Nucleic acid aptamer combined with CD122 protein, screening method and application of nucleic acid aptamer

Abstract

The invention discloses a nucleic acid aptamer combined with CD122 protein, a screening method and application of the nucleic acid aptamer, and belongs to the technical field of biology. A series of nucleic acid aptamers capable of being efficiently combined with CD122 protein are obtained through screening of a magnetic bead SELEX technology, the sequence still keeps high affinity and specificity after being truncated and optimized, and the nucleic acid aptamers can be used in the aspects of detection, treatment or drug delivery and the like. The nucleic acid aptamer screened by the invention is a novel targeting small molecule, has the advantages of small molecular weight, high sensitivity, good stability, easiness in synthesis and modification and the like, and has a wide application prospect in the aspect of targeting combination with CD122 protein.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a nucleic acid aptamer that binds to the CD122 protein, a screening method thereof, and applications thereof. Background Art

[0002] Interleukin-2 (IL-2) is a cytokine produced by activated T cells and has important immunomodulatory functions. IL-2 exerts its pleiotropic activities by binding to different receptor complexes, and the main cell surface receptors targeted are: alpha chain (IL-2Rα), beta chain (IL-2Rβ), and gamma chain (γc). Among them, when IL-2Rα binds to IL-2 alone, it shows low affinity and does not participate in signal transduction; the heterodimer formed by IL-2Rβ and γc binds to IL-2 with medium affinity and is mainly expressed on the surface of NK cells, macrophages, and resting T cells; while the trimeric complex composed of IL-2Rα, IL-2Rβ, and γc binds to IL-2 with high affinity and is the main receptor binding form on activated T cells.

[0003] IL2Rβ, also known as CD122, has been shown to be related not only to T cell expansion but also to T cell exhaustion; in phase II / III clinical trials of patients with advanced solid tumors, it has been shown to be a therapeutic target related to immune checkpoint blockade. Some studies have shown that the CD122 gene is a potential target gene for anti-tumor drugs such as Denileukin diftitox, Aldesleukin, and Daclizumab, and CD122 plays an indispensable role in tumorigenesis, tumor metabolism, and immunity. Therefore, it is an important target gene for tumor-targeted therapy and tumor immunotherapy. In addition, CD122 is also a biomarker in most solid tumors, and its content in pan-cancer is higher compared to non-tumor tissues. In most tumor types, high expression of CD122 is associated with poor prognosis, indicating that CD122 plays a key role in tumorigenesis, tumor proliferation, and tumor metastasis.

[0004] Aptamers are short single-stranded RNA (ssRNA) or DNA (ssDNA) molecules generated by SELEX (Systematic Evolution of Ligands by Exponential Enrichment). Due to their high binding affinity and specificity, they show great potential in medical treatment and diagnosis. High-affinity nucleic acid ligands can be used to judge the occurrence and development of tumors by binding to intracellular or extracellular cancer biomarkers. Aptamers themselves can also be used as immunotherapeutic agents, such as CTLA-4, PD-1, and PD-L1 aptamers of immune checkpoints reported for tumor immunotherapy. Given the characteristics of aptamer therapy in screening, manufacturing, stability, and rapid tissue penetration, immune checkpoint aptamer inhibitors provide a unique opportunity for the development of cancer immunotherapy as an alternative to the current mainstream antibody therapy.

[0005] As a potential target for cancer immunotherapy, the interleukin-2 receptor (IL-2R) has received extensive attention in recent years. However, the research on nucleic acid aptamers targeting IL-2R is still in its infancy, and there are few related reports. Summary of the Invention

[0006] Aiming at the deficiencies of the prior art, the purpose of the present invention is to provide a nucleic acid aptamer that binds to CD122 protein, a screening method, and its applications.

[0007] In the first aspect, the present invention provides a nucleic acid aptamer that binds to CD122 protein, including a nucleotide sequence shown in any one of SEQ ID NO.1 to SEQ ID NO.6, and the nucleotide sequence can specifically bind to CD122 protein.

