Application of Japanese eelgrass ZjPIP1 gene in improvement of plant stress resistance

Abstract

The invention discloses application of a Japanese eelgrass ZjPIP1 gene in improvement of plant stress resistance, and belongs to the technical field of genetic engineering. The nucleotide sequence of the Japanese eelgrass ZjPIP1 gene disclosed by the invention is as shown in SEQ ID No. 1. Constructing a plant expression vector of the ZjPIP1 gene, and transforming arabidopsis thaliana; the resistance of arabidopsis thaliana to high temperature stress, drought stress and high salt stress can be obviously improved. Therefore, the ZjPIP1 gene has an important application prospect in improvement of plant stress resistance.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to the application of genes of Zostera japonica in improving plant stress resistance. ZjPIP1 Background Art

[0002] Organisms often face various adverse conditions (such as drought, high salt, high temperature, etc.) stress in the natural environment; these adverse conditions can inhibit the growth of organisms and even lead to the death of organisms. With the continuous deterioration of the environment, adversity stress such as high salt has become a worldwide problem.

[0003] The currently rapidly developing genetic engineering technology provides a new way for biological genetic improvement. As one of the important supporting species of seagrass beds, Zostera japonica is widely distributed in the intertidal zone of coastal areas and is easily affected by abiotic stress fluctuations such as water loss, increased salinity, and increased temperature. It is an excellent material for obtaining genes for plant resistance to abiotic stress. Cloning genes related to resistance to adversity stress from Zostera japonica and genetically transforming plants lay the foundation for cultivating new biological varieties with multiple stress resistances. Summary of the Invention

[0004] Aiming at the problems existing in the prior art, the purpose of the present invention is to provide the application of genes of Zostera japonica in improving plant stress resistance. ZjPIP1

[0005] To achieve the above purpose, the present invention adopts the following technical solutions: The application of genes of Zostera japonica in improving plant stress resistance, and the nucleic acid sequence of the genes of Zostera japonica is as shown in SEQ ID No.1. ZjPIP1 ZjPIP1

[0006] On the basis of the above solution, by increasing the expression level of genes of Zostera japonica in plants, the resistance of plants to adversity stress is improved. ZjPIP1

[0007] On the basis of the above solution, by constructing a plant expression vector of genes of Zostera japonica, transforming plants to express it in plants, and increasing the expression level of genes in plants. ZjPIP1 ZjPIP1

[0008] On the basis of the above solution, the method of transforming plants is one of agrobacterium-mediated method, gene gun method, electrotransformation method, PEG method, and liposome method.

[0009] On the basis of the above solution, the agrobacterium is Agrobacterium tumefaciens or Agrobacterium rhizogenes.

[0010] ​​​​​​​On the basis of the above - mentioned solution, the stress resistance is the resistance ability to high - temperature stress, high - salt stress and / or drought stress.

[0011] On the basis of the above - mentioned solution, the plant is Zostera japonica or Arabidopsis thaliana.

[0012] Advantages of the technical solution of the present invention: The present invention cloned a gene related to plant stress resistance from Zostera japonica ZjPIP1 , constructed ZjPIP1 a plant expression vector of the gene, and transformed Arabidopsis thaliana; The results showed that: The morphological development of Arabidopsis thaliana plants overexpressing ZjPIP1 the gene was normal. Under stress conditions, the growth of Arabidopsis thaliana overexpressing ZjPIP1 the gene was significantly better than that of wild - type Arabidopsis thaliana; Arabidopsis thaliana seedlings overexpressing ZjPIP1 the gene could resist at least high - temperature stress of 30 °C or high - salt stress of 150 mM NaCl or mannitol stress of 200 mM. In summary, ZjPIP1 the gene has important application prospects in improving plant stress resistance. Description of the Drawings

