide chelates (such as europium Eu 3+) ROX, JOE, APC\VIC, hexachlorofluorescein; for example, the macromolecular fluorescent group includes but is not limited to fluorescent proteins (such as phycoerythrin (PE)), intercalating dyes: ethidium bromide (EB), SYBR Green, ATTo647, ATTo565, Alexa Fluor 488. As used herein, the term "quenching group" includes one or more quenching groups selected from the group consisting of small molecule quenchers, nanomaterial quenchers, and / or combinations thereof; for example, the small molecule quenchers include but are not limited to black hole quenchers (BHQ), black hole quencher 1 (BHQ1), black hole quencher 2 (BHQ2), black hole quencher 3 (BHQ3), black hole quencher 650 (BHQ650), 4-(4-dimethylaminophenylazo)-benzoic acid (DABCYL), TAMRA, Eclipse, MGB, BHQ1; for example, the nanomaterials include but are not limited to nanocarbon materials (such as carbon nanotubes, graphene, etc.), metal nanoparticles (such as gold nanoparticles AuNP). As used herein, the term "insertion sequence" includes nucleotide sequences of any length that do not change the binding properties (such as IL-2) of constructs such as nucleic acid aptamers, molecular beacons, probes, biosensors, etc., for example, nucleotide sequences of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases in length. In some embodiments, the linker includes nucleotide sequences of any length, for example, linkers of at least 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, or more bases in length. In some preferred embodiments, a linker of 20 bases in length is preferred, for example, AAACATCAACTGTACTAATC (SEQ ID NO: 43) or a nucleotide sequence having at least 80% homology thereto. In the text, the terms "Spacer", "carbon chain spacer", "Spacer modification", or "arm modification" can be used interchangeably. In some embodiments, the Spacer includes one or more selected from the group consisting of hydrophobic Spacer C3, C6, C12, hydrophilic Spacer 9, Spacer 18, or dSpacer, PClinker, and / or combinations thereof. In some embodiments, the functionalized terminus includes one or more selected from the group consisting of hydroxyl, carboxyl, amino, or thiol modifications, and / or combinations thereof. As used herein, the term "hydrophobic group" includes one or more selected from the group consisting of dialkyl lipids, cholesterol,, thiophosphate esters, hydrophobic Spacer C3, C6, C12, and / or combinations thereof.

[0045] As used herein, the terms "sample", "specimen", "biological sample" or "sample to be tested" are used interchangeably and refer to any tissue, cell, fluid or other material from an object. In some embodiments, the sample is blood, such as serum, immune cells such as T cells, cell culture medium or the secretory microenvironment of living cells. In some embodiments, the object is a mammal, such as a human, a non-human primate (e.g., orangutan, ape), a rodent (e.g., rat, mouse, guinea pig), a pet (e.g., cat, dog), a livestock (e.g., horse, cow, sheep, pig, rabbit).

[0046] In this text, constructs such as the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. can be used in the preparation of products for IL-2 targeted diagnosis, IL-2 targeted therapy, or detecting the level of IL-2 in a sample. In some embodiments, the product is a magnetic bead or gel resin for IL-2 detection and / or purification, a reagent and / or kit for detecting the level of IL-2, a pharmaceutical composition for IL-2 targeted therapy, etc.; preferably, the product is a kit, which includes a buffer and instructions. As used herein, "kit" is generally defined as a package, assembly, or container (such as an insulated container) that includes one or more of the components or embodiments of the present application and / or other components related to the present application. Any agent or component of the kit can be provided in liquid form (e.g., solution) or in solid form (e.g., dry powder, frozen, etc.). In some cases, the kit includes one or more components, and the one or more components can be in the same container or in two or more containers, and / or in any combination thereof. The container is capable of holding liquid, and non-limiting examples include bottles, vials, cans, tubes, flasks, beakers, etc. In some cases, the container is spill-proof (when closed, the liquid cannot flow out of the container regardless of the orientation of the container). Examples of other compositions or components related to the constructs such as the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. described herein include but are not limited to: diluents, salts, buffers, chelating agents, preservatives, desiccants, antimicrobial agents, needles, syringes, packaging materials, tubes, bottles, flasks, beakers, etc., for example, for using, modifying, assembling, storing, packaging, preparing, mixing, diluting, and / or preserving the components for a specific use. In embodiments where any component is in liquid form, the liquid form can be concentrated or ready-to-use. In other embodiments, the kit can include instructions in any form provided by the kit, a website, or other sources for using the kit related to the constructs such as the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. described herein. For example, the instructions can include instructions for the use, modification, mixing, dilution, preservation, assembly, storage, packaging, and / or preparation of the components related to the kit and / or other components. In some cases, the instructions can also include instructions for the delivery of the components (e.g., transportation or storage at room temperature, sub-zero temperature, low temperature, etc.). The instructions can be provided in any form available to the user of the kit (such as written or oral (e.g., by phone), digital, optical, visual (e.g., videotape, DVD, etc.), and / or electronic communication (including Internet or web-based communication)) in any manner. Example