[0008] In some preferred embodiments, the nucleotide sequence has at least 25% homology with any one of SEQ ID NO.1 to SEQ ID NO.6.

[0009] In some preferred embodiments, the nucleotide sequence is an RNA sequence transcribed from the nucleotide sequence shown in any one of SEQ ID NO.1 to SEQ ID NO.6.

[0010] Deleting or adding partial sequences to the nucleotide sequence of the nucleic acid aptamer, which still has high affinity for CD122 protein, is also within the protection scope of the present invention.

[0011] In some preferred embodiments, modifying the nucleotide sequence still has high affinity for CD122 protein.

[0012] In some preferred embodiments, the modification comprises at least one of the following methods: 1) Group modification: fluorescent or quenching group, amino group, carboxyl group, aldehyde group, mercapto group, azide; 2) Nucleotide variant modification: phosphorylation, thiolation modification, 2-aminopurine substitution modification, deoxyuridine (dU) modification, 3'-end inverted dT / dG modification, locked nucleic acid modification, 2-methoxy modification, peptide nucleic acid; The modified nucleic acid aptamer still has the function of specifically binding to the CD122 protein.

[0013] In a second aspect, the present invention also provides a method for screening a nucleic acid aptamer that binds to the CD122 protein, comprising the following steps:

[0014] (1) Synthesize a random single-stranded DNA library and primers;

[0015] (2) Screening by magnetic bead method: A batch of nucleic acid aptamers with high affinity for binding to the CD122 protein are obtained by screening with Protein G magnetic beads;

[0016] (3) High-throughput sequencing and sequence analysis.

[0017] In some preferred embodiments, in step (1), based on the SELEX technology, a random single-stranded DNA library and corresponding primers are synthesized.

[0018] In some preferred embodiments, in step (2), the CD122 protein with an IgG1-FC tag is immobilized by Protein G magnetic beads, and at least 8 rounds of screening are carried out. From the second round, the magnetic beads and the control protein are screened in reverse, and fetal bovine serum (FBS) is added starting from the 7th round; The purpose of adding FBS is to increase the specificity of the screening and better adapt to the downstream detection environment for later development and application.

[0019] In some specific embodiments, 10% serum is added in the 7th round and 15% serum is added in the 8th round.

[0020] In some preferred embodiments, in step (2), the nucleic acid aptamer is any one of CA001 (SEQ ID NO.1), CA001-S1 (SEQ ID NO.2), CA006 (SEQ ID NO.3), CA006-S1 (SEQ ID NO.4), CA015 (SEQ ID NO.5) and CA015-S1 (SEQ ID NO.6);

[0021] Among them, CA001-S1 is obtained by truncating the nucleic acid aptamer of CA001 to 35 nucleotides, CA006-S1 is obtained by truncating the nucleic acid aptamer of CA006 to 29 nucleotides, and CA015-S1 is obtained by truncating the nucleic acid aptamer of CA015 to 40 nucleotides; the truncated forms screened in the present invention are all optimized sequences after testing, and some of them even have a several-fold increase while basically maintaining the original affinity; other possible truncated forms that have not been tested should also be within the protection scope of the present invention.

[0022] Specifically, the nucleic acid aptamer with the nucleotide sequence shown in SEQ ID NO.2 is obtained by truncating from the nucleotide sequence shown in SEQ ID NO.1; the nucleic acid aptamer with the nucleotide sequence shown in SEQ ID NO.4 is obtained by truncating from the nucleotide sequence shown in SEQ ID NO.3; the nucleic acid aptamer with the nucleotide sequence shown in SEQ ID NO.6 is obtained by truncating from the nucleotide sequence shown in SEQ ID NO.5.

[0023] In some preferred embodiments, in step (3), by analyzing the G-quadruplex, secondary structure and tertiary structure of the nucleic acid aptamer on the sequencing results provided by the sequencing company, the best structure simulated by the computer is used to verify more possible binding aptamers.

[0024] In a third aspect, the present invention also provides a conjugate of a nucleic acid aptamer, which is formed by connecting a signal molecule or an active molecule to the nucleic acid aptamer.