[0013] Figure 1 Changes in the expression level of ZjPIP1 the gene in Zostera japonica after high - salt and high - temperature stress treatments (the left figure is for high - temperature stress and the right figure is for high - salt stress); Figure 2 Growth conditions of Columbia wild - type Arabidopsis thaliana and Arabidopsis thaliana seedlings overexpressing ZjPIP1 the gene under normal conditions; Figure 3 Growth conditions of Columbia wild - type Arabidopsis thaliana and Arabidopsis thaliana seedlings overexpressing ZjPIP1 the gene after high - temperature stress treatment; Figure 4 Growth conditions of Columbia wild - type Arabidopsis thaliana and Arabidopsis thaliana seedlings overexpressing ZjPIP1 the gene after drought stress treatment; Figure 5 Growth conditions of Columbia wild - type Arabidopsis thaliana and Arabidopsis thaliana seedlings overexpressing ZjPIP1 the gene after high - salt stress treatment; Figure 6 Phenotype observation of Columbia wild - type Arabidopsis thaliana and Arabidopsis thaliana plants overexpressing ZjPIP1 the gene under stress conditions; Figure 7 Percentage of water content in the leaf tissue of Columbia wild - type Arabidopsis thaliana and Arabidopsis thaliana plants overexpressing ZjPIP1 the gene to its saturated water content under stress conditions; Figure 8Under stress conditions, the results of NBT and DAB staining of leaves of wild-type Arabidopsis thaliana (Columbia) and Arabidopsis thaliana overexpressing ZjPIP1 gene; Figure 9 Under stress conditions, the H2O2 accumulation in leaves of wild-type Arabidopsis thaliana (Columbia) and Arabidopsis thaliana overexpressing ZjPIP1 gene; Figure 10 Under stress conditions, the catalase activity in leaves of wild-type Arabidopsis thaliana (Columbia) and Arabidopsis thaliana overexpressing ZjPIP1 gene; Figure 11 Under stress conditions, the MDA content in leaves of wild-type Arabidopsis thaliana (Columbia) and Arabidopsis thaliana overexpressing ZjPIP1 gene. Specific implementation mode

[0014] The terms used in the present invention generally have the meanings commonly understood by those of ordinary skill in the art, unless otherwise specified. The present invention will be further described in detail below with reference to specific examples and data. The following examples are only for illustrating the present invention and do not limit the scope of the present invention in any way.

[0015] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in the art or according to the product specifications. The test materials, reagents, drugs, etc. used in the following examples can be obtained through general channels unless otherwise specified.

[0016] In the following examples: Zostera japonica was provided by the Marine Ecology Laboratory of the College of Marine Life Sciences, Ocean University of China; Escherichia coli DH5α was purchased from Shanghai Ruixing Gene Technology Co., Ltd.; The plant expression vector Super1300 was purchased from Vike (Qingdao) Biotechnology Co., Ltd.; Agrobacterium strain GV3101 was purchased from Vike (Qingdao) Biotechnology Co., Ltd.; Wild-type Arabidopsis thaliana (Columbia) was purchased from Vike (Qingdao) Biotechnology Co., Ltd.

[0017] Example 1 ZjPIP1 Cloning of gene Total RNA of Zostera japonica was extracted and reverse-transcribed into cDNA as a template. Specific primers ( ZjPIP1 -F and ZjPIP1 -R) were used for PCR amplification; the nucleic acid sequence of the ZjPIP1 gene obtained by cloning is shown in SEQ ID No. 1, and the amino acid sequence encoded by it is shown in SEQ ID No. 2.

[0018] The PCR reaction system was as follows: 2 μL of cDNA, 25 μL of 2× Buffer, 4 μL of 10 pM dNTP, 2 μL each of 10 μM forward / reverse primers, 0.5 μL of 5 U / μL PrimerSTAR HS DNA polymerase, and 14.5 μL of ddH2O. After loading the samples on ice, they were mixed well.

[0019] The PCR reaction conditions were as follows: 98°C for 3 min; 98°C for 5 sec, 56°C for 15 sec; 72°C for 30 sec, 35 cycles; 72°C for 5 min.