[0047] The present application will be further described below in conjunction with specific embodiments and the accompanying drawings. It should be understood that these embodiments are only used to illustrate the present application and not to limit the scope of the present application. Those skilled in the art can make appropriate modifications and changes to the present invention, and these modifications and changes are all within the scope of the present invention.

[0048] For the experimental methods without specific conditions indicated in the following examples, they are generally carried out under conventional conditions such as those described in the fourth edition by Michael R. Green et al., New York, Cold Spring Harbor Laboratory Press, "Molecular Cloning: A Laboratory Manual" (New York: Cold Spring Harbor Laboratory Press, 2017), or under conventional conditions, or under the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0049] Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described content can be applied to the present application. The preferred implementation methods and materials described herein are for illustrative purposes only. Example 1: Screening of IL-2 nucleic acid aptamers 1. Library construction and primer design

[0050] An ssDNA library was used for the screening of IL-2 nucleic acid aptamers. Among them, the ssDNA library and PCR primers for screening were custom synthesized by Sangon Biotech (Shanghai) Co., Ltd. (hereinafter referred to as "Sangon"). The library consists of single-stranded DNA with a length of 74 bases, with a 30-base random sequence in the middle and fixed primer sequences at both ends. The library and primer sequences used for screening are as follows: Table 1. ssDNA library for screening 5B represents the modification of the Biotin group at the 5' end. 0217-F and 0217-R-5B are used for each round of symmetric PCR to amplify and enrich the sequences and obtain the secondary library, 0217-F-5B is used for asymmetric PCR to generate ssDNA, and unmodified F and R are used for amplifying dsDNA and ligating with the T vector. 2. Connection of protein to Protein A solid-phase carrier

[0051] The recombinant proteins IL-2-Fc-His and IgG1-Fc-His with His tags were expressed using the 293T eukaryotic expression system. The plasmid for expressing IL-2-Fc-His was constructed for this experiment, and other plasmids were stored in the laboratory before. [2&3]。The vector used is the pSB plasmid independently constructed in the laboratory. This plasmid utilizes the principle of the transposon system to insert the target DNA sequence into the genome of the host cell to achieve stable transfection. Since it contains both the transposase and the transposon sequence, the operation is more convenient and the transfection efficiency is higher. The nucleic acid sequence expressing IL-2-Fc-His is shown in SEQ ID NO: 4; the corresponding amino acid sequence is shown in SEQ ID NO: 5.

[0052] To connect the protein to the Protein A solid-phase carrier, 1 mg of IL-2-Fc-His and IgG1-Fc-His were respectively mixed with 200 μL of Protein A agarose resin after removing the supernatant, and rotated overnight at 4°C. The next day, the supernatant protein concentration was detected by centrifugation to determine whether the protein was bound to the carrier. The supernatant was removed, and the precipitate was washed twice with 200 μL of Binding buffer, and finally resuspended with 500 μL of Binding buffer, aliquoted, and stored in a refrigerator at 4°C. Binding buffer was prepared by adding MgCl2 at a final concentration of 1 mM to D-PBS. 3. Systematic Evolution of Ligands by Exponential Enrichment (SELEX)

[0053] A 5-nmole random ssDNA library was used as the starting library. Before each round of screening, the library was incubated in a metal bath at 95°C for 5 min and then rapidly cooled on ice for 5 min before incubation with the target. In the first and second rounds, only IL-2-Fc-His was used for positive screening, aiming to retain the diversity of the library as much as possible and amplify the single-copy sequences that could bind. After centrifuging the fixed target to be bound and discarding the supernatant, it was incubated with the library at 37°C for a certain time, and the precipitate was washed three times with Binding buffer by centrifugation, followed by subsequent PCR and single-strandization steps. From the third round, a blank vector was added for negative screening. First, the Protein A agarose resin without bound protein was incubated with the library to remove the sequences non-specifically adsorbed to the carrier, and the supernatant after that was then incubated with IL-2-Fc-His. From the fifth round, IgG1-Fc-His was used as counter-screening to remove the sequences that bind to the Fc fragment and 6His. All incubations were carried out at 37°C, and the screening pressure was increased in each round by changing the protein dosage, incubation time, washing times, and intensity, so that the sequences specifically binding to IL-2 were enriched.