[0025] In some preferred embodiments, one or more of a radioactive substance, a therapeutic substance, a protein, a sugar residue, a lipid, siRNA, miRNA, a nanomaterial, biotin, digoxin, and a vitamin are connected to the nucleic acid aptamer, so that the resulting nucleic acid aptamer after the reaction has the property of specifically binding to the CD122 protein.

[0026] The present invention also provides the application of the nucleic acid aptamer and its conjugate in any one of the following:

[0027] S1. Detecting and purifying the CD122 protein;

[0028] S2. Imaging of the CD122 protein;

[0029] S3. Preparing a drug targeted to the CD122 protein;

[0030] S4. Multifunctional aptamer.

[0031] In some specific applications, products using the nucleic acid aptamer and its conjugate for detecting and purifying CD122 protein include any one or more of kits, molecular probes, detection chips, etc.

[0032] In some specific applications, the nucleic acid aptamer and its conjugate are used as inhibitors of CD122 protein; or drugs for diagnosing and treating abnormal CD122 expression, or drugs for activating the function of immune cells.

[0033] In some specific applications, the multifunctional aptamer is formed by coupling a nucleic acid aptamer and / or a conjugate of a nucleic acid aptamer with other nucleic acid aptamers to form a new bispecific nucleic acid aptamer or multimer.

[0034] Advantageous technical effects of the present invention:

[0035] The present invention provides a series of nucleic acid aptamers capable of specifically binding to CD122 protein. After modification, this sequence still maintains high affinity and specificity and can be used in aspects such as detection, treatment, or drug delivery.

[0036] The nucleic acid aptamers screened in the present invention can specifically bind to CD122 protein with high affinity. They are a novel type of targeting small molecule, having advantages such as small molecular weight, high sensitivity, good stability, easy synthesis and modification, etc., and having broad application prospects in targeting and binding CD122 protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 It is for monitoring the enrichment of the screened library in each round binding to CD122 protein by flow cytometry in Example 1;

[0038] Figure 2 It is for detecting the binding of the screened nucleic acid aptamer to CD122 protein by flow cytometry in Example 2;

[0039] Figure 3 It is for detecting the affinity of the candidate nucleic acid aptamer SEQ ID No.1 and its truncated form to CD122 protein by BLI in Example 3;

[0040] Figure 4 It is for detecting the affinity of the candidate nucleic acid aptamer SEQ ID No.3 and its truncated form to CD122 protein by BLI in Example 3;

[0041] Figure 5 It is for detecting the affinity of the candidate nucleic acid aptamer SEQ ID No.5 and its truncated form to CD122 protein by BLI in Example 3;

[0042] Figure 6To implement the affinity detection of the random control chain and buffer with CD122 protein in Example 3;

[0043] Figure 7 To determine the KD values of the nucleic acid aptamers SEQ ID No.1 and SEQ ID No.2 binding to CD122 protein respectively in Example 4;

[0044] Figure 8 To determine the KD values of the nucleic acid aptamers SEQ ID No.3 and SEQ ID No.4 binding to CD122 protein respectively in Example 4;

[0045] Figure 9 To determine the KD values of the nucleic acid aptamers SEQ ID No.5 and SEQ ID No.6 binding to CD122 protein respectively in Example 4;

[0046] Figure 10 To obtain the affinity detection results of the nucleic acid aptamers SEQ ID No.1 - SEQ ID No.6 with IgG1 - FC protein respectively in Example 5;

[0047] Figure 11 To obtain the affinity detection results of the nucleic acid aptamers SEQ ID No.1 - SEQ ID No.6 with CD25 protein respectively in Example 5;

[0048] Figure 12 To obtain the affinity detection results of the nucleic acid aptamers SEQ ID No.1 - SEQ ID No.6 with CD132 protein respectively in Example 5;

[0049] Figure 13 To detect the binding results of SEQ ID No.1, SEQ ID No.3 and SEQ ID No.5 with CHO cells overexpressing CD122 protein by flow cytometry in Example 6. Detailed implementation mode

[0050] The present invention is described in detail below through specific examples. The experimental methods in the following examples are all conventional methods unless otherwise specified. The medicinal material raw materials, reagent materials, etc. used in the following examples are all commercially available products unless otherwise specified.