[0020] SEQ ID No.1 (5’→3’): ATGGACACCAAACTCGAGAGTTCATCGGCGCCGGAGATGGAGAGAGAACATGGAGCGGAAAAAGAGTACACCGATCCCGAAGCAACTCCATGGATCGATGTGAGGGAACTCAATTGTTGGCCCTTGTACCGTGCCGTGATCACCGAGTTTGTGGCAACAATGGTTTTCCTTTACATCGCCGTGACTGCTTTAGTCGGGTACAAAAATGAATCAAGCAAACACAACAACATAGGTCTGCTTGGCATCGCATGGGTGTTCGGAGGCATGATCTTCGTGTTAGTCTATTGCACCGCCGGTATCTCGGGAGGTCATCTCAACCCAGCAGTTACCTTCGGTATGCTTATCGCACGGAAGTGCTCTCTTCCGCGCGCCTTGATGTACGTGATAGCGCAGTGTTTGGGTGCTGTTTGCGGGGTTGGTTTCGTCAAAGTCACCTCCGGAGTAGACATCTACCGTTCCGTCGGAGGGGGTGCCAATTCAGTGTCAGATGGGTACACTAATGGTTCTGCCCTCGGAGCGGAGATTCTGGGGACTTTCGTTCTAATTTTCACCATTTTCTCGGCGACGGATCCCAAGAGAAAAGACAGAGACTCTCACGTCCCGACTCTCGCACCGCTGGTGATAGGGTTCGCTGTCTTCATGGTGCACTTAGGTACGATTAGTATCGGAGGAACGGGTATTAATCCGGCGAGGAGCTTTGGAGCGGCTGTTGTTTACAATAATCACCAGGCTTGGAGTGAACTTTGGATCTTTGTTGTCGGACCGTTGCTTGGATCGCTTATAGCTACTTCATTCCACCAGCTTGTCATCCGGGCATCCAATACCAAAAAGATCGTCAATTCTTTTGCGAGTCCATGA SEQ ID No.2: MDTKLESSSAPEMEREHGAEKEYTDPEATPWIDVRELNCWPLYRAVITEFVATMVFLYIAVTALVGYKNESSKHNNIGLLGIAWVFGGMIFVLVYCTAGISGGHLNPAVTFGMLIARKCSLPRALMYVIAQCLGAVCGVGFVKVTSGVDIYRSVGGGANSVSDGYTNGSALGAEILGTFVLIFTIFSATDPKRKDRDSHVPTLAPLVIGFAVFMVHLGTISIGGTGINPARSFGAAVVYNNHQAWSELWIFVVGPLLGSLIATSFHQLVIRASNTKKIVNSFASP The ZjPIP1 -F and ZjPIP1 -R primer sequences are shown in SEQ ID No. 3 and SEQ ID No. 4.

[0021] ZjPIP1 -F: 5’-ATGGACACCAAACTCGAGAGT-3’ (SEQ ID No. 3); ZjPIP1 -R: 5’-TCATGGACTCGCAAAAGAATT-3’ (SEQ ID No. 4).

[0022] Example 2 Changes in the expression levels of genes in Zostera japonica after high-salt and high-temperature stress treatments ZjPIP1 High-salt stress treatment: Based on natural seawater, pure water or different masses of NaCl (99.5% analytical pure, Sinopharm, China) were added to artificially adjust the salinity of the culture environment. A total of 3 salinity levels were set for the stress test, namely 30‰ (CK30), 50‰ (HS50), and 70‰ (HS70). Since the salinity of natural seawater is between 29 - 32‰, the 30‰ (CK30) group was selected as the control group. Under the high-salt stress test system, Zostera japonica was cultured for 5 days at a culture temperature of 20 ± 2°C.

[0023] High-temperature stress treatment: Based on natural seawater, Zostera japonica was cultured at 20°C, 30°C, and 30°C. The 20°C group was set as the control group, and Zostera japonica was cultured for 7 hours at a culture salinity of 30‰.

[0024] Cover the roots and rhizomes of Zostera japonica with washed and disinfected gravel, plant them in transparent PVC pots, and evenly place the planted pots in a glass device containing seawater with different salinities and temperatures. Put 10 Zostera japonica plants with similar growth conditions in each pot. The gravel used for planting was washed twice with seawater of the corresponding salinity and temperature before use. The seawater and planted pots in the high-salt stress treatment group need to be replaced every 2 days, and the gravel and cultivation device are cleaned to prevent the normal growth of seagrass from being affected by nutrient deficiency or excessive proliferation of epiphytic bacteria.