[0054] The screening conditions set for each round are shown in Table 2 below. Table 2. Screening conditions set for each round 4. Monitoring the library screening process by ELONA method

[0055] Asymmetric PCR amplification of the 2nd, 4th, 5th, 6th, 7th and 8th rounds of dsDNA was performed using forward primers modified with Biotin, and ELONA was performed to monitor the enrichment of the library.

[0056] After generating dsDNA by symmetric PCR, prepare 200 μL of asymmetric PCR system. Table 3. Asymmetric PCR amplification

[0057] The reaction procedure was 95°C pre-denaturation for 3 min; 95°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 30 s, amplification for 30 cycles; and finally 72°C extension for 30 s, 4°C maintenance. The product was purified by ethanol sodium acetate precipitation for ELONA.

[0058] One day in advance, 96-well ELISA plates were coated with recombinant human IL-2 for injection (Beijing Shuanglu, hereinafter referred to as "commercial IL-2" to distinguish it from IL-2 expressed in the laboratory), IL-2-Fc-His, IgG1-Fc-His, IgG1-Fc and BSA. 2500IU of commercial IL-2 was added to each well, and 2μg of other proteins were added to each well, and the plates were left to stand overnight at 4°C. The next day, the plates were washed five times with a PBST solution containing 0.5% Tween20 and 1mM MgCl2. 100μL of 1.5% BSA was added to block at 37°C for 1h, and then washed 5 times. Then, 100μL of 200nM nucleic acid solution was incubated at 37°C for 1h, and then HRP-modified streptavidin secondary antibody was added. The plates were bound at 37°C for 30min, and TMB was used for color development and the absorbance at 650nm was detected. 5. Enriched library for cloning sequencing and verification

[0059] The screening libraries obtained in the sixth and seventh rounds were amplified with dsDNA using unmodified primers, connected to the T vector and sent to the company for sequencing. The sequencing results were analyzed for homology, and the enriched sequences were synthesized by the company with Biotin-modified ssDNA, and the binding with IL-2 was detected by ELONA. The specifically binding sequences were further truncated and optimized and verified by synthesis.

[0060] Discussion and Analysis

[0061] Screening of IL-2 nucleic acid aptamers using an ssDNA library, with IL-2-Fc-His as the positive screen and protein A vector or IgG1-Fc-His as the negative screen, for a total of 8 rounds of screening. At the 6th round, the screening process was monitored. IL-2-Fc-His, IgG1-Fc-His, IgG1-Fc, BSA, and commercially purchased IL-2 were coated on the bottom of a 96-well ELISA plate. Asymmetric PCR was used to obtain the ssDNA libraries of the 2nd, 4th, 5th, and 6th rounds and ELONA was performed. The results showed that the binding of the library to IL-2 and IL-2-Fc-His began to increase from the fifth round ( Figure 1 A). Two more rounds of screening were continued. The ELONA results showed that the binding of the library to IL-2 remained basically unchanged, but the binding to IgG1-Fc-His gradually increased ( Figure 1 B). The agarose gel electrophoresis images of the optimized library cycle numbers from rounds 5 - 8 are shown in Figure 1 C, and it can be seen that non-target heterobands began to show obvious amplification from the seventh round.

[0062] The libraries of the sixth and seventh rounds were selected for the next step of cloning and sequencing. After the library was ligated to the T vector, it was transformed and plated, and the bacterial plates were sent to the company for sequencing. 40 clones were selected from each of the two rounds and submitted to the supplier for sequencing. Multiple sequence alignment and homology analysis were performed on the results, and 10 enriched sequences were obtained and truncated and optimized as follows: Table 4. Enriched sequences

[0063] The binding ability of the above 10 sequences was detected by ELONA, and the results are shown in Figure 2 . Except for sequences 4 and 38, all can bind to IL-2 and IL-2-Fc-His. Among them, 1 is a heteroband, and among the other sequences, 8, 24, and 35 have relatively high specificity. Therefore, these three sequences were selected for the next step of truncation optimization and verification.