[0051] The present invention is further described below through examples and drawings.

[0052] Example 1: Screening of nucleic acid aptamers binding to CD122 protein

[0053] The method for screening ssDNA nucleic acid aptamers binding to CD122 protein in this example includes the following steps:

[0054] 1. Based on SELEX technology, synthesize the random single-stranded DNA library and primers shown in the following sequences:

[0055] Random single-stranded DNA library:

[0056] 5'-TTACGTCAAGGTGTCACTCC-N(40)-GAAGCATCTCTTTGGCGTG-3';

[0057] It includes primer sequences fixed at the 5' end and 3' end and a random sequence of 40 bases in the middle.

[0058] Library amplification primers:

[0059] Forward primer: 5'-FAM-TTACGTCAAGGTGTCACTCC-3';

[0060] Reverse primer: 5'-Biotin-CACGCCAAAGAGATGCTTC-3';

[0061] Both the library and primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0062] 2. Screening by Protein G magnetic bead method:

[0063] The magnetic bead method was used for screening, and a total of eight rounds of screening were carried out. The screening conditions for each round are shown in Table 1:

[0064] Table 1 Optimization of screening conditions for CD122 protein aptamers

[0065]

[0066] The specific screening method is as follows:

[0067] 2.1 Protein immobilization: Take 10 μl of Protein G magnetic beads (Tiandi Renhe Biology), wash them twice with 100 μl of DPBS (Solarbio) containing 0.02% Tween 20 (DPBST), adsorb the magnetic beads with a magnetic stand, discard the supernatant, and set aside; Dilute the CD122 protein (Sinobiological inc) to 100 μl with DPBST and mix it with the washed magnetic beads, rotate and incubate at room temperature for 30 minutes, and after incubation, gently wash twice with 200 μl of PBST. Fix the negative screening protein IgG1-FC (Sino biological inc) in the same way.

[0068] 2.2 Library screening: Dissolve the ssDNA library in DPBS (Solarbio), aliquot it and place it in a PCR instrument for denaturation and renaturation. The PCR program is as follows: Heat at 95°C for 10 min, incubate at 4°C for 5 min, and after incubating at room temperature for 15 min, add 0.02% TweenTM 20. Incubate with magnetic beads immobilized with the positive screening protein at room temperature for 30 min. After incubation, collect the magnetic beads, transfer them to a clean centrifuge tube, wash the magnetic beads 3 times with 200 μl of DPBST, collect the magnetic beads, resuspend them in 200 μl of enzyme-free water, incubate in a boiling water bath for 10 min, adsorb the magnetic beads with a magnetic stand, and collect the supernatant and store it in a 4°C refrigerator. In the second round of screening, use the magnetic beads for negative screening. First, react the library recovered in the first round with the magnetic beads for a period of time and then incubate with the magnetic beads immobilized with the positive screening protein. The reaction conditions are the same as those in the first round.

[0069] 2.3 Single-stranded library preparation:

[0070] Mix the supernatant collected in 2.2 with 2 ml of PCR mix (Vazyme) and dispense it in aliquots, and perform PCR amplification at 100 μl per tube (the primers are the library amplification primers described above). The PCR program is set as follows: 95°C, 5 min; 95°C, 30 s, 60°C, 30 s, 72°C, 15 s, 10 - 18 cycles; 72°C, 5 min. Add 100 μl of streptavidin magnetic beads (Anhui Uniprom Biotechnology Co., Ltd.) that have been washed with PBST to each 1 ml of the amplified product and incubate with rotation at room temperature for 15 min; discard the supernatant after incubation and wash the magnetic beads 3 times with PBST; add 100 μl of 40 mM NaOH solution to the magnetic beads, perform alkaline denaturation for 1 min, recover the supernatant, neutralize it with an appropriate amount of 1 M HCl, then add 100 μl of DPBS solution and mix well, and desalt it with a 3k ultrafiltration tube (Millipore) as the next-round library.