[0025] Use a kit to extract the total RNA from the leaves of Zostera japonica after high-salt and high-temperature stress treatments, and use an Agilent 2100 bioanalyzer and agarose gel electrophoresis to evaluate the quality and integrity of the samples. Enrich the mRNA in the Zostera japonica samples with Oligo(dT) magnetic beads, fragment it and add primers, and then use the NEB#7530 kit (New England Biolabs, USA) to reverse-transcribe the enriched mRNA into cDNA. Use AMPure XP Beads to purify the cDNA to obtain a cDNA library. The cDNA library was sequenced by Illumina Novaseq6000, and the raw data was filtered by FASTQ to obtain high-quality Clean Reads. The Clean Reads were aligned with the Zostera japonica genome assembled by our research group in the early stage using alignment software, and StringTie and RSEM software were used to reconstruct the transcripts and calculate the FPKM values (fragments per kilobase of transcript per million mapped reads) of the transcripts. Count ZjPIP1 the FPKM values of the genes, and the results are shown in Figure 1 .

[0026] It can be seen from Figure 1 that ZjPIP1 the expression level of the gene in the high-salt and high-temperature stress treatment groups was significantly higher than that in the control group, indicating that its expression is related to abiotic stress resistance.

[0027] Example 3 ZjPIP1 Construction of the gene plant expression vector and obtaining of recombinant strains Using the cDNA of Japanese eelgrass as a template, SacI and XbaI restriction sites were added to the upstream and downstream primers respectively (P1 and P2). The coding region of the ZjPIP1 gene with SacI and XbaI restriction sites at both ends was amplified by PCR. The PCR product was recovered and ligated with the cloning vector pMD18-T (purchased from TaKaRa) under the action of T4 DNA ligase. The ligation product was transformed into Escherichia coli DH5α to obtain ampicillin-resistant colonies. The recombinant plasmid was extracted and double-digested with SacI and XbaI, and the digested fragment containing ZjPIP1 the gene coding sequence was recovered and cloned into the corresponding restriction sites of the plant expression vector Super1300 to obtain the plant expression vector Super1300- ZjPIP1 .

[0028] The primers used were.

[0029] P1: 5'-ctagaggatccccggATGGACACCAAACTCGAGAGTTC-3' (SEQ ID No.5); P2: 5'-gatcggggaaattcgTCATGGACTCGCAAAAGAATTG-3' (SEQ ID No.6).

[0030] The Super1300- ZjPIP1 recombinant plasmid was transformed into Agrobacterium strain GV3101 competent cells by the liquid nitrogen freeze-thaw method, and the recombinant strain containing the recombinant plasmid was screened out.

[0031] Example 4 Constructing Arabidopsis thaliana overexpressing ZjPIP1 gene (1) Pick a single colony of the recombinant strain constructed in Example 3 and inoculate it into an LB (rifampicin 50 mg / L, kanamycin 50 mg / L) liquid medium. Culture at 28 °C and 180 rpm until OD600 = 0.5 - 0.8. Then transfer 2 mL of the bacterial liquid to 50 mL of LB (rifampicin 50 mg / L, kanamycin 50 mg / L) medium and culture until OD600 = 0.6 - 0.8. After centrifuging the bacterial liquid at 5000 rpm for 15 min, resuspend it with the same volume of liquid 1 / 2 MS (0.02% silwet L-77) for standby.

[0032] (2) Soak Arabidopsis thaliana seeds in 1% NaClO for 5 min and rinse them 4 - 6 times with sterile water. Sow them on the substrate soil.

[0033] (3) Select a healthy Arabidopsis plant in the early fruiting stage, and place it upside down with the pot on top of the container containing the Agrobacterium suspension prepared in step (1). Immerse the entire inflorescence in the Agrobacterium suspension for 20-30 seconds, and make sure that the leaves do not come into contact with the infiltration solution as much as possible. Remove the pot and place it horizontally in a dark box for about 24 hours, maintaining a certain humidity (relative humidity 60%). After 24 hours, place the treated Arabidopsis plants under light conditions of 22-25°C to allow them to grow normally, and harvest the seeds.

[0034] (4) Inoculate the harvested transgenic Arabidopsis seeds into 20 mL MS (hygromycin 30 mg / L) medium and culture at 22°C for about 1 week. Select the bright green and healthy Arabidopsis seedlings and transplant them into the matrix soil. Extract the genomic DNA of the transgenic plants and use the above vector sequence to design primers for PCR amplification. The correct identification is the overexpression ZjPIP1 genes of Arabidopsis thaliana.