[0064] We used the DNA Secondary Structure Predictor tool on the website of Yunzhou Biosciences to predict the secondary structures of the three sequences, and on this basis, truncated and optimized them, minimizing the number of bases as much as possible while maintaining a specific conformation to reduce production costs. The truncated sequences are shown in the following table, and the secondary structure predictions of each sequence before and after truncation are shown in Figure 3 . Table 5. Truncated sequences

[0065] Further analysis of the core sequences after sequence truncation, based on the existing experience in the laboratory, determined that the core sequences of the truncated sequences are respectively:

[0066] Apt8-core (TCGTTCGGGACTGCTCGGGATTGCGGATA: SEQ ID NO: 21);

[0067] Apt24-core (CGTCACTCTGCTTTGGAAGTGCTGGTTGTGTGATG: SEQ ID NO: 22);

[0068] Apt35-core (CCACTAGAGGGCCTGCTCTGGATTGCGTAACGGGTAGTGG: SEQ ID NO: 23). Example 2: Prokaryotic System Protein Expression and Purification

[0069] Considering that a large amount of IL-2 is required for subsequent experiments, and the purchased IL-2 contains other components such as human serum albumin, this project reconstructed the plasmid expressing IL-2 and produced recombinant IL-2 with only His-tag without other fragments using the prokaryotic expression system. The core sequence of protein expression is shown in SEQ ID NO: 24; the corresponding amino acid sequence is shown in SEQ ID NO: 25.

[0070] Since both IL-2 and IL-15 are members of the γc receptor cytokine family, have common receptor subunits IL-2 / 15Rp (CD122) and IL-2Rγ (CD132), and are structurally similar, it is necessary to investigate the specificity of the binding of nucleic acid aptamers to the two.

[0071] The recombinant plasmid IL-2-6H (the core sequence for protein expression is SEQ ID NO: 26, and the corresponding amino acid sequence is SEQ ID NO: 27), as well as IL-2-catch-6H (the core sequence for protein expression is SEQ ID NO: 28, and the corresponding amino acid sequence is SEQ ID NO: 29) and IL-15-catch-6H (the core sequence for protein expression is SEQ ID NO: 30, and the corresponding amino acid sequence is SEQ ID NO: 31) plasmids stored in the laboratory were transferred into BL21 Escherichia coli for expression. Single colonies were picked and inoculated into 6 mL of kanamycin-resistant LB medium, and cultured with shaking at 37 °C and 220 rpm overnight. The next day, the culture was expanded at a ratio of 1:100 and continued to be shaken for 3 - 6 h until the OD600 value was about 0.6. IPTG with a final concentration of 0.5 mM was added, and induction was carried out overnight at 16 °C and 200 rpm. The next day, the bacterial solution was transferred to a 50 mL centrifuge tube, centrifuged at 3500 rpm for 7 min, and the supernatant was discarded. An appropriate amount of PBS was added to wash the bacterial cells, and after centrifugation again, the supernatant was discarded. The cells were resuspended in 20 mL of PBS solution containing 6 M urea. Then, the bacterial cells were lysed at low temperature using an ultrasonic crusher: during ultrasonication, the centrifuge tube was inserted into an ice-water mixture, the power was adjusted to 30%, and it was sonicated for 5 s, paused for 3 s, and sonicated for 20 min. At this time, the solution could be seen to become clear. After all the bacteria were completely lysed, an imidazole solution with a final concentration of 20 mM was added, and the bacterial cell debris was precipitated by centrifugation at 4 °C and 4000 rpm for 7 min. Nickel agarose purification resin was used to purify the protein. Gradient elution was carried out using imidazole solutions with different concentrations, and SDS-Page electrophoresis and Coomassie brilliant blue staining were performed on the eluted liquid to determine the concentration of the concentrate. The molecular weight of IL-2-6H is about 17 kDa, and a 3 kDa protein concentrator tube was used for concentration. The molecular weights of IL-2-catch-6H and IL-15-catch-6H are about 35 kDa, and a 10 kDa protein concentrator tube was used for concentration. The purified protein was electrophoresed using a 15% SDS-Page gel to verify the protein size and purity, and the results are as Figure 4 shown. Example 3: Protein Quantification by BCA Method