[0071] 2.4 Monitoring the enrichment degree of each round of screening library by flow cytometry

[0072] Denature and renature the single-stranded ssDNA libraries of the 0th, 5th, 7th, and 8th rounds labeled with 200 nM FAM and incubate with Protein G magnetic beads immobilized with CD122 protein at room temperature with rotation for 30 min. At the same time, use blank magnetic beads as a negative control. After incubation, wash 3 times with PBST, resuspend the magnetic beads in 300 μl of PBS, and count 10,000 events with a flow cytometer (Beckman Coulter, CytoFLEX), and record the fluorescence signal of the magnetic beads.

[0073] 3. Multiple rounds of screening and high-throughput sequencing

[0074] The screening was carried out in 8 rounds. During the library screening process, the input amount of the library was gradually reduced round by round to increase the screening pressure. At the same time, starting from the second round, magnetic beads, IgG1-FC protein or serum were used as reverse screening to reduce non-specific binding. And fetal bovine serum (FBS) was added starting from the 7th round to increase the specificity and stability of the screening library (Table 1). The binding of each round of the library to the target protein was detected by flow cytometry. The results showed that there was an obvious fluorescence shift in the library starting from the 5th round, reaching the highest at the 7th round, and the fluorescence shift in the 8th round was weaker than that in the 7th round, indicating that the binding tended to saturation and met the sequencing requirements. The library of the 7th round was amplified and the product was sent to Sangon Biotech (Shanghai) Co., Ltd. for high-throughput sequencing analysis.

[0075] A total of 158,606 intermediate sequences were obtained from the high-throughput sequencing results of the 7th round. Three sequences with strong binding to CD122 protein were identified in the subsequent screening and identification, which were the nucleotide sequences shown in SEQ ID NO:1, SEQ ID NO:3, and SEQ ID NO:5, and they were named CA001, CA006, and CA015 respectively.

[0076] Example 2: Detection of the nucleic acid aptamer binding to CD122 protein by flow cytometry

[0077] The binding of the selected sequencing strands to CD122 protein was detected by flow cytometry:

[0078] 1. Take 5 μl of Protein G magnetic beads, wash them with DPBST, and incubate with CD122 protein at room temperature for 30 min to immobilize the protein;

[0079] 2. After washing, incubate the magnetic beads with the candidate sequences in Example 1 labeled with 500 nM FAM at room temperature with rotation for 30 min, and use the library labeled with FAM as a control at the same time;

[0080] 3. After washing 3 times with DPBST, resuspend in 300 μl of DPBS, and detect the fluorescence intensity of the magnetic beads by a flow cytometer (Beckman Coulter, CytoFLEX) by counting 10,000 particles.

[0081] The binding of each candidate nucleic acid aptamer to CD122 protein is as Figure 2 shown. Compared with the control group, all three nucleic acid aptamers have obvious binding shift signals with CD122 protein.

[0082] Example 3: Detection of the affinity of candidate nucleic acid aptamers and their truncations to CD122 protein by biolayer interferometry (BLI)

[0083] Based on the preliminary screening of nucleic acid aptamers that bind to the CD122 protein in Example 2, these 3 sequences were further truncated and optimized to reduce the synthesis cost for later development and application. The truncated nucleic acid aptamers were named: CA001-S1 (SEQ ID NO:2), CA006-S1 (SEQ ID NO:4), CA015-S1 (SEQ ID NO:6).

[0084] The binding of the selected nucleic acid aptamers and their truncated aptamers to the CD122 protein was detected by BLI technology. We used a streptavidin sensor (SA sensor, Sartorius) to perform affinity detection through the Octet platform ( RH96 system, Sartorius).