[0035] The PCR reaction program was: 95°C, 5 min; 95°C, 50 s, 55°C, 50 s, 72°C, 1 min, 32 cycles; 72°C, 10 min.

[0036] The primers for identifying transgenic plants were P3: 5'-TTTCCTTTACATCGCCGTGAC-3' (SEQ ID No. 7); P4: 5'-GCAAACAGCACCCAAACACT-3' (SEQ ID No. 8).

[0037] (5) Seeds of T1 plants identified as positive by PCR were harvested, and the harvested transgenic Arabidopsis seeds were inoculated into 20 mL MS (30 mg / L hygromycin) medium. The ratio of positive plants to negative plants in each line was about 3:1. Arabidopsis seedlings that could grow normally on the screening medium were selected, transplanted into the matrix soil, and seeds were harvested from each plant to obtain T2 transgenic plants. Transgenic Arabidopsis seeds harvested from each plant were inoculated into 20 mL MS (30 mg / L hygromycin) medium, and transgenic plants whose seeds could germinate and grow on the screening medium were selected as homozygous lines, transplanted into the matrix soil, and seeds were harvested from each plant to obtain homozygous T3 transgenic plants.

[0038] Example 5 Overexpression ZjPIP1 Detection of stress resistance in Arabidopsis thaliana The overexpression obtained by the method of Example 3 ZjPIP1The seeds of Arabidopsis thaliana overexpressing the gene and Columbia wild-type Arabidopsis thaliana seeds were inoculated on 1 / 2 MS medium to germinate. After 1 week, the seedlings were transferred to 1 / 2 MS medium containing 150 mM NaCl (simulating high-salt stress) or 200 mM mannitol (simulating drought stress), and cultured at 22 °C for 2 weeks. The growth of the seedlings was observed.

[0039] The overexpression obtained by the method of Example 3 ZjPIP1 The seeds of Arabidopsis thaliana overexpressing the gene and Columbia wild-type Arabidopsis thaliana seeds were inoculated on 1 / 2 MS medium to germinate. After 1 week, the seedlings were transferred to 1 / 2 MS medium and cultured at 30 °C (simulating high-temperature stress) for 2 weeks. The growth of the seedlings was observed.

[0040] The results are as Figures 2 - 5 shown. Under high-temperature, high-salt or drought stress conditions, the growth of Arabidopsis thaliana seedlings (OE1, OE2, OE3) overexpressing the ZjPIP1 gene was significantly better than that of Columbia wild-type Arabidopsis thaliana seedlings (WT). Therefore, Arabidopsis thaliana seedlings overexpressing the ZjPIP1 gene could at least tolerate 150 mM NaCl, 200 mM mannitol and high temperature of 30 °C.

[0041] The Arabidopsis thaliana seedlings of each line germinated on MS medium were transplanted into a substrate of mixed nutrient soil: vermiculite (3:1) and continued to be cultured. The Arabidopsis thaliana plants of each line were respectively subjected to normal culture (watering), salt stress treatment (irrigation with 150 mM NaCl), high-temperature stress treatment (30 °C) or drought stress (stopping watering). After 7 days, phenotypic observation was carried out, and the leaves were collected for the detection of physiological and biochemical indexes. The results are as Figure 6 shown. Under stress conditions, the growth of Arabidopsis thaliana (OE1, OE2, OE3) overexpressing the ZjPIP1 gene was also significantly better than that of wild-type Arabidopsis thaliana seedlings (WT).