[0072] The concentration of the obtained IL-2-6H was detected using the BCA method. According to the number of samples, the required BCA working solution was prepared at 50 volumes of reagent A: 1 volume of reagent B, and stored at room temperature after sufficient mixing. The protein standard 0.5 mg / mL was added to a 96-well plate at a volume of 0, 1, 2, 4, 8, 12, 16, and 20 μL, and PBS was added to 20 μL, with the final concentrations corresponding to 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mg / mL, respectively. Take 20 μL of the protein to be tested and add it to a 96-well plate, add 200 μL of BCA working solution to each well, react at 37°C for 30 minutes, and read the absorbance at 562 nm with an enzyme reader. Draw a standard curve based on the absorbance of the standard, and calculate the concentration of the sample to be tested. Example 4: Analysis of specificity and affinity of nucleic acid aptamers binding to IL-2

[0073] We ordered synthetic aptamers with biotin modification and truncated optimization from Sangon, and used ELONA to detect the specificity of each sequence to IL-2. The sequence information is shown in the table below. Table 6. Modified and optimized nucleic acid aptamers

[0074] Commercial IL-2 was used, 2500 IU per well was coated, and different concentrations of nucleic acid aptamers were combined to detect the absorbance at 650 nm to calculate the equilibrium dissociation constant.

[0075] The optimized sequences Apt8-1, 8-2, 24-1, 24-2, and 35 were specifically characterized to detect affinity. 2500 IU of commercial IL-2, 2 μg of IL-2-Fc-His, IgG1-Fc-His, and BSA were coated on a 96-well ELISA plate, and 100 μL of 200 nM biotin-modified aptamers were added for detection. The results showed that 8-2, 24-2, and 35 had better specificity, while 8-1 and 24-1 also had a certain binding to IgG1-Fc-His ( Figure 5 A). The affinity of the three sequences was tested using commercial IL-2. Apt35 had the highest affinity, followed by 24-2 ( Figure 5 B). Example 5: Specificity of nucleic acid aptamers for IL-2 and IL-15

[0076] As mentioned above, IL-2 and IL-15 are both members of the γc receptor cytokine family, and have common receptor subunits IL-2 / 15Rβ (CD122) and IL-2Rγ (CD132), which are structurally similar. Therefore, it is necessary to examine the specificity of nucleic acid aptamers binding to the two.

[0077] As described in the above embodiments, ELONA was used to detect the binding of Apt8-2, 24-2, 35 to three proteins. The results showed that Apt24-2 and Apt35 could specifically bind to IL-2 but not to IL-15, while Apt8-2 had a weak binding to IL-15( Figure 6 ), and Apt24-2 (abbreviated as Apt24) and Apt35 were used for subsequent experiments. Example 6: Detection of IL-2 Concentration in Solution by Nucleic Acid Aptamer Molecular Probe

[0078] Apt24 and Apt35 were modified to construct nucleic acid aptamer molecular beacons for rapid detection of IL-2 concentration in solution. 6-FAM and BHQ1 were modified at the 5' end and 3' end of the sequence respectively. The above nucleic acid aptamer molecular beacons were synthesized by Shanghai Saiheng Biotechnology Co., Ltd. (abbreviated as "Saiheng"), and the sequences are shown in the following table. Table 7. Nucleic Acid Aptamer Molecular Beacons Constructed by Modification

[0079] The synthesized probe dry powder was centrifuged at 12,000 rpm for 1 min first, and an appropriate amount of Binding buffer was added to dissolve it into 10 μM. Before use, it was placed in a metal bath at 95 °C for 5 min and immediately cooled on ice for 5 min. For the detection of recombinant protein samples, 50 μL of 40 μg / mL recombinant protein solution was added to a 96-well plate, and then 50 μL of probe solution was added to make the final concentration of the probe 50 nM. After incubating in the dark at room temperature for 10 min, the fluorescence intensity at 485 / 528 nm was detected by a microplate reader. For the detection of recombinant cytokines, 1 μg of cytokine was added to each well of a 96-well plate, the final concentration of the probe was 50 nM, the reaction system was 100 μL, and after incubating in the dark at room temperature for 10 min, it was detected by a microplate reader.

[0080] The data were expressed as mean ± standard deviation, with three replicates set for each group, and GraphPad Prism 9.0 software was used for analysis and graphing. Unpaired t-test was used for comparison between two groups, and One-way ANOVA test was used for comparison of three groups and above. p < 0.05 indicated that the data had statistical differences.