[0085] 1. Entrusted Sangon Biotech (Shanghai) Co., Ltd. to synthesize biotin-labeled nucleic acid aptamers CA001, CA001-S1, CA006, CA006-S1, CA015, CA015-S1 and a random control strand. The synthesized aptamers were diluted to 100 nM with DPBST for standby;

[0086] 2. The biotin-labeled nucleic acid aptamers were pre-treated by denaturation and renaturation before the BLI experiment. 200 μl was added to each well of a 96-well plate and immobilized on a pre-wetted streptavidin sensor. After equilibration, it was then allowed to bind and dissociate with 500 nM CD122 protein. The reaction temperature for the whole process was 25 °C, and it was shaken at 1000 rpm in the 96-well plate. All running buffers and dilution buffers were DPBST;

[0087] 3. The RH96 system program was set as follows: (1) Sensor equilibration for 60 s; (2) Nucleic acid aptamer coupling for 240 s; (3) Sensor equilibration for 180 s; (4) CD122 protein binding for 240 s; (5) CD122 protein dissociation for 300 s. The RH96 system can detect 8 channels at a time, and 7 nucleic acid aptamers can be simultaneously detected for binding. The running buffer was used as a blank control well.

[0088] 4. After subtracting the buffer signal using the Octet data analysis software ( Analysis Studio 13.0) and normalizing the response data obtained from the reaction surface, a single affinity parameter Kd was obtained.

[0089] The binding of the BLI-detected candidate nucleic acid aptamers and their truncated forms to the CD122 protein is as follows Figures 3 to 5As shown, the full lengths of the three nucleic acid aptamers CA001, CA006, and CA015 all have relatively high binding signals with the CD122 protein, while the control strand does not bind to the CD122 protein ( Figure 6 ), which corresponds to the flow cytometry results of Example 2. The truncated forms of each nucleic acid aptamer show higher response signals and stronger affinities when binding to the CD122 protein (Table 2), which may be related to the sequence structure. According to the prediction of the secondary structure of the candidate nucleic acid aptamers by software, the key binding regions are mainly random region sequences, while the fixed sequences at both ends have less influence on binding. Among them, CA006-S1 has only 29 bases after truncation, which is the shortest binding truncated form among the selected sequences.

[0090] Table 2 Affinities of CA001, CA006, and CA015 and Their Truncated Sequences

[0091]

[0092] Example 4: Dissociation Equilibrium Constant K of Nucleic Acid Aptamers Binding to CD122 Protein D Determination

[0093] For the candidate nucleic acid aptamers and their truncated forms with binding signals in Example 3, we detected the accurate kinetic parameter K by BLI D , using the RH96 system for multi-cycle kinetic detection.

[0094] 1. Dilute the biotin-labeled nucleic acid aptamers CA001, CA001-S1, CA006, CA006-S1, CA015, and CA015-S1 to 100 nM with DPBST;

[0095] 2. The diluted nucleic acid aptamers are pretreated by denaturation and renaturation before the BLI experiment. Add 200 μl per well to a 96-well plate, fix them to the pre-wetted streptavidin sensor, and then bind and dissociate with the gradient-diluted CD122 protein respectively after equilibration. The reaction temperature for the whole process is 25 °C, and it is shaken at a speed of 1000 rpm in the 96-well plate. All running buffers and dilution buffers are DPBST;

[0096] 3. The RH96 system program is set as follows: (1) Sensor equilibration for 60 s; (2) Nucleic acid aptamer coupling for 180 s; (3) Sensor equilibration for 180 s; (4) CA001, CA006, CA015, and CA006-S1 bind to the CD122 protein for 180 s, and CA001-S1 and CA015-S1 bind to the CD122 protein for 90 s; (5) CD122 protein dissociation for 300 s. Use the running buffer as the blank control well.

[0097] 4. Use the Octet data analysis software ( Analysis Studio 13.0) to fit the binding-response data with a 1:1 interaction model to obtain the dissociation equilibrium constant K of the aptamer and the target molecule D .