[0042] Overexpression ZjPIP1 Water content detection of Arabidopsis thaliana overexpressing the gene Using the leaves of Arabidopsis thaliana plants overexpressing the ZjPIP1 gene treated by the above high-salt stress, high-temperature stress and drought stress methods as materials, the dry and fresh weights and relative water content (RWC) of Arabidopsis thaliana overexpressing the ZjPIP1 gene and Columbia wild-type Arabidopsis thaliana under different treatment conditions were measured. The fresh weights of the leaves or above-ground parts of Arabidopsis thaliana of each line under normal culture or stress treatment were weighed and recorded as W F ; The leaves were completely immersed in distilled water for 36 - 48 h until they fully absorbed water, and the surface water of the leaves was wiped dry and weighed, and the weight was recorded as W T ; The leaves or above-ground parts were transferred to a forced-air drying oven and dried at 80 °C to a constant weight, and the dry weight was weighed and recorded as WD According to the formula: RWC = (W F - W D ) / (W T - W D ) × 100%, calculate the percentage of the water content of the leaf tissue in its saturated water content. The results are as Figure 7 shown. After high-temperature stress, high-salt stress, and drought stress, the water content of the transgenic Arabidopsis thaliana lines is 1.36 times, 1.43 times, and 1.42 times that of the non-transgenic control, respectively.

[0043] Physiological index detection of Arabidopsis thaliana overexpressing ZjPIP1 gene To detect the accumulation of reactive oxygen species in the leaves of Arabidopsis thaliana lines overexpressing ZjPIP1 gene and the Columbia wild-type Arabidopsis thaliana control after stress treatment, NBT and DAB were used for staining and determination, and the results are as Figure 8 shown; among them, in the NBT staining result, the more blue parts on the leaf, the more the accumulation amount of O2 - ; the blue parts of the transgenic lines are less than those of the non-transgenic control (WT), indicating less accumulation amount of O2 - ; in the DAB staining result, the more brown parts on the leaf, the more the accumulation amount of H2O2; the brown parts of the overexpressing lines are less than those of the wild control (WT), indicating less accumulation amount of H2O2. Further, the H2O2 accumulation amount, H2O2 scavenging ability, and MDA content of the transgenic Arabidopsis thaliana lines and non-transgenic control leaves were measured, and the results are as Figures 9 - 11 shown; after high-salt stress, drought stress, and high-temperature stress, compared with the non-transgenic control, the H2O2 accumulation amount of the transgenic lines decreased by 60.88%, 75.90%, and 65.51% respectively ( Figure 9 ); the catalase activity of the transgenic lines increased by 1.81 times, 4.96 times, and 2.06 times respectively ( Figure 10 ); the MDA content decreased by 59.74%, 71.79%, and 49.98% respectively ( Figure 11 ).

[0044] The above are only the preferred embodiments of the present invention, and are not limitations to the present invention in other forms. Any person skilled in the art may use the disclosed technical content to make changes or modifications into equivalent embodiments with equivalent changes. However, any simple modification, equivalent change, and modification made to the above embodiments based on the technical essence of the present invention without departing from the technical solution content of the present invention still belong to the protection scope of the technical solution of the present invention.

Claims

1. Japanese eelgrass ZJPIP1 The application of the gene in improving plant stress resistance is characterized in that: Japanese eelgrass ZJPIP1 The nucleic acid sequence of the gene is shown in SEQ ID No.

1.

2. Japanese eelgrass according to claim 1 ZJPIP1 The application of the gene in improving plant stress resistance is characterized in that: Japanese eelgrass ZJPIP1 The expression level of the gene improves the plant's resistance to adverse stress.

3. Japanese eelgrass according to claim 2 ZJPIP1 The application of the gene in improving plant stress resistance is characterized in that: By constructing Japanese eelgrass ZJPIP1 Plant expression vectors of genes are used to transform plants so that they are expressed in plants and increase the expression of genes in plants. ZJPIP1 The expression level of the gene.

4. Japanese eel grass according to claim 3 ZJPIP1 The application of the gene in improving plant stress resistance is characterized in that: The method of transforming plants is one of Agrobacterium-mediated method, gene gun method, electric shock method, PEG method and liposome method.

5. Japanese eelgrass according to claim 4 ZJPIP1 The application of the gene in improving plant stress resistance is characterized in that: The Agrobacterium is Agrobacterium tumefaciens or Agrobacterium rhizogenes.

6. Japanese eelgrass according to any one of claims 1 to 5 ZJPIP1 The application of the gene in improving plant stress resistance is characterized in that: The stress resistance is the ability to resist high temperature stress, high salt stress and / or drought stress.

7. Japanese eelgrass according to claim 6 ZJPIP1 The application of the gene in improving plant stress resistance is characterized in that: The plant is Japanese eelgrass or Arabidopsis thaliana.

Images