[0081] When IL-2 was present in the solution, the binding of the nucleic acid aptamer to IL-2 caused a conformational change, and fluorescence could be detected. The detection ability of the probe was verified using each recombinant protein produced, and the results showed that it could better distinguish the protein with IL-2 and the control protein( Figure 7 A and B). The detection of different concentrations of IL-2-6H showed that as the protein concentration increased, the detected fluorescence value also increased and was linear within a certain range, and thus the IL-2 concentration could be quantified( Figure 7 C).

[0082] In addition, we detected a variety of recombinant human cytokines (TGF-β, IL-6, IGF-1, VCAM-1) stored in the laboratory. We used Apt24-MB and Apt35-MB to detect IL-2 and other human cytokines. The final concentration of the cytokines was 10 μg / mL, and the relative fluorescence intensity (%) was calculated as follows: (fluorescence intensity of each well - background fluorescence intensity) / [(average fluorescence intensity of (IL-2 fluorescence intensity - background fluorescence intensity))] x 100. The results showed that the probes also had high resolution ability for IL-2 ( Figure 8 ).

[0083] Since IL-2 exerts its effects through paracrine or autocrine pathways, the inflammatory state of the body or the impact of treatment factors on the immune system can be judged by detecting the level of IL-2 in samples such as peripheral blood in clinical or scientific research. We also verified the detection ability of the two probes for cytokines in serum with different contents of FBS solution. IL-2-6H, BSA, and PBS were diluted with Binding buffer solution containing different proportions of FBS, and molecular beacon probes were added for detection, so that the final concentration of FBS was 0%, 10%, 20%, and 50%. F0 represents the average fluorescence intensity of the PBS group at this ratio. The results showed that even in an environment of 50% FBS, the two MABs still maintained the detection ability for IL-2 ( Figure 9 ).

[0084] In summary, the inventors screened two ssDNA aptamers with high specificity and affinity for human IL-2: Apt24 and Apt35, among which the binding Kd value of Apt35 was about 66 nM. Transforming the two sequences into nucleic acid aptamer molecular beacons can be used for the rapid detection of IL-2 in solution. Although there is a non-specific increase in fluorescence for some irrelevant proteins, it can be distinguished from the IL-2 group, and the two probes still maintain good performance in an environment of high-concentration serum, providing tools for IL-2 targeted diagnosis, IL-2 targeted therapy, or detecting the level of IL-2 in samples (such as blood, such as serum, immune cells such as T cells, cell culture medium, or the microenvironment secreted by living cells).

[0085] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the described embodiments. Those skilled in the art can make various equivalent variations or substitutions without departing from the spirit of the present invention, and these equivalent variations or substitutions are all included within the scope defined by the claims of this application. References 1. Momeni M, Mashayekhi K, Navashenaq J G, et al. Identification of G - quadruplex anti - Interleukin - 2 aptamer with high specificity through SELEX stringency[J]. Heliyon, 2022, 8(6): e09721. 2. Zheng W W, Yang L T, Zhou H, et al. A novel aptamer beacon for rapid screening of recombinant cells and in vivo monitoring of recombinant proteins[J] Applied microbiology and biotechnology, 2023, 107(2 - 3): 553 - 67. 3. Zhou H, Abudureheman T, Zheng W W, et al. CAR - Aptamers Enable Traceless Enrichment and Monitoring of CAR - Positive Cells and Overcome Tumor Immune Escape[J]. Advanced science (Weinheim, Baden - Württemberg, Germany), 2023: e2305566.

Claims

1. A nucleic acid aptamer that binds to interleukin-2 (IL-2), wherein: The nucleic acid aptamer comprises a nucleotide sequence selected from the following group or a nucleotide sequence having at least 80% homology with any nucleotide sequence selected from the following group: Apt8-1 (SEQ ID NO: 16); Apt8-2 / Apt8-core (SEQ ID NO: 17); Apt24-1 (SEQ ID NO: 18); Apt24-2 (SEQ ID NO: 19); Apt35 (SEQ ID NO: 20); Apt24-core (SEQ ID NO: 22); and / or Apt35-core (SEQ ID NO: 23).