[0098] The dissociation equilibrium constants K of the binding of each candidate aptamer and its truncation to the CD122 protein D are as Figures 7 - 9 shown. They all have a high affinity for the CD122 protein. The specific values are: the dissociation equilibrium constants K of CA001 and CA001-S1 D are 0.67 nM and 0.8 nM respectively, the dissociation equilibrium constants K of CA006 and CA006-S1 D are 1.6 nM and 2.2 nM respectively, and the dissociation equilibrium constants K of CA015 and CA015-S1 D are 1.43 nM and 0.61 nM respectively. Experiments show that after truncation, the affinity constants of the selected aptamers CA001 and CA006 do not change significantly. The affinity of the CA015-S1 truncation (40 nt) is significantly improved compared to CA015. At the same time, it is also the sequence with the lowest dissociation equilibrium constant K D (the smaller the K D value, the greater the affinity). The sequence length of CA001-S1 is 35 nt, and the K D value is not much different from that of CA015-S1. Considering the later cost, CA001-S1 is the preferred sequence.

[0099] Example 5: Specificity analysis of aptamer

[0100] For the aptamers and their truncations with high affinity for the CD122 protein, we detected their binding specificity by BLI. After diluting the biotin-labeled aptamers CA001, CA001-S1, CA006, CA006-S1, CA015, and CA015-S1 to 100 nM with DPBST, they were immobilized on a streptavidin sensor and were respectively bound and dissociated with different recombinant proteins IgG1-Fc, CD25, and CD132 (Sino biological inc). The whole reaction process was the same as that in Example 4.

[0101] The RH96 system program was set as follows:

[0102] (1) Each aptamer was bound to IgG1-Fc for 240 s and dissociated for 300 s;

[0103] (2) Each nucleic acid aptamer binds to CD25 and CD132 for 120 s and dissociates for 180 s;

[0104] The affinity of each candidate nucleic acid aptamer and its truncation for IgG1-Fc, CD25, and CD132 proteins was detected as Figures 10 - 12 shown. The binding response signals of each candidate nucleic acid aptamer to IgG1-Fc, CD25, and CD132 proteins were all within 0.1, indicating that the nucleic acid aptamers CA001, CA001-S1, CA006, CA006-S1, CA015, and CA015-S1 do not bind to the control protein IgG1-Fc or the homologous proteins CD25 and CD132, and have good binding specificity.

[0105] Example 6: Detection of the binding of nucleic acid aptamers at the cellular level by flow cytometry

[0106] To detect the subsequent downstream applications of the screened nucleic acid aptamers, the binding ability of CA001, CA006, and CA015 to CHO-S cells (Chinese hamster ovary cells) overexpressing CD122 protein was verified by flow cytometry.

[0107] 1. Seed CHO-S cells in a 6 cm culture dish one day in advance and perform transfection when the cell density reaches 70%-80%;

[0108] 2. Mix Optim-MEM medium with pCMV3-CD122-GFPSpark plasmid (Sino biological inc) and Lipo8000 TM transfection reagent (Beyotime Biotechnology) and add it to the 6 cm culture dish, and continue to culture for 24 h;

[0109] 3. After 24 h of cell transfection, use chemically defined cell digestive solution for digestion (using untransfected CHO-S cells as a control at the same time). After cell counting, aliquot 4x10 5 cells / tube into 1.5 mL centrifuge tubes and centrifuge to discard the supernatant;

[0110] 4. Dilute CY5-modified CA001, CA006, and CA015 nucleic acid aptamers to 500 nM with DPBS respectively. After denaturation and renaturation, add them to the centrifuge tubes aliquoted in the previous step, and incubate in the dark on a shaker at 4 °C for 30 min;

[0111] 5. After incubation, centrifuge to discard the supernatant, wash 3 times, resuspend in 300 ul DPBS, and analyze the binding of each nucleic acid aptamer by counting 10,000 events using a flow cytometer (Beckman Coulter, CytoFLEX).

[0112] The results are as follows Figure 13 As shown, obvious fluorescence shift occurred after adding CY5-labeled CA001, CA006, and CA015 aptamers to CHO-S cells transfected with CD122 protein, while no obvious change was observed in untransfected CHO-S cells. The experiment indicated that CA001, CA006, and CA015 aptamers could bind to cells expressing CD122.