2. The nucleic acid aptamer according to claim 1, wherein The nucleic acid aptamer is a modified nucleic acid aptamer, wherein the modification comprises one or more modifications selected from the group consisting of at least one modified sugar moiety, at least one modified internucleoside bond, at least one modified nucleotide, at least one terminal modification, at least one spacer modification, and combinations thereof; For example, wherein the at least one modified sugar moiety includes, but is not limited to, 2'-O-methoxyethyl (2'-OH) modified sugar moieties, 2'-methoxy modified sugar moieties, 2'-O-alkyl modified sugar moieties, bicyclic sugar moieties, 2'-OH modified sugar moieties, fluorine substituted modified sugar moieties, and combinations thereof; For example, the at least one modified internucleoside linkage includes, but is not limited to, phosphorothioates, alkyl phosphonates, phosphorodithioates, alkyl phosphonothioates, phosphoramidates, carbamates, carbonates, phosphotriesters, acetamidoesters, carboxymethyl esters, and combinations thereof; For example, the at least one modified nucleotide includes, but is not limited to, peptide nucleic acid (PNA), locked nucleic acid (LNA), arabinose-nucleic acid, derivatives of peptide nucleic acid (PNA), derivatives of locked nucleic acid (LNA), derivatives of arabinose-nucleic acid, and combinations thereof; For example, the at least one terminal modification includes but is not limited to a poly-T sequence (T-strand) modified terminal, a PEG-modified terminal, a fluorescent group-modified terminal, a quenching group-modified terminal, an affinity tag (e.g., biotin, digoxin, etc.) modified terminal, a phosphorylation-modified terminal, a hydrophobic group (e.g., diacyl lipid, cholesterol, etc.) modified terminal, an amino-modified terminal, a linker-modified terminal, a Spacer (e.g., C3Spacer, Spacer 18) modified terminal, an inserted sequence-modified terminal, a functionalized terminal, or a combination thereof; For example, the at least one spacer modification includes but is not limited to a non-terminal region modified with a fluorescent group, a non-terminal region modified with a quenching group, a non-terminal region modified with an affinity tag (e.g., biotin, digoxin, etc.), a non-terminal region modified with a hydrophobic group (e.g., diacyl lipid, cholesterol, etc.), a non-terminal region modified with a complementary sequence (e.g., a neck modified with a complementary sequence (C-strand)), a non-terminal region modified with a Spacer (e.g., C3 Spacer, Spacer 18), a non-terminal region modified with an insertion sequence, or a combination thereof.

3. The nucleic acid aptamer according to any one of the preceding claims, wherein The nucleic acid aptamer further comprises one or more parts selected from the group consisting of a fluorescent group, a quenching group, an insertion sequence, a linker, a spacer, a functionalized end and / or a combination thereof; For example, the fluorescent group is located at the 5' end, 3' end or non-terminal region of the nucleic acid aptamer, at the 5' end, 3' end or non-terminal region of other parts, and / or between the nucleic acid aptamer and other parts; For example, the quencher group is located at the 5' end, 3' end or non-terminal region of the nucleic acid aptamer, at the 5' end, 3' end or non-terminal region of other parts, and / or between the nucleic acid aptamer and other parts; For example, the insertion sequence is located at the 5' end, 3' end or non-terminal region of the nucleic acid aptamer, at the 5' end, 3' end or non-terminal region of other parts, and / or between the nucleic acid aptamer and other parts; For example, the linker is located at the 5' end, 3' end or non-terminal region of the nucleic acid aptamer, at the 5' end, 3' end or non-terminal region of the other part, and / or between the nucleic acid aptamer and other parts; For example, the Spacer is located at the 5' end, 3' end or non-terminal region of the nucleic acid aptamer, at the 5' end, 3' end or non-terminal region of other parts, and / or between the nucleic acid aptamer and other parts.