[0113] The nucleotide sequences used in the examples are as follows:

[0114] SEQ ID No.1 (CA001)

[0115] TTACGTCAAGGTGTCACTCCGGGTACAGGCGTCGGAACCTCGCGGAG TGATGTTTGAGCAGAAGCATCTCTTTGGCGTG;

[0116] SEQ ID No.2 (CA001-S1:)

[0117] CACTCCGGGTACAGGCGTCGGAACCTCGCGGAGTG;

[0118] SEQ ID No.3 (CA006)

[0119] TTACGTCAAGGTGTCACTCCGGGGTAAGGGTGTCGGGACCTCGCCGG TGGGGAACCTTGGGAAGCATCTCTTTGGCGTG;

[0120] SEQ ID No.4 (CA006-S1:)

[0121] CCGGGGTAAGGGTGTCGGGACCTCGCCGG;

[0122] SEQ ID No.5 (CA015)

[0123] TTACGTCAAGGTGTCACTCCGGGAACATGGGTAAAGGCGTCGGAACC TCGCAGTTCCCGGGAAGCATCTCTTTGGCGTG;

[0124] SEQ ID No.6 (CA015-S1)

[0125] CGGGAACATGGGTAAAGGCGTCGGAACCTCGCAGTTCCCG.

[0126] The above are only the preferred embodiments of the present invention and are not intended to limit the scope of implementation of the present invention; any modifications or equivalent replacements made to the present invention without departing from the spirit and scope of the present invention shall be covered by the protection scope of the claims of the present invention.

Claims

1. A nucleic acid aptamer that binds to CD122 protein, characterized in that: It includes a nucleotide sequence as shown in any one of SEQ ID NO.1 to SEQ ID NO.6, and the nucleotide sequence can specifically bind to the CD122 protein.

2. A nucleic acid aptamer binding to CD122 protein according to claim 1, characterized in that: The nucleotide sequence has at least 25% homology to any one of SEQ ID NO.1 to SEQ ID NO.

6.

3. A nucleic acid aptamer binding to CD122 protein according to claim 1, characterized in that: The nucleotide sequence is an RNA sequence transcribed from the nucleotide sequence shown in any one of SEQ ID NO.1 to SEQ ID NO.

6.

4. A nucleic acid aptamer binding to CD122 protein according to claim 1, characterized in that: modifying the nucleotide sequence; The modification includes at least one of the following methods: 1) group modification: fluorescent or quenching group, amino group, carboxyl group, aldehyde group, thiol group, azide; 2) nucleotide variant modification: phosphorylation, thio modification, 2-aminopurine substitution modification, deoxyuridine modification, 3' end inversion dT / dG modification, locked nucleic acid modification, 2-methoxy modification, peptide nucleic acid.

5. A method for screening nucleic acid aptamers that bind to CD122 protein, characterized in that: The following steps are involved: (1) Synthesizing random single-stranded DNA library and primers; (2) Magnetic bead screening: A batch of nucleic acid aptamers with high affinity binding to CD122 protein were obtained by Protein G magnetic bead screening; (3) High-throughput sequencing and sequence analysis.

6. The method for screening a nucleic acid aptamer that binds to CD122 protein according to claim 5, characterized in that: In step (2), CD122 protein with IgG1-FC tag is fixed by Protein G magnetic beads, and at least 8 rounds of screening are performed. From the second round, magnetic beads and control proteins are counter-screened, and fetal bovine serum is added from the seventh round.

7. A conjugate of a nucleic acid aptamer, characterized in that: The conjugate is composed of the nucleic acid aptamer according to any one of claims 1 to 4 connected to a signal molecule or an active molecule.

8. A nucleic acid aptamer conjugate according to claim 7, characterized in that: One or more of radioactive substances, therapeutic substances, proteins, sugar residues, lipids, siRNA, miRNA, nanomaterials, biotin, digoxin, and vitamins are linked to the nucleic acid aptamer.

9. The use of the nucleic acid aptamer or conjugate according to any one of claims 1 to 8, characterized in that: Use it for: S1. Detect and purify CD122 protein; S2. Imaging of CD122 protein; S3. Prepare drugs targeting CD122 protein; S4. Multifunctional aptamers.

Images