4. The nucleic acid aptamer according to claim 3, wherein The fluorescent group includes one or more fluorescent groups selected from the following group: small molecule fluorescent groups, nanomaterials, quantum dots, macromolecular fluorescent groups and / or combinations thereof; for example, the small molecule fluorescent groups include but are not limited to 6-carboxyfluorescein (6-FAM), tetraethylrhodamine, 5-carboxytetramethylrhodamine (5-TAMRA), tetramethylrhodamine isothiocyanate (TRITC), coumarin, fluorescein isothiocyanate (FITC), cyanine dyes (such as Cy2, Cy3, Cy5, PE-Cy5.5), lanthanide chelates (such as europium Eu 3+ ), ROX, JOE, APC\VIC, hexachlorofluorescein; for example, the macromolecular fluorescent group includes but is not limited to fluorescent protein (e.g., phycoerythrin (PE)), embedded dye: ethidium bromide (EB), SYBRGreen, ATTO647, ATTO565, Alexa Fluor488; and / or The quenching group includes one or more quenching groups selected from the following group: small molecule quenchers, nanomaterial quenchers and / or combinations thereof; for example, the small molecule quenchers include but are not limited to black hole quenchers (BHQ), black hole quenchers 1 (BHQ1), black hole quenchers 2 (BHQ2), black hole quenchers 3 (BHQ3), black hole quenchers 650 (BHQ650), 4-(4-dimethylaminophenylazo)-benzoic acid (DABCYL), TAMRA, Eclipse, MGB, BHQ1; for example, the nanomaterials include but are not limited to nanocarbon materials (such as carbon nanotubes, graphene, etc.), metal nanoparticles (e.g., gold nanoparticles AuNP); and / or The inserted sequence includes a nucleotide sequence of any length that does not change the IL-2 binding property of the nucleic acid aptamer, for example, a nucleotide sequence of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 bases in length; and / or The linker comprises a nucleotide sequence of any length, for example, a linker of at least 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70 or more bases in length; preferably a linker of 20 bases in length, for example, AAACATCAACTGTACTAATC (SEQ ID NO: 43) or a nucleotide sequence having at least 80% homology thereto; and / or The Spacer comprises one or more selected from the following group: hydrophobic Spacer C3, C6, C12, hydrophilic Spacer 9, Spacer 18 or dSpacer, PC linker and / or a combination thereof; and / or The functionalized end comprises one or more selected from the group consisting of: hydroxyl, carboxyl, amino or thiol modification and / or a combination thereof; Preferably, the 5' end of the nucleic acid aptamer includes a fluorescent group and the 3' end includes a quencher group; more preferably, the 5' end of the nucleic acid aptamer includes 6-carboxyfluorescein (6-FAM) and the 3' end includes black hole quencher 1 (BHQ1).

5. The nucleic acid aptamer according to claim 2, wherein the nucleic acid aptamer binding to IL-2 forms a secondary structure through base complementary pairing, and the secondary structure includes but is not limited to a hairpin structure, a stem-loop structure, a pseudoknot, a G-quadruplex, and the like.

6. A molecular beacon for detecting IL-2, comprising the nucleic acid aptamer according to any one of the preceding claims; preferably, the molecular beacon further comprises a fluorescent group and a quenching group; more preferably, the molecular beacon nucleotide sequence is SEQ ID NO: 37 or SEQ ID NO:

38.

7. A preparation comprising the nucleic acid aptamer and / or nucleic acid aptamer molecular beacon according to any one of the preceding claims; for example, magnetic beads or gel resins for IL-2 detection and / or purification, reagents and / or kits for detecting IL-2 levels, pharmaceutical compositions for IL-2 targeted therapy, etc.

8. Use of the nucleic acid aptamer and / or nucleic acid aptamer molecular beacon according to any one of the preceding claims in the preparation of a product for IL-2 targeted diagnosis, IL-2 targeted therapy or detection of IL-2 levels in a sample; For example, the sample is blood, such as serum, immune cells such as T cells, cell culture fluid or secretory microenvironment of living cells; and / or The subject is a mammal, such as a human, a non-human primate (e.g., an ape), a rodent (e.g., a rat, a mouse, a guinea pig), a pet (e.g., a cat, a dog), or a livestock (e.g., a horse, a cow, a sheep, a pig, a rabbit); and / or For example, the product is a magnetic bead or gel resin for IL-2 detection and / or purification, a reagent and / or kit for detecting IL-2 levels, a pharmaceutical composition for IL-2 targeted therapy, etc.; preferably, the product is a kit comprising other compositions or components and / or instructions.

9. A method for detecting IL-2, comprising: a) mixing the nucleic acid aptamer, nucleic acid aptamer molecular beacon and / or product according to any one of the preceding claims with a sample to be tested; b) measuring the level of IL-2 in the sample; For example, the sample is blood, such as serum, immune cells such as T cells, etc., cell culture fluid or secretory microenvironment of living cells.

10. A construct for screening IL-2 nucleic acid aptamers, wherein the core sequence of protein expression of the construct is selected from the group consisting of SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28 or SEQ ID NO: 30; and / or The amino acid sequence of the protein expressed by the construct is selected from the group consisting of SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29 or SEQ ID NO:31.

Images